SSR molecular marker developed based on mactra veneriformis reference transcriptome sequence, amplification primer and application

Abstract

The invention belongs to the technical field of molecular marker technology development and application, and discloses an SSR molecular marker developed based on a mactra veneriformis reference transcriptome sequence, and the SSR molecular marker comprises 16 nucleotide sequences corresponding to microsatellite markers as shown in SEQ ID NO.1-SEQ ID NO.16 in sequence. At present, no report about development of mactra veneriformis microsatellites from genomes and transcriptomes exists, 16 stable microsatellite molecular markers with clear strips and high polymorphism are developed from mactra veneriformis transcriptome data on the basis of a high-throughput transcriptome sequencing technology for the first time, and the microsatellite molecular markers can be used for identifying the mactra veneriformis microsatellites. The method has good practical production and application values in the fields of mactra veneriformis population genetics analysis, genetic relationship identification, high-density genetic map construction and molecular marker-assisted breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker technology development and application, and in particular to an SSR molecular marker, amplification primer and application developed based on a transcriptome sequence of a tetrapod clam. Background Art

[0002] Mactra veneriformis belongs to Lamellibranchia, Heterodonta, Veneroida, Mactridae, Mactra, commonly known as white clam, sand clam, sand clam, white clam, is one of the main economic shellfish in China. It lives in a buried habitat and is mainly distributed in the muddy beach in the middle and lower areas of the intertidal zone and shallow sea. It is distributed in China, South Korea, and Japan. In my country, the production is relatively large in the coastal areas of Tianjin, Liaoning, Shandong, and Jiangsu. It is deeply loved by consumers because of its delicious taste and high nutritional value, such as high protein, low fat, and rich in unsaturated fatty acids. In recent years, with the development of industry, the scale of land reclamation has gradually expanded in some coastal cities, and the spawning grounds of tidal flat shellfish have been greatly affected, which has led to a certain reduction in the resources of tidal flat shellfish such as Mactra veneriformis. Therefore, it is urgent to clarify the population resource background of Mactra veneriformis and lay the foundation for the cultivation of new varieties of Mactra veneriformis.

[0003] Microsatellite markers (SSR) are an important type of molecular markers. There are two main methods for developing SSRs. One is the traditional genomic development method (genomic SSR, G-SSR), and the other is the EST-SSR based on transcriptome data, that is, the expressed sequence tag-SSR (expressed sequence tag) development method. Compared with the traditional genomic SSR development technology, the SSRs developed based on high-throughput transcriptome sequencing technology are abundant in number, low in development cost and short in development cycle. More importantly, they are often associated with functional genes of important economic traits such as growth, and have important value in the study of polymorphism of aquatic economic animals. At present, ocean acidification has greatly affected the survival and growth of marine organisms, especially shellfish. As a shellfish with extremely fragile shells during the rapid growth period of larvae, the tetrahedral clam will be the first to be threatened by acidification. However, there are no reports on the development of SSRs in tetrahedral clams based on transcriptome data under the background of ocean acidification.

[0004] At present, the conventional genomic SSR development method (genomic SSR, G-SSR) is sometimes used in the prior art, which is generally developed by magnetic bead enrichment method, with complicated operation steps and high price. Moreover, most of the developed SSR markers are not related to important economic traits and have little value in breeding. Compared with the traditional genomic SSR development technology, the transcriptome-based SSR development technology has abundant SSR development, low cost, and short development cycle. More importantly, the SSR markers developed by this method are often associated with important economic traits and have very important value in the study of polymorphism of aquatic economic animals. However, there are currently very few molecular markers used for population genetics analysis and breeding of tetrahedral clams, and SSRs developed based on transcriptome data have not been reported in tetrahedral clams. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an SSR molecular marker, amplification primer and application developed based on the transcriptome sequence of Tetrapoda tetragonosa.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] A SSR molecular marker developed based on the transcriptome sequence of tetragonolae, the SSR molecular marker comprising 16 microsatellite markers Mv01, Mv05, Mv09, Mv12, Mv13, Mv16, Mv18, Mv20, Mv22, Mv30, Mv42, Mv43, Mv45, Mv70, Mv71, and Mv72, and the corresponding nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.16.

