Sucrose isomerase mutant and application thereof in production of isomaltulose

Abstract

The invention discloses a mutant with improved enzyme activity of sucrose isomerase and application of the mutant, and belongs to the technical field of genetic engineering and enzyme engineering in molecular biology. A known sucrose isomerase parent is subjected to molecular modification by utilizing a site-directed mutagenesis technology to obtain mutant enzymes T522S / K340D, D222H / K340D, G467N / K340D, T522S, K340D, D222H and G467N, and the catalytic activity of the series of mutants provided by the invention is increased by 10%-25% compared with that of original bacteria; the isomaltulose conversion rates of the combined mutants T522S / K340D, D222H / K340D and G467N / K340D are respectively increased by 2.3%, 1.5% and 1.3% compared with those of original bacteria, and the strain has good stability, can be used for biological preparation of isomaltulose and has potential application prospects.

Description

Technical Field

[0001] The invention relates to a sucrose isomerase mutant and application thereof in the production of isomaltulose, belonging to the technical field of enzyme engineering. Background Art

[0002] Isomaltulose, also known as palatinose monohydrate (C 12 H 22 O 11 ·H2O), sucrose isomer, is a disaccharide of glucose and fructose connected by α-1,6 glycosidic bond. White crystal, odorless, sweet, sweetness is about 42% of sucrose, no bad aftertaste, melting point 122-124°C, specific rotation α 20 D is +97.2°. Compared with sucrose, it is acid-resistant, heat-resistant, not easy to hydrolyze, and has poor thermal stability. It is easily soluble in water but insoluble in ethanol. The viscosity and solubility of its aqueous solution are lower than those of sucrose under the same conditions.

[0003] In terms of food processing, isomaltulose has extremely low hygroscopicity and is not easy to agglomerate. Therefore, it has free flowability in instant powders, maintains product texture in bread products, avoids increased viscosity and deformation of candies, and maintains the stability of the physical and chemical properties of various foods; its excellent acid resistance can remain stable in foods containing organic acids or vitamin C; most microorganisms cannot utilize isomaltulose, which is conducive to extending the shelf life of foods. Based on the above characteristics, isomaltulose can be used as a substitute for sucrose. Common methods for preparing isomaltulose include natural extraction, chemical synthesis, and biosynthesis. Isomaltulose naturally exists in sugarcane and honey, and its content is extremely low. The extraction method to obtain isomaltulose is not only complicated and costly, but also not conducive to industrial production. The chemical synthesis method has not been widely used because its by-products in the operation process are unknown and pollute the environment. The biosynthesis method includes microbial conversion method and enzyme conversion method. The former uses the microbial metabolic system to produce isomaltulose, while the latter uses the secretion of sucrose isomerase expressed by microorganisms, which is extracted and purified for sucrose isomerization to produce isomaltulose. The enzyme conversion method is divided into free enzyme conversion and immobilized enzyme conversion. The immobilized enzyme conversion method can quickly separate the enzyme and substrate, and can still maintain enzyme activity after multiple reactions, but the immobilized materials and processes still need further optimization research; in the free enzyme conversion method, the enzyme and substrate can fully contact, which can maximize the optimal reaction conditions of the enzyme and make the enzyme activity closest to the physiological state. Therefore, the enzyme method is generally chosen to produce isomaltulose.

[0004] Compared with other enzymes in the glucosidase family, the optimal enzyme reaction conditions of sucrose isomerase (SI) are closer to industrial production conditions and it is considered to be the enzyme with the most promising production prospects for isomaltulose. However, its enzyme activity is still low, resulting in low isomaltulose production. Therefore, it is necessary to further improve the ability of SI to catalyze the conversion of sucrose to isomaltulose. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a sucrose isomerase mutant and its application in the production of isomaltulose, aiming to solve the technical problem that the existing sucrose isomerase (SI) enzyme activity is still low, resulting in low isomaltulose production.

[0006] The first technical solution provided by the present invention is a sucrose isomerase mutant, wherein the mutant is a sucrose isomerase parent with one or more mutations at threonine at position 522, lysine at position 340, aspartic acid at position 222 and glycine at position 467, and the amino acid sequence of the parent is shown in SEQ ID NO.1.

