Kit for detecting pathogenic gene of phenylketonuria and application of kit

Abstract

The invention relates to a gene diagnosis technology, in particular to a kit for detecting phenylketonuria pathogenic genes and application of the kit, the kit comprises a reagent for detecting PAH pathogenic mutants, and the PAH pathogenic mutants are characterized in that in a coding region of a nucleotide sequence shown as the accession number NM000277.3, the 721st basic group is mutated into C from T, and the 741st basic group is mutated into G from T; the reagent is a primer. According to the invention, a new mutation site of the phenylketonuria virulence gene is found, and the research of the phenylketonuria virulence gene is enriched; the kit provided by the invention contains a reagent for detecting the new mutation site, is found for the first time in the prior art, is simple in structure, can more conveniently and quickly detect the pathogenic gene of phenylketonuria, and increases a new clinical detection product.

Description

Technical Field

[0001] The present invention relates to gene diagnosis technology, in particular to a kit for detecting phenylketonuria pathogenic genes and its application. Background Art

[0002] Phenylketonuria (PKU) is an autosomal recessive inherited metabolic disease with abnormal amino acid metabolism. Gene mutations lead to phenylalanine hydroxylase (PAH) deficiency or tetrahydrobiopterin (BH4) deficiency. Phenylalanine (Phe) cannot be normally hydroxylated to tyrosine (Tyr), activating the bypass metabolic pathway. The concentrations of phenylalanine and phenylpyruvate in the blood increase, damaging the central nervous system, causing intellectual development retardation in children, and at the same time, the concentration of Tyr in the body decreases. Common symptoms include rat-smelling urine, mental retardation, yellow hair, epileptic seizures, etc., and children are more likely to suffer from the disease.

[0003] In recent years, it has been widely used in the diagnosis of PKU and prenatal diagnosis and eugenics for heterozygous detection. At present, 80% of the gene mutations of PKU children in my country have been identified, but the correlation between genotype and clinical phenotype is complex, and the clinical phenotype cannot be completely predicted by genotype.

[0004] Prior art CN 111394446 B discloses a kit for detecting pathogenic genes related to phenylketonuria and its dedicated capture probe set. The kit provided can simultaneously detect the six pathogenic genes of phenylketonuria, namely PAH, PTS, GCH1, QDPR, PCBD1, and SPR, and can detect phenylketonuria of various point mutation types, and can detect the full length of PAH, PTS, GCH1, QDPR, PCBD1, and SPR genes, which is conducive to the discovery of new pathogenic mutations and provides a new means of discovery for the genetic basis of phenylketonuria.

[0005] Prior art CN 107828883 B discloses a detection primer set, a kit and a gene mutation detection method for phenylketonuria. For the first time, for the PAH, PTS, GCH1, QDPR, PCBD1, and SPR genes related to phenylketonuria, a primer set covering the 6 genes and the shearing sites of about 10bp upstream and downstream thereof is provided. The primer set has high specificity, small mutual interference between primers, high uniformity, and high depth of amplicon expression in a multiplex PCR reaction system. The coverage is more complete, the detection sites are more, and the accuracy rate is high. It can be applied to the detection of phenylketonuria gene mutations, the detection of carriers, genetic counseling and other disease prevention aspects, and can also be applied to the guidance of disease treatment.

[0006] At present, there are many pathogenic genes for phenylketonuria, and their mutation sites are countless. The corresponding test kits have more than hundreds of primers and probes, which is not conducive to promotion. Therefore, it is particularly important to simplify the detection sites and realize the detection of pathogenic genes for phenylketonuria more simply and conveniently. Summary of the invention

[0007] The present invention first provides a kit for detecting a phenylketonuria pathogenic gene, the kit comprising a reagent for detecting a PAH pathogenic mutant, wherein the PAH pathogenic mutant is: in the coding region of the nucleotide sequence shown in the accession number NM_000277.3, the 72nd base mutates from T to C and the 741st base mutates from T to G.

[0008] Preferably, the reagent is a primer.

[0009] Preferably, the primer sequences are shown in SEQ ID NO.1 to SEQ ID NO.4.

[0010] Preferably, the reagents further comprise sequencing reagents.

[0011] Preferably, the kit further comprises one or more of dNTPs, PCR buffer, magnesium ions and Taq polymerase.

[0012] The present invention also provides application of the above-mentioned kit in detecting phenylketonuria.

[0013] Preferably, the use is for non-diagnostic purposes.

[0014] The present invention also provides a method for detecting phenylketonuria, which comprises the step of using the above kit.

[0015] Preferably, the detection method is for non-diagnostic purposes.

[0016] Compared with the prior art, the present invention has at least the following beneficial effects:

[0017] (1) The present invention discovered a new mutation site of the phenylketonuria pathogenic gene, enriching the research on the phenylketonuria pathogenic gene;

[0018] (2) The kit of the present invention includes reagents for detecting the above-mentioned new mutation sites, which is the first discovery in the prior art. It has a simple structure and can more conveniently and quickly detect the pathogenic gene of phenylketonuria, thus adding new clinical detection products. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the genetic map of phenylketonuria family No. 1; among them, Indicates male carriers, indicates a female carrier, ■ indicates a male patient, and ↗ indicates a proband. DETAILED DESCRIPTION

[0020] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0021] Example 1

[0022] 1. Sample collection

[0023] This PAHD pedigree was collected by Henan Province Newborn Disease Screening Center. There are 3 members in total. The proband is a female who was 60 days old when diagnosed. The family situation is shown in Figure 1 This study was approved by the Ethics Committee of the Third Affiliated Hospital of Zhengzhou University, and all subjects signed the relevant informed consent.