[0008] The amplification primers for the SSR molecular markers as described above include 16 amplification primer pairs, and their corresponding nucleotide sequences are shown in SEQ ID NO.17-SEQ ID NO.48 in sequence.

[0009] The method for obtaining the SSR molecular marker as described above comprises the following steps:

[0010] (1) High-throughput transcriptome sequencing was performed on the acidified and control groups of tetrapod clams, and high-quality transcriptome sequences were assembled using the previously performed whole genome sequencing as a reference sequence. In the obtained transcriptome sequences, the original sequencing data was assembled and redundancy removed using Trinity software, resulting in 25,145 Unigenes with an average length of 2017.11 bp;

[0011] (2) Microsatellite marker screening and primer design

[0012] The identification and positioning of microsatellite sequences were performed using MISA software. The MISA search parameters were set as follows: mononucleotide, dinucleotide, trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide, with the minimum number of repetitions being 12, 6, 5, 5, 4 and 4 respectively. The maximum number of bases between two sites of the composite SSR was set to 100. Primers were designed using Primerpremier 5 software. The main parameter settings were: primer length was 18-25 bp, PCR amplification product length was between 150 and 300 bp, 52°C ≤ annealing temperature Tm ≤ 65°C, 20% ≤ GC content ≤ 80%. At the same time, the results were further verified using Primer-BLAST in the NCBI database. The main parameters were set as: Selfcomplementarity < 6, Self′3complementarity < 3, and the difference in Tm values ​​between the upstream and downstream primers was no higher than 2°C. Finally, 90 pairs of primers were screened out.

[0013] (3) Using DNA extracted from tetrapod clams as template, the above 90 primer pairs were subjected to PCR amplification. The PCR reaction system was 20 μL, including: 100 ng template DNA, 2 μL 10× buffer, 10 mM Mg 2+ 1 μL of dNTP, 1 μL of forward primer F and reverse primer R, 1U of Taq DNA polymerase; the PCR reaction program was 95℃ pre-denaturation for 3 min; 94℃ denaturation for 45 s, 50-60℃ annealing for 30 s, 72℃ extension for 60 s, a total of 35 cycles; the obtained PCR products were analyzed by capillary gel electrophoresis through a sequencing analyzer, and finally 16 microsatellite markers with clear, stable and rich polymorphism were obtained.

[0014] The application of SSR molecular markers as described above in the analysis of genetic diversity of different populations of tetrapod clams.

[0015] The application of SSR molecular markers as described above in the identification of kinship of tetrapod clams.

[0016] The application of SSR molecular markers as described above in the construction of a high-density genetic map of Tetrapoda tetrapoda.

[0017] The application of SSR molecular markers as described above in molecular marker-assisted breeding of tetrapod clams.

[0018] The advantages and positive effects achieved by the present invention are:

[0019] 1. There is no report on the development of microsatellites of four-cornered clams from genomes and transcriptomes. The present invention is the first to develop 16 stable, clear-banded, and highly polymorphic molecular markers from transcriptome data of four-cornered clams based on high-throughput transcriptome sequencing technology, which has good practical production and application value in the fields of population genetics analysis, kinship identification, high-density genetic map construction, and molecular marker-assisted breeding of four-cornered clams.

[0020] 2. The present invention establishes for the first time a method for developing SSR markers based on high-throughput transcriptome sequencing data of four-cornered clams. The reference transcriptome data obtained by high-throughput sequencing in the early stage is used as the basis for screening SSR markers, and efficient and accurate SSR sites are developed. 16 stable, reliable, repeatable and accurate EST-SSR markers were screened. These 16 microsatellite markers were applied to the genetic diversity analysis of four geographical populations of four-cornered clams, which can accurately cluster different geographical groups and show high polymorphism. It is explained that the microsatellite markers developed in this description can be used in the field of population genetics analysis, kinship identification, high-density genetic map construction and molecular marker-assisted breeding of four-cornered clams, which will greatly promote the evaluation of four-cornered clam germplasm resources and the progress of genetic breeding.