[0007] In certain embodiments, the mutant is a mutant of the parent subjected to any of the following mutations (a)-(g):

[0008] (a) mutating the threonine T at position 522 to serine S;

[0009] (b) mutating the lysine K at position 340 to aspartic acid D;

[0010] (c) mutating the aspartic acid D at position 222 to histidine H;

[0011] (d) mutating glycine G at position 467 to asparagine N;

[0012] (e) mutating the threonine T at position 522 to serine S and the lysine K at position 340 to aspartic acid D;

[0013] (f) mutating the lysine K at position 340 to aspartic acid D and mutating the aspartic acid D at position 222 to histidine H;

[0014] (g) The lysine K at position 340 was mutated to aspartic acid D and the glycine G at position 467 was mutated to asparagine N.

[0015] In certain embodiments, the second technical solution provided by the present invention is a gene encoding the mutant described in the first technical solution.

[0016] The third technical solution provided by the present invention is an expression vector carrying the gene described in the second technical solution.

[0017] In certain embodiments, the vector includes but is not limited to a plasmid, and optionally but not limitedly, the plasmid is a pP43 series plasmid.

[0018] A further option is but not limited to the pP43NMK plasmid.

[0019] The fourth technical solution provided by the present invention is a recombinant cell expressing the mutant described in the first technical solution, or containing the gene described in the second technical solution, or transformed with the expression vector described in the third technical solution.

[0020] In certain embodiments, the recombinant cell is an animal cell, a plant cell, or a microbial cell.

[0021] In certain embodiments, the microbial cell is a fungus or a bacterium.

[0022] In certain embodiments, the recombinant cell is based on Bacillus subtilis as a starting strain.

[0023] In certain embodiments, the Bacillus subtilis is Bacillus subtilis WB800.

[0024] The fifth technical solution provided by the present invention is a method for preparing isomaltulose, which comprises using sucrose as a substrate and utilizing the mutant described in the first technical solution as a catalyst to form a catalytic system to catalytically generate isomaltulose.

[0025] In certain embodiments, in the catalytic system, the concentration of sucrose is 200 g / L, and the dosage of the catalyst is 20 U / g of mutant.

[0026] In certain embodiments, the catalytic temperature is 35-40° C., the catalytic time is 7-12 h, and optionally, the catalytic time is 7-8.5 h.

[0027] In certain embodiments, the pH of the catalytic system is 4 to 10, and can be 7.0.

[0028] In certain embodiments, the preparation method of the crude enzyme solution of the sucrose isomerase mutant is as follows: adding the recombinant cell seed solution to the fermentation medium, culturing for 24 to 48 hours at 20 to 37° C. and 150 to 250 rpm, and obtaining the crude enzyme solution after centrifugation; the recombinant cell uses Bacillus subtilis WB800 as the host cell and the plasmid pP43NMK as the expression vector to express the sucrose isomerase mutant described in the first technical solution.

[0029] In certain embodiments, the cell seed solution preparation method is: inoculating recombinant cells into LB liquid culture medium, and culturing in a shaking flask at 35-40° C., 150-250 rpm for 8-12 hours.

[0030] In certain embodiments, the method comprises: inoculating the cells into LB liquid culture medium, culturing in a shake flask at 37° C., 200 rpm for 12 h, inoculating the seed solution into a fermentation medium at an amount of 1% (v / v), and culturing the strain at 25-30° C., 150-250 rpm for not less than 24 h.

[0031] In certain embodiments, the fermentation medium contains: 10 g / L tryptone, 20 g / L yeast extract, 8 g / L sodium chloride, 15 g / L glucose, 1 g / L disodium hydrogen phosphate dodecahydrate, and 1 g / L magnesium sulfate heptahydrate.

[0032] The sixth technical solution provided by the present invention is the use of the sucrose isomerase mutant described in the first technical solution, the gene described in the second technical solution, the expression vector described in the third technical solution, the recombinant cell described in the fourth technical solution, or the method described in the fifth technical solution in the preparation of isomaltulose or a product containing isomaltulose.