[0024] 2. Sample DNA Extraction

[0025] (1) DNA extraction The DNA in the venous blood of the subjects was extracted using the Qiagen kit from Germany, and the quality control was performed using the Nanodrop 2000 spectrophotometer. The results showed that the DNA concentration was 67 ng / μL and the OD260 / 280 ratio was 1.9, which was between 1.7 and 2.0, and could meet the requirements for library construction.

[0026] 3 Exon Sequencing

[0027] Refer to the instructions of the Human Whole Exome Sequencing Kit (Agilent) and the Molecular Cloning Laboratory Manual Operating Guide.

[0028] (3.1) Take 2 μg of DNA, mechanically shear it to a fragment size of about 200 bp, and cut the gel to recover 150-250 bp fragments;

[0029] (3.2) DNA fragments are end-repaired and 3' end A is added;

[0030] (3.3) Connecting sequencing adapters, purifying the connected products, and then performing PCR amplification and purifying the amplified products;

[0031] (3.4) The probe of the Agilent kit is added to the purified amplification product for hybridization capture. The hybridization product is eluted and recovered for PCR amplification. The final product is then recovered and a small sample is taken for agarose gel electrophoresis for quality control analysis.

[0032] (3.5) NextSeq500 sequencer sequencing and data analysis.

[0033] 4 Results

[0034] The PAH gene sequencing results of the proband showed that c.72T>C and c.741T>G mutations occurred, and the carriers were "c.72T>C mutation" or "c.741T>G mutation"; the c.72T>C mutation was a missense mutation, causing the corresponding amino acid to change from leucine to proline; the c.741T>G mutation was a missense mutation, causing the corresponding amino acid to change from phenylalanine to valine.

[0035] Example 2 Sanger Verification

[0036] The exome sequencing results were further verified using Sanger sequencing to identify the c.72T>C and c.741T>G loci. Genotypes of the c.72T>C and c.741T>G loci were tested on three individuals from family No. 1 in Example 1 and 30 healthy individuals outside the family.

[0037] The specific steps are as follows:

[0038] 1. DNA Extraction Normal human genomic DNA was extracted according to the method of Example 1.

[0039] The primers designed for the mutation sites c.72T>C and c.741T>G are shown in Table 1.

[0040] Table 1 Primer sequences

[0041] Sequence number sequence SEQ ID NO.1 CCTGAGGCCCTAAAAAGCCA SEQ ID NO.2 AGAGAGTTTCCTGCCCAAGC SEQ ID NO.3 ACATGGGGCACAGTGTTCAA SEQ ID NO.4 GTGCAGTGGAAGACTCGGAA

[0042] 2. PCR reaction system see Table 2.

[0043] Table 2 PCR reaction system

[0044] Reagents volume 10XBuffer 5μL dNTPMix 4μL Upstream primer 2μL(10μM) Downstream primer 2μL(10μM) DNA 3μL Taq enzyme 1μL Deionized water 33μL total 50μL

[0045] 3. PCR reaction program see Table 3:

[0046] Table 3 PCR reaction program

[0047] stage temperature time Number of cycles Step 1: 94℃ 5min 1 cycle 95℃ 30s Step 2: 55℃ 30s 30 cycles 72℃ 60s Step 3: 72℃ 7min Step 4: 4℃

[0048] 4 PCR results

[0049] After agarose gel electrophoresis, the samples were sent to BGI for Sanger sequencing.

[0050] The sequencing results showed that the genotype of the proband in Family No. 1 was a compound mutation of "c.72T>C mutation + c.741T>G mutation"; the genotypes of the two carriers in Family No. 1 at this site were single mutations of "c.72T>C mutation" or "c.741T>G mutation" respectively; the 30 unrelated normal controls did not contain the above compound mutations.

[0051] Example 3 Validation in other families

[0052] Another 30 pedigrees similar to pedigree No. 1 were selected for Sanger sequencing verification, and the amplification method was the same as in Example 2; the kit test results showed that the probands in the other 30 pedigrees all had a compound mutation of "c.72T>C mutation + c.741T>G mutation", which confirmed that the above double-site mutation can be used to detect phenylketonuria.

[0053] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A kit for detecting phenylketonuria pathogenic genes, characterized in that: The kit comprises a reagent for detecting a PAH pathogenic mutant, wherein the PAH pathogenic mutant is: in the coding region of the nucleotide sequence shown in the accession number NM_000277.3, the 72nd base mutates from T to C and the 741st base mutates from T to G.

2. The kit according to claim 1, characterized in that The reagent is a primer.

3. The kit according to claim 2, characterized in that The primer sequences are shown as SEQ ID NO.1 to SEQ ID NO.

4.

4. The kit according to claim 1, characterized in that The reagents also include sequencing reagents.

5. The kit according to any one of claims 1 to 4, characterized in that The kit further comprises one or more of dNTPs, PCR buffer, magnesium ions and Taq polymerase.

6. Use of the kit according to any one of claims 1 to 4 in detecting phenylketonuria.

7. The use according to claim 6, characterized in that: The described use is for non-diagnostic purposes.

8. A method for detecting phenylketonuria, characterized in that: The method comprises the step of using the kit according to any one of claims 1 to 4.

9. The method according to claim 8, characterized in that The detection method is used for non-diagnostic detection.

Images