[0021] 3. The present invention establishes for the first time a method for developing SSR markers based on high-throughput transcriptome sequencing data of tetrahedral clams, and screens stable, reliable, repeatable and accurate SSR markers for use in population genetics analysis, kinship identification, high-density genetic map construction and molecular marker-assisted breeding of tetrahedral clams, which will greatly promote the evaluation of tetrahedral clams germplasm resources and the progress of genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a characteristic map of microsatellite markers developed based on the transcriptome of Tetrapoda tetragonosa in the present invention;

[0023] Figure 2 This is a cluster diagram of genetic structure analysis conducted in four geographical populations of Tetrapoda tetrapoda using 16 pairs of microsatellite primers in the present invention. DETAILED DESCRIPTION

[0024] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0025] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0026] A SSR molecular marker developed based on the transcriptome sequence of tetragonolae, the SSR molecular marker comprising 16 microsatellite markers Mv01, Mv05, Mv09, Mv12, Mv13, Mv16, Mv18, Mv20, Mv22, Mv30, Mv42, Mv43, Mv45, Mv70, Mv71, and Mv72, and the corresponding nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.16.

[0027] The amplification primers for the SSR molecular markers as described above include 16 amplification primer pairs, and their corresponding nucleotide sequences are shown in SEQ ID NO.17-SEQ ID NO.48 in sequence.

[0028] The method for obtaining the SSR molecular marker as described above comprises the following steps:

[0029] (1) High-throughput transcriptome sequencing was performed on the acidified and control groups of tetrapod clams, and high-quality transcriptome sequences were assembled using the previously performed whole genome sequencing as a reference sequence. In the obtained transcriptome sequences, the original sequencing data was assembled and redundancy removed using Trinity software, resulting in 25,145 Unigenes with an average length of 2017.11 bp;

[0030] (2) Microsatellite marker screening and primer design

[0031] The identification and positioning of microsatellite sequences were performed using MISA software. The MISA search parameters were set as follows: mononucleotide, dinucleotide, trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide, with the minimum number of repetitions being 12, 6, 5, 5, 4 and 4 respectively. The maximum number of bases between two sites of the composite SSR was set to 100. Primers were designed using Primerpremier 5 software. The main parameter settings were: primer length was 18-25 bp, PCR amplification product length was between 150 and 300 bp, 52°C ≤ annealing temperature Tm ≤ 65°C, 20% ≤ GC content ≤ 80%. At the same time, the results were further verified using Primer-BLAST in the NCBI database. The main parameters were set as: Selfcomplementarity < 6, Self′3complementarity < 3, and the difference in Tm values ​​between the upstream and downstream primers was no higher than 2°C. Finally, 90 pairs of primers were screened out.

[0032] (3) Using DNA extracted from tetrapod clams as template, the above 90 primer pairs were subjected to PCR amplification. The PCR reaction system was 20 μL, including: 100 ng template DNA, 2 μL 10× buffer, 10 mM Mg 2+1 μL of dNTP, 1 μL of forward primer F and reverse primer R, 1U of Taq DNA polymerase; the PCR reaction program was 95℃ pre-denaturation for 3 min; 94℃ denaturation for 45 s, 50-60℃ annealing for 30 s, 72℃ extension for 60 s, a total of 35 cycles; the obtained PCR products were analyzed by capillary gel electrophoresis through a sequencing analyzer, and finally 16 microsatellite markers with clear, stable and rich polymorphism were obtained.

[0033] The application of SSR molecular markers as described above in the analysis of genetic diversity of different populations of tetrapod clams.

[0034] The application of SSR molecular markers as described above in the identification of kinship of tetrapod clams.