[0033] The seventh technical solution provided by the present invention is the use of sucrose isomerase in the preparation of isomaltulose, using sucrose as a substrate and sucrose isomerase as a catalyst to form a catalytic system to catalyze the production of isomaltulose, and the amino acid sequence of the sucrose isomerase is shown in SEQ ID NO.1.

[0034] The technical effects of the present invention are as follows:

[0035] (1) The present invention uses sucrose isomerase from Serratia plymuthica as a parent enzyme for molecular modification, mutates at least one amino acid at position 522, position 222, position 340 or position 467, and obtains a series of mutants with improved enzyme activity.

[0036] (2) The specific enzyme activities of a series of sucrose isomerase mutants provided by the present invention are significantly improved compared with the wild enzyme. The specific enzyme activities of the single point mutants T522S, K340D, D222H, and G467N are 119%, 115%, 110%, and 123% of the wild enzyme. The specific enzyme activities of the combined mutants T522S / K340D, K340D / D222H, and K340D / G467N are 125%, 123%, and 124% of the wild enzyme.

[0037] (3) The genetically engineered bacteria provided by the present invention use sucrose as a substrate to synthesize isomaltulose in a one-step process, which greatly saves time and cost. K340D / D222H 、SI G467N / K340D and SI T522S / K340DAfter being introduced into the pP43NMK vector and overexpressed in B. subtilis WB800, the isomaltulose yield was significantly improved, which was 123%, 124% and 125% of the wild enzyme respectively. The genetically engineered bacteria constructed by the present invention have the advantages of simple culture medium, cheap substrate, fast strain growth, genetic stability, high expression level, green environmental protection, etc., and have significant industrial production potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the map of the recombinant Escherichia coli-Bacillus subtilis shuttle plasmid.

[0039] Figure 2 It is the SDS-PAGE electrophoresis diagram of the original enzyme SI and the mutant, wherein lanes 1 to 8 are: 1: SI, 2: T522S / K340D, 3: D222H / K340D, 4: G467N / K340D, 5: T522S, 6: K340D, 7: D222H, 8: G467N.

[0040] Figure 3 These are the HPLC test results of fructose, glucose, sucrose, isomaltulose and trehalulose standards.

[0041] Figure 4 These are the HPLC test results of isomaltulose produced by the recombinant engineered strain using sucrose as substrate after shake flask fermentation. DETAILED DESCRIPTION

[0042] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0043] In the present invention, the amino acids at the corresponding positions are represented by the recognized IUPAC single-letter abbreviations, wherein each amino acid and its abbreviation are: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y) and valine (Val or V).

[0044] In the present invention, amino acid substitution is represented by "original amino acid, position, substituted amino acid". For example, the mutation of threonine at position 522 to serine is represented by T522S.

[0045] In the present invention, amino acid multi-site substitution is represented by any of the following (a) or (b):

[0046] (a) "original amino acid, position, substituted amino acid, / , original amino acid, position, substituted amino acid", for example, the threonine at position 522 mutates to serine and the lysine at position 340 mutates to aspartic acid, which is represented by T522S / K340D; (b) "original amino acid, position, substituted amino acid, +, original amino acid, position, substituted amino acid", for example, the threonine at position 522 mutates to serine and the lysine at position 340 mutates to aspartic acid, which is represented by T522S+K340D.

[0047] In the present invention, the terms "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", "nucleotide sequence" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, the term includes, but is not limited to, single-stranded, double-stranded or double-stranded DNA or RNA, genomic DNA, cDNA, DNA RNA hybrids, or polymers comprising, consisting of or essentially consisting of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases.

[0048] In the present invention, the term "vector" generally refers to a nucleic acid molecule that can self-replicate in a suitable host or a nucleic acid molecule that can insert a target gene fragment into a host genome, which transfers the target gene fragment carried into a host cell and / or between host cells. The vector may include a vector that is mainly used to insert DNA or RNA into a cell, a vector that is mainly used to replicate DNA or RNA, and a vector that is mainly used for the expression of transcription and / or translation of DNA or RNA. The vector also includes vectors with a variety of the above functions. The vector may be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, the vector can produce a desired expression product by culturing a suitable host cell containing the vector.

[0049] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, can be obtained from commercial sources. For example, the plasmids, super competent cell preparation kits, BCA kits, etc. used in the following examples are commercial products, and the specific operations are performed according to the kit instructions.

