Method for cultivating eggplants with high chlorogenic acid accumulation characteristic

Abstract

The invention discloses a method for cultivating an eggplant with a high chlorogenic acid accumulation characteristic. The transgenic eggplant with the high chlorogenic acid accumulation characteristic is cultivated by overexpressing a gene QD in the eggplant. The novel technology developed by the invention can obviously improve the content of chlorogenic acid in eggplants, and has important theoretical research value and wide practical application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a method for cultivating eggplants with high chlorogenic acid accumulation characteristics. Background Art

[0002] Eggplant (Solanum melongena L.) belongs to the genus Solanum of the Solanaceae family. It is one of the important vegetable crops in my country and is grown all over the country. As one of the important vegetable varieties in the adjustment of my country's agricultural planting structure, eggplant cultivation has reached a high level in terms of production level and industrialization. However, eggplant production still faces many "quality" challenges: improving eggplant's disease resistance and nutritional quality is an important goal of eggplant genetic breeding. At present, most eggplant varieties do not perform well in terms of disease and pest resistance. Eggplant pests and diseases such as Verticillium wilt occur frequently, which seriously affects the yield and quality of eggplant and restricts the development of the eggplant industry. In addition, with the improvement of living standards, people's consumption concepts have quietly changed, requiring not only delicious eggplants, but also nutritious and safe. Therefore, quality breeding of eggplants has received more and more attention.

[0003] Chlorogenic acid is a plant secondary metabolite with strong antioxidant, bactericidal and antiviral properties. It plays an important role in helping plants resist stress from adversity / diseases and pests and in human health care. The physiological role of chlorogenic acid in plants has always attracted much attention, and its important function in plants resisting stress from adversity has been supported by a large amount of research data. Studies have shown that chlorogenic acid can help eggplants cope with the invasion of Verticillium wilt pathogens. Verticillium wilt is one of the main diseases of eggplant production in my country. Once infected, it will cause huge losses to eggplant planting / production. Depending on the severity of the disease, it can lead to a 20%-60% reduction in yield of diseased plants. However, the infection of Verticillium wilt pathogens can activate the active oxygen scavenging mechanism in wild eggplant (Solanum torvum Sw.), increase the biosynthesis of various defense substances including chlorogenic acid, thereby achieving the purpose of assisting eggplants in resisting stress from diseases and pests. In addition, the appropriate intake of chlorogenic acid can reduce the incidence of cardiovascular diseases, type II diabetes and other diseases, and has a good health care effect on the human body. Due to its ability to assist plants in resisting stress and its health benefits for the human body, researchers hope to genetically improve eggplant through transgenic technology and increase the content of chlorogenic acid in the crop, thereby achieving the goal of enhancing the plant's disease resistance, increasing yield, and improving nutritional value. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a method for cultivating eggplants with high chlorogenic acid accumulation characteristics.

[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0006] A method for cultivating eggplants with high chlorogenic acid accumulation characteristics comprises overexpressing gene QD in eggplants to cultivate transgenic eggplants with high chlorogenic acid accumulation characteristics; the genomic DNA sequence of the gene QD is shown in SEQ ID NO: 1.

[0007] As a preferred technical solution of the present invention, the method comprises the following steps:

[0008] A. Construction of a recombinant expression vector containing gene QD;

[0009] B. Using the recombinant expression vector to transform Agrobacterium, and then using the Agrobacterium to infect eggplant, screen out transgenic eggplant strains with high chlorogenic acid accumulation characteristics compared with wild-type eggplant.

[0010] As a preferred technical solution of the present invention, in step A, the recombinant vector is constructed as a recombinant overexpression vector, which is constructed based on a backbone vector with a strong promoter.

[0011] As a preferred technical solution of the present invention, the recombinant expression vector is constructed based on a backbone vector having a CaMV35S promoter.

[0012] As a preferred technical solution of the present invention, the recombinant expression vector is constructed using pBI121 as a backbone vector.

[0013] As a preferred technical solution of the present invention, the target gene is inserted between the restriction endonuclease BamHI and restriction endonuclease SacI recognition sites on the pBI121 backbone vector to obtain a recombinant expression vector.

[0014] As a preferred technical solution of the present invention, the steps for constructing the recombinant expression vector are as follows: using the designed primers for PCR amplification to amplify the target gene fragment with the pBI121 homologous arms, selecting the BamHI and SacI restriction sites on pBI121 to cut the plasmid, and then using the homologous recombination method to construct an overexpression recombinant plasmid.