[0035] The application of SSR molecular markers as described above in the construction of a high-density genetic map of Tetrapoda tetrapoda.

[0036] The application of SSR molecular markers as described above in molecular marker-assisted breeding of tetrapod clams.

[0037] Specifically, the relevant preparation and detection are as follows:

[0038] 1. In the early stage of the present invention, high-throughput transcriptome sequencing was performed on the acidified group and the control group of the tetrahedral clam, and the whole genome sequencing of the tetrahedral clam completed in the early stage was used as the reference sequence to assemble a high-quality transcriptome sequence. In the obtained transcriptome sequence, the original sequencing data was assembled and redundancy was removed by Trinity software (http: / / trinityrnaseq.sourceforge.net / ), and 25145 Unigenes with an average length of 2017.11 bp were obtained.

[0039] 2. Microsatellite marker screening and primer design

[0040] The identification and location of microsatellite sequences were performed using MISA software. The MISA search parameters were set as follows: mononucleotide, dinucleotide, trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide, with the minimum number of repeats being 12, 6, 5, 5, 4 and 4, respectively. The maximum number of bases between two sites of the composite SSR was set to 100. Primers were designed using Primerpremier 5 software. The main parameter settings were as follows: primer length was 18-25 bp, PCR amplification product length was between 150 and 300 bp, 52°C≤annealing temperature (Tm)≤65°C, and 20%≤GC content≤80%. At the same time, the results were further verified using Primer-BLAST in the NCBI database. The main parameters were set as follows: Selfcomplementarity<6, Self′3complementarity<3, and the difference in Tm values ​​between the upstream and downstream primers was not higher than 2°C. Finally, 90 pairs of primers were screened out, and the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0041] 3. Using the DNA extracted from the Tianjin population of Tetrapoda tetrapodii as a template, the above 90 pairs of primers were amplified by PCR. The PCR reaction system was 20 μL, including: 100 ng template DNA, 2 μL 10× buffer, 10 m M dNTP 1 μL (containing Mg 2+ ), 1 μL each of forward primer (F) and reverse primer (R), 1U Taq DNA polymerase. The PCR reaction program was 95℃ pre-denaturation for 3min; 94℃ denaturation for 45s, 50-60℃ annealing for 30s, 72℃ extension for 60s, for a total of 35 cycles. The obtained PCR products were analyzed by capillary gel electrophoresis using a 3730XL sequencing analyzer (ABI, USA), and finally 16 pairs of microsatellite marker primers with clear, stable and rich polymorphism were obtained. The specific sequences of microsatellite marker primers are shown in Table 1. The nucleotide sequences of microsatellite markers Mv01, Mv05, Mv09, Mv12, Mv13, Mv16, Mv18, Mv20, Mv22, Mv30, Mv42, Mv43, Mv45, Mv70, Mv71, and Mv72 amplified by 16 pairs of microsatellite primers are shown in SEQ ID NO.1 to SEQ ID NO.16, respectively.

[0042] Table 1 Sequence list of 16 pairs of microsatellite primers of Tetrapoda tetrapoda

[0043]

[0044] The more specific steps are as follows:

[0045] Example 1: Development of microsatellite primers for Tetrapoda tetrapoda based on transcriptome

[0046] Two marine aquaculture test groups with different pH were set up: low pH group (pH7.6) and control group (pH8.1). Total RNA was extracted from the gill tissues of the four-cornered clams in the two groups using the Trizol method. High-throughput transcriptome sequencing was performed using the Illumina 6000 platform, and the whole genome sequence was used as the reference sequence to assemble a high-quality transcriptome sequence of the four-cornered clams. Among the sequences obtained, the original sequencing data was assembled by Trinity software (http: / / trinityrnaseq.sourceforge.net / ) and redundancy was removed, and 25145 Unigenes with an average length of 2017.11bp were obtained, and the Q20% was between 98.99% and 99.38%, with a high assembly quality.