[0050] The embodiments of the present invention are not limited thereto, and other unspecified experimental operations and process parameters are performed according to conventional techniques.

[0051] Test method:

[0052] HPLC detection conditions: differential refractive index detector; chromatographic column Sepax HP-Amino, column temperature 30°C; mobile phase is a mixed solution of 70% (v / v) acetonitrile and 30% (v / v) ultrapure water, flow rate 1.0 mL / min; injection volume 10 μL. Relevant operations refer to GB 1886.182-2016 National Food Safety Standard Food Additive Isomaltulose Detection Method.

[0053] The raw materials used in the examples are:

[0054] The Bacillus subtilis WB800 and the construction method of the recombinant bacteria used in the following examples have been disclosed in the patent document with publication number CN 114350699A.

[0055] The synthesis of plasmid pP43NMK-SI was completed by Tianlin Biotechnology (Wuxi) Co., Ltd.

[0056] Preparation of competent strain E. coli DH5ɑ: kit provided by Shanghai Sangon Biotechnology Co., Ltd.

[0057] SPI-A solution: ammonium sulfate 4 g / L, dipotassium hydrogen phosphate trihydrate 28 g / L, potassium dihydrogen phosphate 12 g / L, trisodium citrate dihydrate 2 g / L, make up to 1 L, sterilize at 115°C for 30 min.

[0058] SPI-B solution: 0.8 g / L magnesium sulfate heptahydrate, dilute to 1 L, sterilize at 115°C for 30 min.

[0059] CAYE solution: 20 g / L casein amino acids, 100 g / L yeast extract, dilute to 1 L, sterilize at 115°C for 30 min.

[0060] 10mmol / LEGTA solution, adjust pH to 8.0 with NaOH, sterilize at 115℃ for 30min, dispense 1mL into 1.5mL EP tubes, and store in a -20℃ refrigerator for later use.

[0061] 50mmol / L CaCl2 solution, sterilize at 115℃ for 30min.

[0062] 50mmol / L MgCl2 solution, sterilize at 115℃ for 30min.

[0063] 50% glucose solution, sterilized at 115℃ for 30min.

[0064] SPI solution: SPI-A 9.8 mL, SPI-B 9.8 mL, CAYE solution 200 μL, glucose solution 200 μL.

[0065] SPⅡ solution: 5.88mL of SPI solution, 60μL of CaCl2 solution, and 60μL of MgCl2 solution.

[0066] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride.

[0067] LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder.

[0068] Fermentation medium: tryptone 10 g / L, yeast extract 20 g / L, sodium chloride 8 g / L, glucose 15 g / L, disodium hydrogen phosphate dodecahydrate 1 g / L, magnesium sulfate heptahydrate 1 g / L, pH 7.0.

[0069] The buffers involved in the following examples are as follows: Tris-HCl buffer: 50 mmol / L, pH 7.0;

[0070] Binding Buffer: 50mmol / L Tris-HCl, 500mmol / L NaCl, pH 7.0;

[0071] Washing Buffer: 50mmol / L Tris-HCl, 500mmol / L NaCl, 20mmol / L imidazole, pH 7.0;

[0072] Elution Buffer: 50mmol / L Tris-HCl, 500mmol / L NaCl, 500mmol / L imidazole, pH 7.0;

[0073] Dialysis buffer: 50mmol / L Tris-HCl, 10mmol / L EDTA, pH 7.0.

[0074] Example 1 Site-directed mutagenesis of sucrose isomerase and construction of recombinant plasmid and recombinant Bacillus subtilis

[0075] (1) Construction of wild-type plasmid

[0076] The sucrose isomerase (SI) gene sequence from the microorganism Serratia plymuthica has a NCBI accession number of WP_212559700.1, an amino acid sequence as shown in SEQ ID NO.1, and a nucleotide sequence of the encoding gene as shown in SEQ ID NO.2.

[0077] The sucrose isomerase encoding gene with the nucleotide sequence shown in SEQ ID NO.2 was constructed between the HindⅢ and XhoI restriction sites of the plasmid vector pP43NMK to construct a recombinant plasmid as shown in Figure 1 , and named as pP43NMK-SI.