[0015] As a preferred technical solution of the present invention, in step B, after the recombinant expression vector is used to transform Agrobacterium, the recipient plant is transformed using Agrobacterium-mediated transformation technology.

[0016] As a preferred technical solution of the present invention, the specific operation process is as follows: after the constructed recombinant expression vector is used to transform Agrobacterium and obtain the correct colony, it is added to the YEB liquid culture medium with Rif and Kan resistance, shaken and cultured at 28°C for 36 hours, and then 1 mL of the bacterial solution is added to the culture medium containing the corresponding resistance to expand the culture; to obtain the Agrobacterium bacterial solution; the bacterial solution is centrifuged at 6000 rpm for 8 minutes, the bacterial body is resuspended with YEB and precipitated, and then centrifuged again, and the bacterial body is resuspended with MS salt, and the cultured cotyledons are placed in the bacterial solution and soaked for 10-15 minutes; after picking out, absorbing and placing on the co-culture medium for weak light culture for 48 hours, the cotyledons are transferred to the defective culture medium for screening, and after the callus tissue grows, the culture is continued until the seedlings grow out; the seedlings are cut and transferred to the rooting culture medium, and placed in the light culture box for continued growth until roots are formed, the seedlings are formed and the transgenic plants are obtained.

[0017] A method for cultivating eggplants with high chlorogenic acid accumulation characteristics, overexpressing an equivalent gene or a similar gene with the same function as the gene QD in eggplants, and cultivating transgenic eggplants with high chlorogenic acid accumulation characteristics.

[0018] The beneficial effect of adopting the above technical scheme is that the theoretical research and experimental research of the research group of the present invention have confirmed that by overexpressing the gene QD in eggplant, the content of chlorogenic acid in eggplant can be significantly increased. For the cultivation of eggplant with high chlorogenic acid accumulation characteristics, the technical achievements of the present invention have important theoretical research value and broad practical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the restriction endonuclease map of the cDNA sequence of the gene QD of the present invention;

[0020] Figure 2 It is the spectrum of the overexpression recombinant plasmid of the transgenic eggplant strain of the present invention;

[0021] Figure 3 It is a schematic diagram of the relative expression of NPTII (Neomycin Phosphotransferase II) (A) and the target gene (B) in the wild type and transgenic positive seedlings of the present invention;

[0022] Figure 4 is the HPLC chromatogram of chlorogenic acid in leaves (A) and fruits (B) of the wild-type and transgenic plants of the present invention;

[0023] Figure 5 Schematic diagram of the comparison of chlorogenic acid content in leaves (A) and fruits (B) of wild-type and transgenic plants of the present invention;

[0024] Figure 6It is a schematic diagram comparing the flesh browning phenotypes of the transgenic and wild-type eggplant strains of the present invention (30 minutes after slicing). DETAILED DESCRIPTION

[0025] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0026] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof.

[0027] It should also be understood that the term “and / or” used in the specification and appended claims refers to any and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0028] References to "one embodiment" or "some embodiments" etc. described in the specification of this application mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0029] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0030] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solution of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] Example 1

[0032] A method for cultivating eggplant with high chlorogenic acid accumulation characteristics, first constructing an overexpression vector containing the gene QD (such as Figure 2As shown), then the overexpression vector is used to transform Agrobacterium, and then the Agrobacterium is used to infect eggplant to screen out transgenic eggplant strains with high chlorogenic acid accumulation characteristics compared with wild-type eggplant. The specific process is:

[0033] (1) Construction of overexpression vector

[0034] ① Overexpression vector construction: The overexpression vector is a binary expression vector with pBI121 as the vector backbone, including the CaMV35S promoter, the complete open reading frame of the target gene, and terminator. The vector can use the CaMV35S promoter to drive the gene QD to be transcribed at a high level in the host plant and then overexpressed. The specific process of vector construction is as follows: PCR amplification is performed using the primer pair F1 (GGACTCTAGAGGATCCATGGGTTTCAAGCAGGACCTG) and R1 (GATCGGGGAAATTCGAGCTCTCAAAATTGCTCATATACAATCCTCCGCA) composed of SEQ ID NO.2 and SEQ ID NO.3 to amplify the gene QD with the homologous arm of pBI121, select the BamHI and SacI restriction sites on pBI121 to cut the plasmid, and then use the homologous recombination method to construct the overexpression recombinant plasmid. The constructed vector is transformed into Escherichia coli, and the positive transformants are screened by colony PCR. The plasmid was extracted and sequenced to obtain a recombinant plasmid for overexpression of the target gene for Agrobacterium transformation.