[0047] MISA software was used to search for microsatellite loci in transcriptome sequences. The MISA search parameters were set as follows: mononucleotide, dinucleotide, trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide, with a minimum number of repeats of 12, 6, 5, 5, 4 and 4, respectively. 3448 SSR loci were found from 25145 Unigene sequences in the transcriptome, distributed in 2941 Unigene sequences, with an SSR occurrence frequency (number of Unigenes containing SSR / total number of Unigenes) of 11.7%, and an SSR appearance frequency (number of detected SSR loci / total number of Unigenes) of 13.71%. The types of SSR loci detected in the transcriptome included mono-, di-, tri-, tetra-, penta- and hexanucleotide repeat unit types of 869, 534, 1934, 62, 39 and 10, respectively. Among them, the trinucleotide repeat unit had the most sites, at 1934, with an occurrence frequency of 56.1% ( Figure 1 ).

[0048] Primerpremier 5 software was used for primer design. The main parameters were set as follows: primer length was 18-25 bp, PCR amplification product length was between 150 and 300 bp, 52°C ≤ annealing temperature (Tm) ≤ 65°C, 20% ≤ GC content ≤ 80%. At the same time, Primer-BLAST in the NCBI database was used to further verify the results. The main parameters were set as follows: Selfcomplementarity < 6, Self′3complementarity < 3, and the difference in Tm values ​​between upstream and downstream primers was not higher than 2°C. Finally, 90 pairs of primers that met the requirements were screened out, and the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0049] The DNA of the axe-foot tissue of the tetrahedral clam was extracted by the improved CTAB method, and the preliminary detection was carried out by 0.8% agarose gel electrophoresis. The concentration and quality of the DNA were detected by the ultra-micro protein nucleic acid analyzer (Nanodrop2000), and the DNA concentration was uniformly diluted to 100ng / μL. The diluted DNA was used as a template to perform gradient PCR amplification on the above 90 pairs of primers. The PCR reaction system was 10μL, including: 100ng template DNA, 1μL 10× buffer, 10m M dNTP 1μL (containing Mg 2+ ), 1 μL each of forward primer (F) and reverse primer (R), 1U Taq DNA polymerase, and the rest was made up with double distilled water. The PCR reaction program was 95℃ pre-denaturation for 3min; 94℃ denaturation for 45s, 50-60℃ annealing for 30s, 72℃ extension for 60s, for a total of 35 cycles. The PCR products were analyzed by capillary gel electrophoresis using a 3730XL sequencer (ABI, USA). Primers with fuzzy bands, small numbers, and unstable amplification were removed, and 16 microsatellite markers with clear, stable, and rich polymorphism were finally obtained. Their names are: Mv01, Mv05, Mv09, Mv12, Mv13, Mv16, Mv18, Mv20, Mv22, Mv30, M42, Mv43, Mv45, Mv70, Mv71, Mv72, Mv75, Mv82, Mv85, and Mv90.

[0050] Example 2: Genetic diversity analysis and cluster analysis of four populations of Tetrapoda tetrapoda using 16 pairs of microsatellite primers

[0051] 1. Four geographic populations of Tetrapoda tetrapoda were collected from coastal areas of China—Tianjin Binhai New Area (TJ), Jiangsu Lianyungang (JS), Liaoning Jinzhou (LN), and Shandong Yantai (SD). The peduncle tissue of Tetrapoda tetrapoda was taken, and genomic DNA was extracted from the tissue using the classic phenol-chloroform method. The DNA quality and concentration were tested using 0.8% agarose gel electrophoresis and an ultra-micro nucleic acid protein detector (Nanodrop2000). The DNA concentration of all samples was adjusted to 100 ng / μL for later use.