[0078] (2) Construction of mutant plasmid

[0079] Primers were designed based on the gene encoding SI from Serratia plymuthica as shown in SEQ ID NO.2, and site-directed mutagenesis was performed using pP43NMK-SI constructed in step (1) as a template to construct a mutant plasmid:

[0080] Forward primer T522S:TACGGC AGC TACACTGATCTGGACCCGGCTAA;

[0081] Reverse primer T522S: TCAGTGTA GCT GCCGTACGTCAGCGCCGGGAT;

[0082] Forward primer K340D:AGATTGG GAT CTCAGCCAGTTTCGTCAGGTCA;

[0083] Reverse primer K340D: GGCTGAG ATC CCAATCTTTGCGACGCCAACGT;

[0084] Forward primer D222H: TCGTCAG CAT CTGTATGCCATGCTGAGATTCTG;

[0085] Reverse primer D222H: GATCTC CCT GTAGTTTGGATTCACCTTAAACCACG;

[0086] Forward primer G467N: GTGGGAC AAC AGCAAAAACGCTGGTTTTACCT;

[0087] Reverse primer G467N: TTTTGCT GTT GTCCCACTGAAACGGGGTACGG;

[0088] The underlined bold parts represent the codons corresponding to the amino acids encoded by the mutant gene.

[0089] PCR amplification system: see Table 1.

[0090] Table 1 PCR amplification reaction system

[0091]

[0092] PCR reaction conditions: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 20 s, annealing at 56°C for 20 s, and extension at 72°C for 130 s; 30 cycles (denaturation-annealing-extension is 1 cycle); complete extension at 72°C for 1 min, and sample storage at 4°C.

[0093] After PCR amplification, add 2 μL DpnⅠ restriction endonuclease (10U / μL) to the reaction solution and incubate at 37°C for 2 hours to eliminate the template. Transform the PCR product into E.coil DH5α cells, spread on LB plates, pick a single colony into LB liquid culture medium, extract the plasmid, and obtain the correct single point mutation plasmid pP43NMK-SI through sequencing. T522S 、pP43NMK-SI K340D 、pP43NMK-SI D222H 、pP43NMK-SI G467N . Orderly stacking was performed to obtain the combined mutation plasmid pP43NMK-SI T522S / K340D 、pP43NMK-SI K340D / D222H 、pP43NMK-SI K340D / G467N .

[0094] The successfully constructed mutant plasmid and the wild-type plasmid from step (1) were transformed into B. subtilis WB800 to obtain the single-point mutant strain WB800 / pP43NMK-SI T522S 、WB800 / pP43NMK-SI K340D 、WB800 / pP43NMK-SI D222H 、WB800 / pP43NMK-SI G467N , combined mutant strain WB800 / pP43NMK-SI T522S / K340D 、WB800 / pP43NMK-SI K340D / D222H 、WB800 / pP43NMK-SI K340D / G467N and strain WB800 / pP43NMK-SI expressing the wild-type enzyme.

[0095] Example 2: Expression and purification of wild-type enzyme and mutant enzyme

[0096] The specific steps are as follows:

[0097] (1) The wild-type strain and each mutant strain prepared in Example 1 were respectively picked up and placed in LB liquid medium containing 50 μg / mL kanamycin. After culturing at 37°C and 200 r / min for 12 h, they were transferred to fermentation medium containing 50 μg / mL kanamycin and cultured at 30°C and 200 r / min for 24 h, and the fermentation broth was collected.

[0098] (2) After the collected fermentation broth was centrifuged at 8000 r / min and 4°C for 10 min, the supernatant was collected, i.e. the crude enzyme solution, and filtered through a 0.45 μm pore size water system membrane. 2+ The chelating agarose resin column was pre-balanced; crude enzyme solution was added and balanced with Binding Buffer and Washing Buffer respectively; the enzyme was eluted with Elution Buffer and recovered; the recovered enzyme solution was dialyzed in dialysis buffer and stored in a refrigerator at 4°C to prepare the recombinant enzyme pure enzyme dialysate. The purified wild-type and mutant SDS-PAGE protein bands are shown in Figure 2. Figure 2 The result showed a single clear band, indicating that the heterologous expression of the sucrose isomerase gene was successful.