[0035] (2) Cultivation and identification of transgenic lines

[0036] ① Cultivation of transgenic lines: Put an appropriate amount of wild-type seeds into a 10mL centrifuge tube, add sterile water to soak for 12 hours, shake and wash 5 times, and pour out the water; add 75% alcohol, disinfect for 2 minutes, and then wash with sterile water 5 times; then use 1% sodium hypochlorite for disinfection for 15-20 minutes, and wash with sterile water in a clean bench for another 6 times. Finally, pour the seeds into a culture bottle with sterile water, place it at 4℃ for 24 hours, put it in a 28℃ incubator, and shake and culture at 100rpm until the seeds germinate. Under sterile conditions, transfer the sprouting seeds to solid MS culture medium and culture them in an incubator with light at 28℃ for 16 hours and darkness at 18℃ for 8 hours until the cotyledons unfold. Cut the cotyledons under sterile conditions, soak them in liquid MS culture medium for 40-60 minutes, and then spread them on solid MS culture medium containing IAA and ZT for 24 hours. After the experimental vector is transformed into Agrobacterium, the correct colony is obtained, and it is added to 30mL YEB liquid medium with Rif and Kan resistance, and cultured at 28℃ for 36h, and then 1mL of bacterial solution is added to 100mL medium containing corresponding resistance for expansion culture. The obtained Agrobacterium bacterial solution is centrifuged at 6000rpm for 8min, and the bacterial sediment is resuspended with YEB and centrifuged again, and the bacterial body is resuspended with MS salt, and the cultured cotyledons are placed in the bacterial solution and soaked for 10-15min. After picking out, blotted and placed on the co-culture medium for weak light culture for 48h, the cotyledons are transferred to the defective medium for screening, and the callus tissue is continued to be cultured until the seedlings grow out; the seedlings are cut and transferred to the rooting medium, and continue to grow at 28℃ light for 16h and 18℃ dark for 8h until roots are formed and the seedlings are formed.

[0037] ② Identification of transgenic strains: The transgenic material contains a plasmid containing the NPTII (NeomycinPhosphotransferase II, kanamycin resistance) gene. Therefore, the expression level of NPTII can be detected to determine whether the vector has been successfully transferred into the genetic material, such as Figure 3 Total RNA was extracted from the surviving transgenic plants and transcribed into cDNA using reverse transcriptase (eg Figure 1 ), using primers 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5 for PCR amplification, preparing a qPCR reaction system, adding the extracted cDNA, primers 2F (TCACTGAAGCGGGAAGGGA) and 2R (AGCCGGATCAAGCGTATGC) composed of SEQ ID NO.4 and SEQ ID NO.5, fluorescent dye and reaction buffer, performing qPCR reaction, real-time monitoring of the amplification of the NPTII gene, and the fluorescent signal obtained by qPCR can be used to calculate the relative expression of the NPTII gene. Usually, a non-transgenic control group needs to be set up for comparison.

[0038] Determine the integration status: If the expression level of the NPTII gene in the transgenic plant is significantly higher than that in the non-transgenic control, it means that the transgenic vector has been successfully integrated and expressed.

[0039] Example 2 Results Observation

[0040] Analysis of the expression content of the target gene in the overexpression strain: The expression level of gene QD in transgenic eggplant was detected by real-time fluorescence quantitative PCR (qPCR) technology. SmActin was selected as the internal reference gene in the qPCR reaction. SmActin internal reference primers: the internal reference primer pair 3F (GTCGGAATGGGACAGAAGGATG) and 3R (GTGCCTCAGTCAGGAGAACAGGGT) composed of SEQ ID NO.6 and SEQ ID NO.7 and the target gene quantitative primer pair 4F (CACATTGAACAACTTCAACTCCTAC) and 4R (CACGAACTCAACGTCC) composed of SEQ ID NO.8 and SEQ ID NO.9 were used to analyze the relative expression level of the target gene in transgenic eggplant.

[0041] ④ Quantitative analysis of chlorogenic acid content: Chlorogenic acid was extracted from the leaves and fruits of transgenic and wild-type eggplants using methanol extraction method, and quantitative analysis was performed using HPLC to study the effect of overexpression of gene QD on the synthesis and accumulation of chlorogenic acid in transgenic plants, thereby obtaining transgenic eggplant lines with high accumulation of chlorogenic acid, such as Figure 4 shown.