[0052] 2. Using the genomic DNA obtained above as a template, HEX fluorescent labeling was performed on the 5' end of each forward primer according to the 16 pairs of microsatellite primer sequences in Table 1, and PCR amplification was performed on 120 individuals from four geographic populations of Tetrapoda tetrapoda. The PCR reaction system was 20 μL, including: 100 ng template DNA, 2 μL 10× buffer, 10 mM dNTP 1 μL (containing Mg 2+), 1 μL each of forward primer (F) and reverse primer (R), 1 U Taq DNA polymerase. The PCR reaction program was 95°C pre-denaturation for 3 min; 94°C denaturation for 45 s, 56-58°C annealing for 30 s, 72°C extension for 60 s, for a total of 35 cycles. The obtained PCR products were analyzed by capillary gel electrophoresis using a 3730XL sequencer (ABI, USA), and the amplified bands were genotyped using GeneMapper 3.2 software.

[0053] 3. The data of 16 microsatellite loci of four geographical populations of tetrahedral clams were obtained through the above steps, and genetic diversity analysis was performed. Microsatellite Analyser (MSA) software was used to calculate the number of alleles (Na), expected heterozygosity (He) and observed heterozygosity (Ho). Polymorphic information content (PIC) was calculated using PIC-CALC 0.6 software. The genetic diversity index data of each population are shown in Table 2. A total of 262 alleles were detected at 16 microsatellite loci, and the number of alleles at each locus ranged from 8 to 25, with an average number of alleles of 16.4. Ho was 0.447-0.942, with an average of 0.709; He was 0.692-0.975, with an average of 0.883; PIC was 0.637-0.960, with an average of 0.857. From the perspective of genetic parameters measuring population genetic diversity such as average allele number, heterozygosity and polymorphic information content, 16 microsatellite loci in the four populations of tetrahedral clams all showed high polymorphism, thus proving that the markers screened by the present invention can fully meet the requirements of genetic diversity analysis of the geographic population of tetrahedral clams.

[0054] Table 2 Genetic diversity parameters of four geographical populations of Tetrapoda tetrapoda

[0055]

[0056] 4. Genetic distance and cluster analysis of four geographical populations of Tetrapoda tetrapoda

[0057] The four-cornered clam populations collected in Tianjin Binhai New Area (TJ), Jiangsu Lianyungang (JS), Liaoning Jinzhou (LN), and Shandong Yantai (SD) were used as the research objects. According to the typing results of the four populations at 16 SSR loci, the Nei's genetic distance was calculated using GenALEX6.0 software (Table 3), and then cluster analysis was performed using Mega software. Figure 2As shown, the results of genetic distance analysis showed that the genetic distance between the Tianjin population and the Jiangsu population of the four-cornered clam was the largest (0.375), and the genetic distance between the Tianjin population and the Shandong population was the smallest (0.192). The UPGMA cluster analysis of the four geographical populations of the four-cornered clam constructed based on Nei's genetic distance showed that the Tianjin population and the Shandong population first clustered into one branch, and then the two populations clustered into one branch with the Liaoning population, and finally clustered into one branch with the Jiangsu population. The clustering results are basically consistent with its geographical distribution, that is, the northern population of the four-cornered clam first clustered into one branch, and the southern population and the northern population were genetically far apart; and among the three northern populations, the Tianjin and Shandong populations had the closest relationship. The results show that the 16 microsatellite markers developed by the present invention can clearly explain the relationship between the geographical populations of the four-cornered clam from a genetic perspective, and have broad application prospects in the genetics of aquatic animal populations.

[0058] Table 3 Genetic distances among four geographic populations of Tetrapoda tetrapoda

[0059]

[0060]

[0061] At present, there are cases of developing microsatellite primers using transcriptomes in other species of aquatic animals, but not in tetrapod clams. In addition, the present invention is based on the reference transcriptome sequencing of the tetrapod whole genome sequence just sequenced in 2022, and the microsatellite primers developed on this basis, while some other species are microsatellite primers developed without reference transcriptome sequences based on reference genomes, which are less accurate and may affect the quality of microsatellite primers.