[0099] Enzyme activity assay conditions: 50 mM citric acid-sodium hydrogen phosphate buffer (pH 5.0), 0.9 mL of buffer containing 100 g / L sucrose and 0.1 mL of enzyme solution, a total of 1 mL system. Reaction conditions: 30 min at 40 °C, 10 min in a boiling water bath to terminate the reaction. The reaction supernatant was taken and the isomaltulose content was detected by HPLC. The fructose (Fructose), glucose (Glucose), sucrose (Sucrose), isomaltulose (Isomaltose) and trehalulose (Trehalulose) standards were mixed for liquid phase detection. The retention time of each substance is as follows Figure 3 shown.

[0100] Enzyme activity (U) is defined as the amount of enzyme required to produce 1 μmol of isomaltulose per minute under the above reaction conditions.

[0101] The specific enzyme activity of the obtained pure enzyme solution was detected respectively. Under this condition, the specific enzyme activity (U / mg) of the wild enzyme SI was defined as 100%. The results of the specific enzyme activity determination are shown in Table 2. Compared with the specific enzyme activity of the wild enzyme SI, the specific enzyme activities of the single point mutants were increased by 19% for T522S, 15% for K340D, 10% for D222H, and 23% for G467N. The specific enzyme activities of the combined mutants were increased by 25% for T522S / K340D, 23% for K340D / D222H, and 24% for K340D / G467N. The specific enzyme activity of the wild enzyme SI was 372.19U / mg.

[0102] Table 2 Relative enzyme activities of SI and mutants

[0103]

[0104] Example 3: Production of isomaltulose by the original enzyme and combined mutants using sucrose as substrate

[0105] 1. Construction of recombinant engineering bacteria for producing isomaltulose using sucrose as substrate

[0106] Pick a single colony of B. Subtilis WB800, inoculate it into 5mL of antibiotic-free LB liquid culture medium, place it in a 37℃ shaker, and culture it at 200r / min for 12h. Take 100μL of the above bacterial solution and inoculate it into 5mL of SPI solution, place it in a 37℃ shaker, and culture it at 200r / min for 3.5h. Take 600μL of the above bacterial solution and inoculate it into 6mL of SPII solution, place it in a 37℃ shaker, and culture it at 200r / min for 2h. Add 60μLEGTA solution to the above bacterial solution, place it in a 37℃ shaker, and culture it at 200r / min for 10min. Aliquot 500μL into a 1.5mL EP tube and add 10μL of the constructed mutant plasmid pP43NMK-SI and pP43NMK-SI K340D / D222H 、pP43NMK-SI K340D / G467N 、pP43NMK-SI T522S / K340D , put it in a 37℃ shaker, 200r / min, and culture for 1.5h. Put the above centrifuge tube into a centrifuge, 4000r / min, centrifuge for 3min, remove 400μL of supernatant, resuspend, apply to LB solid plate containing Kan resistance, and put it in a 37℃ incubator for 12h. The colonies on the plate are the recombinant engineered bacteria WB800 / pP43NMK-SI, WB800 / pP43NMK-SI K340D / D222H 、WB800 / pP43NMK-SI K340D / G467N 、WB800 / pP43NMK-SI T522S / K340D .

[0107] 2. Fermentation culture of recombinant engineered bacteria producing isomaltulose using sucrose as substrate

[0108] Pick WB800 / pP43NMK-SI, WB800 / pP43NMK-SI K340D / D222H 、WB800 / pP43NMK-SI K340D / G467N 、WB800 / pP43NMK-SI T522S / K340DA single colony was placed in a Kan-resistant LB liquid medium with a final concentration of 50 μg / mL, and cultured in a 37°C shaker for 12 hours to obtain a seed solution; 500 μL of the above seed solution was inoculated into 500 mL of fermentation medium, and cultured in a 30°C shaker for 24 hours. The fermentation liquid was centrifuged at 4°C and 8000 r / min for 10 minutes, and the supernatant was collected as the crude enzyme solution.