[0042] See also Figure 5 and Figure 6 , respectively, are the schematic diagrams of the comparison of chlorogenic acid content in leaves (A) and fruits (B) of wild-type and transgenic plants, and the schematic diagram of the comparison of flesh browning phenotype. The results showed that the chlorogenic acid content in the flesh and leaves of transgenic eggplant lines was significantly increased compared with the control wild-type eggplant. The specific chlorogenic acid content in the flesh and leaves of transgenic eggplant lines and the control wild-type eggplant is shown in Table 1.

[0043] Table 1

[0044]

[0045]

[0046] As shown in Table 1, the chlorogenic acid content in both leaves and pulp of transgenic eggplant strains far exceeds that of wild-type eggplant.

[0047] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that numerous changes, modifications, substitutions and variations may be made to the examples without departing from the principles and spirit of the invention, the scope of the invention being defined by the appended claims and their equivalents.

[0048] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0049] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A method for cultivating eggplants with high chlorogenic acid accumulation characteristics, characterized in that: Gene QD is overexpressed in eggplant to cultivate transgenic eggplant with high chlorogenic acid accumulation characteristics; the genomic DNA sequence of the gene QD is shown in SEQ ID NO:

1.

2. The method for cultivating eggplant with high chlorogenic acid accumulation characteristics according to claim 1, characterized in that: The method comprises the following steps: A. Construction of a recombinant expression vector containing gene QD; B. Using the recombinant expression vector to transform Agrobacterium, and then using the Agrobacterium to infect eggplant, screen out transgenic eggplant strains with high chlorogenic acid accumulation characteristics compared with wild-type eggplant.

3. The method for cultivating eggplant with high chlorogenic acid accumulation characteristics according to claim 2, characterized in that: In step A, the recombinant vector is constructed as a recombinant overexpression vector, which is constructed based on a backbone vector with a strong promoter.

4. The method for cultivating eggplant with high chlorogenic acid accumulation characteristics according to claim 3, characterized in that: The recombinant expression vector is constructed based on a backbone vector having a CaMV35S promoter.

5. The method for cultivating eggplant with high chlorogenic acid accumulation characteristics according to claim 4, characterized in that: The recombinant expression vector is constructed using pBI121 as a backbone vector.

6. The method for cultivating eggplant with high chlorogenic acid accumulation characteristics according to claim 5, characterized in that: The target gene was inserted between the restriction endonuclease BamHI and restriction endonuclease SacI recognition sites on the pBI121 backbone vector to obtain a recombinant expression vector.

7. The method for cultivating eggplant with high chlorogenic acid accumulation characteristics according to claim 6, characterized in that: The specific steps for constructing the recombinant expression vector are as follows: use the designed primers for PCR amplification to amplify the target gene fragment with the homologous arms of pBI121, select the BamHI and SacI restriction sites on pBI121 to cut the plasmid, and then use the homologous recombination method to construct an overexpression recombinant plasmid.

8. The method for cultivating eggplant with high chlorogenic acid accumulation characteristics according to claim 2, characterized in that: In step B, the recombinant expression vector is used to transform Agrobacterium, and then the Agrobacterium-mediated transformation technique is used to transform the recipient plant.

9. The method for cultivating eggplant with high chlorogenic acid accumulation characteristics according to claim 8, characterized in that: The specific operation process is as follows: after using the constructed recombinant expression vector to transform Agrobacterium and obtain the correct colony, add it to the YEB liquid culture medium with Rif and Kan resistance, shake and culture at 28°C for 36 hours, and then take 1mL of the bacterial solution and add it to the culture medium containing the corresponding resistance to expand the culture; to obtain the Agrobacterium bacterial solution; centrifuge the bacterial solution at 6000rpm for 8min, resuspend the bacterial sediment with YEB and centrifuge again, resuspend the bacterial body with MS salt, and soak the cultured cotyledons in the bacterial solution for 10-15min; pick out, blot and place on the co-culture medium for weak light culture for 48 hours, then transfer the cotyledons to the defective culture medium for screening, and continue to culture until the callus tissue grows out until the seedlings grow out; cut the seedlings and transfer them to the rooting culture medium, place them in the light incubator and continue to grow until roots are formed, the seedlings are formed and transgenic plants are obtained.

10. A method for cultivating eggplants with high chlorogenic acid accumulation characteristics, characterized in that: By overexpressing equivalent genes or similar genes with equivalent functions to gene QD in eggplant, transgenic eggplant with high chlorogenic acid accumulation characteristics was cultivated.

Images