[0062] The nucleotide sequences amplified from 16 pairs of microsatellite markers Mv01, Mv05, Mv09, Mv12, Mv13, Mv16, Mv18, Mv20, Mv22, Mv30, Mv42, Mv43, Mv45, Mv70, Mv71, and Mv72 in the present invention are as follows: 1

[0064] GCTTTTGTGTTGAATGTTTGATGATACATATCCCTATCTCTTAAGTATTTAGTTGTAATTTTGTACTAAAACAGTGATTTTTATGTGTGCACATATATATATATTTCAAAAACGTCATTTACAAATAAAATTTAATGATTCATACACATACTTCAGTCTTTGTTAGTTATTTTGAAAATGTAACCAGGATTTTTATCTGAGAGTATTATTGTTGCATATAAATGTATA 2

[0066] ACAGTTTCAAGGTGGACCACCAAGAGGACCTCATCCAGATGGTCCTGAGCCACCAAGAGGTTTTGGTCCAAGATTTATGCAAAGACCAAGATTTCATGGACCCAATATGCAACAACACCCAGGTGCTGGTGGCATAAGATTTAGTATACCTAAAAGAAACAAAATGCAACAACAACAACAACAATCTCAGCAACAACAAACGCCAC 3

[0068] CTGGTATATATTTATGAAATCATATTGGTGTAGAAGATCTAGAGTTAGTGTATCAACATCATTTAGTAATGATGGTTATAAACCAGCTAGAAATATTGCTACTAATGTTGTTGTTGATGATGATGATGATGATGATAATGTTGAAAGTGTTCCTGATGATATGAAAGATA 4

[0070] CATCACCTGCTCCAGGAAACACTCTTCAAGTATCCAGTAACTCTCAGTCACGATCTAATAGTAAAACTTTA

[0071] GCTCCTAGGTTACAACAACAACAACAGGTCACCATGGCAACTGGTAGTACAACAA 5

[0073] ACCGAGAGAAATAGAAGAGACTCAAGTACTGGTACTAAATCAAGGTTAAATAATCGTAGAGTTAGTACAAGTGCCTCTAGTCTTAGAAACAGAGATAAGAAGCGTCATGATGATGATGATGATGATGATGTTGATGAGATTAGAGTACCACTGTATGAAGAATGTGTATTTGAATGTAATAATTGGCTAGCAGCT 6

[0075] GGAGCAACAACAACAACAACAATATTCAAGACAATCGTCACGTGACCAAGGAATGCCCAATCAATTCAGTCGACAGTCATCACGTGATCAGCATATAGAACCTCCCACATATAATCCAACGTCACCTGCTGGAAATACTATAAATAGTTTTGATGACATTTTATCACCTTTCGAAAACTTTCAAAACTCTAATTATTGTGACAAACTTTTTG 7

[0077] CTATGTCTTGAAAGTTTAGTCTACTCTAATTTCTATGCCATATATATATATATATATATGTCTATATATAAATTTCTGAACTATTTTATACATATTACAATTATATCAATGGCTAAGCGCAAAACAATGGTAACTCACTCTTTTTTATTGAGTTACGAT 8

[0079] TAACTAGACTGGTTCTTGGATGATGTCAGAATTGTGTCTGAGATTAGATCAGTAATTTGACTGGTTCTTGAATTCGTCAGAAATAGATTTGTTTTTCAATTTCTTCTACCTTCATATTGGATAATACATGAAGTCTGATCCTTAATATCAATTCCCAGGATATATATATATATATTTGTGCTAGA 9

[0081] AGTACATTCATAGAATCTGTACCTGATATATCATTTAATATAGAAACTGATGTAAGTCCTCAAAGTACTAAGTTACTAAGTGAAGACAGTCTTCATGATGAAAACTCAGAAGAAGAAGAAGAAGAATTAGTTCTCATGCTTCTCCAAATTCAACTACCTCACTTCCTGAAGGTAATCTGGTTACTCAGTCTACTTACAGTGAAGATAATGATCTTAACCAGGAAAACT 10