[0109] The crude enzyme solution was purified and the enzyme activity was determined in the same manner as in Example 2. After the enzyme reaction, the production of fructose, glucose, isomaltulose, and trehalulose and the consumption of sucrose were detected by HPLC. The retention times of fructose, glucose, sucrose, isomaltulose, and trehalulose on HPLC were as follows: Figure 4 shown.

[0110] The sucrose concentration was controlled at 200 g / L, the enzyme addition amount was 20 U / g, the initial reaction pH was controlled at 5.0, the enzyme reactor temperature was controlled at 40°C, the conversion was performed for 8.5 hours, 1 mL was sampled every 30 minutes, and after the second hour, 1 mL was sampled every hour, the enzyme was inactivated in a boiling water bath for 10 minutes, the reaction was centrifuged through a membrane, and the amount of isomaltulose produced was detected by HPLC.

[0111] The results showed that the pure enzyme expressed by strain WB800 / pP43NMK-SI produced 162.58 g / L of isomaltulose. K340D / D222H The expressed pure enzyme produced 165.08 g / L of isomaltulose, strain WB800 / pP43NMK-SI T522S / K340D The expressed pure enzyme produced 166.32 g / L of isomaltulose, strain WB800 / pP43NMK-SI K340D / G467N The expressed pure enzyme produced 165.06 g / L of isomaltulose, which increased by 1.5%, 2.3% and 1.3% respectively.

[0112] Comparative Example

[0113] According to the methods in Examples 1, 2, and 3, strain WB800 / pP43NMK-SI was constructed. D222V 、WB800 / pP43NMK-SI M556E 、WB800 / pP43NMK-SI V549I 、WB800 / pP43NMK-SI R557K 、WB800 / pP43NMK-SI A529E The specific enzyme activities of the pure enzymes after heterologous expression of the above strains are shown in Table 3.

[0114] Table 3 Relative enzyme activities of SI and mutants

[0115]

[0116] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. The use of sucrose isomerase in the preparation of isomaltulose, characterized in that: Sucrose is used as a substrate and sucrose isomerase is used as a catalyst to form a catalytic system to catalyze the production of isomaltulose. The amino acid sequence of the sucrose isomerase is shown in SEQ ID NO.

1.

2. A sucrose isomerase mutant, characterized in that The mutant is obtained by mutation of one or more of the 522nd threonine, the 340th lysine, the 222nd aspartic acid and the 467th glycine of the sucrose isomerase parent, and the amino acid sequence of the parent is shown in SEQ ID NO.

1.

3. The mutant according to claim 2, characterized in that The mutant is a mutant of the parent subjected to any of the following mutations (a)-(g): (a) mutating the threonine T at position 522 to serine S; (b) mutating the lysine K at position 340 to aspartic acid D; (c) mutating the aspartic acid D at position 222 to histidine H; (d) mutating glycine G at position 467 to asparagine N; (e) mutating the threonine T at position 522 to serine S and the lysine K at position 340 to aspartic acid D; (f) mutating the lysine K at position 340 to aspartic acid D and mutating the aspartic acid D at position 222 to histidine H; (g) The lysine K at position 340 was mutated to aspartic acid D and the glycine G at position 467 was mutated to asparagine N.

4. A gene encoding the mutant according to claim 2 or 3.

5. An expression vector carrying the gene according to claim 4.

6. A recombinant cell expressing the mutant according to claim 2 or 3, or containing the gene according to claim 4, or transformed with the expression vector according to claim 5.

7. A method for preparing isomaltulose, characterized in that: The method comprises taking sucrose as a substrate and utilizing the mutant according to claim 2 or 3 as a catalyst to form a catalytic system to catalytically generate isomaltulose.

8. The method according to claim 7, characterized in that In the catalytic system, the concentration of sucrose is 100-700 g / L, and the dosage of the catalyst is 5-50 U / g of mutant.

9. The method according to claim 7, characterized in that: The catalytic temperature is 35-40° C., the catalytic time is 7-12 hours, and the pH of the catalytic system is 4-10.

10. Use of the sucrose isomerase mutant according to claim 2 or 3, the gene according to claim 4, the expression vector according to claim 5, the recombinant cell according to claim 6, or the method according to any one of claims 7 to 9 in the preparation of isomaltulose or a product containing isomaltulose.

Images