[0083] CCAAACTGATGATAATGAAAGCAATGACCATAATGATAGTGATGATAATTTTAAAAGTTTTGATACTGTT

[0084] GATACTTATAACACGCAAGATAGTCAACATGAACAAAATGATGTTAATGATGATGTTGAT

[0085] GACAATAGTG

[0086] GTGATGATGATGATGAAATCAAAACAAAAACTGCTGATTATGTTACAAATGATATGGATGATGATGAAGG

[0087] AACTAAGCAATCTGTTTCGGATAATTTATCAAGGAGAGAA 11

[0089] TGAAGTCATGGACTAGTGAAAATAGACTTTGACTAATGAAAATTGGATATTTTATATATATATAGTTAATAAT

[0090] TTTGCCTGTTACTATAGAAAAATTATGGGTCTGACTATTGCTTGAGAAAAACTTATAACTGGTATGGTCTT

[0091] TGC 12

[0093] CTCGCGTAGGTAGAAAATCACCAAAATCCGGAGAAGACCCCCAACGAATCCTTCCGAGATTATTCATTTATGAAAGGTCGAGGGTGTTTTCCGAATGGGGTATGGTGGTAAAAGATATGATTGATTTATGTCAATAATAAGTTCTGGTATTTAATTGAGCGACTACTATAATAATAATAATAAATATTCAAACTCCC 13

[0095] TCTAATGATTTAAGTGACCAATCAGATGAAGACTCAGATAAACCTTTGAAGAGTTCTAGAAACACACAACTATCAGACAGTGATAGTGATGACACTGATGATACTCAATCTAAATCTGGACATGATTCCGACACTGATGATGATGATGATACTAATGATTCCAAATCTGCTAATAATGATACCAAGTCT 14

[0097] GTCATTTTGTTGGCATTGTTTTTCACATTTACTGGATGGGTCAATGAACTCATTTTTTATGGAGATCTCTGAATACAGCTTTGTGTATTAGTATATATATATATATATTTACTGATATCCAAGATAAATGAGATGT 15

[0099] TACAATGCCAAGTGATGATGATGATGAAACAGTGTCTATGATAAAAGAATTATTAGATACAAGAATCAGACCTACTGTACAGGAAGATGGTGGAGATATTATATTTATGGGCTATGAAGATGGTGTAGTTAAGTTAAAAA 16

[0101] AGAATCAATTTTAAAAGGGATTCTGACAAAATACATTATATATATATACTGTATACTTTTATCCCAGGAAATCTGTTTGAAATATTGTCGTTTTAATTTTACTCATTTTGATGTATTGCCTTGACGATTGTTTTGAAAGACGAAAGTCTTCTTCATAATTGACCTATAGTTTTTGCTTTATGAGTACACTTATGATTAAGAA

[0102] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. An SSR molecular marker developed based on the transcriptome sequence of Tetrapoda tetragonosa, characterized in that: The SSR molecular markers include 16 microsatellite markers Mv01, Mv05, Mv09, Mv12, Mv13, Mv16, Mv18, Mv20, Mv22, Mv30, Mv42, Mv43, Mv45, Mv70, Mv71, and Mv72, and their corresponding nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.16 respectively.

2. The SSR molecular marker amplification primer according to claim 1, characterized in that: The amplification primers include 16 amplification primer pairs, and the corresponding nucleotide sequences are shown in SEQ ID NO.17-SEQ ID NO.48 respectively.

3. The method for obtaining SSR molecular markers according to claim 1, characterized in that: The steps include: (1) High-throughput transcriptome sequencing was performed on the acidified and control groups of tetrapod clams, and high-quality transcriptome sequences were assembled using the previously performed whole genome sequencing as a reference sequence. In the obtained transcriptome sequences, the original sequencing data was assembled and redundancy removed using Trinity software, resulting in 25,145 Unigenes with an average length of 2017.11 bp; (2) Microsatellite marker screening and primer design Identification and localization of microsatellite sequences were performed using MISA software, and the MISA search parameters were set as follows: mononucleotide, dinucleotide, trinucleotide, tetranucleotide, pentanucleotide, and hexanucleotide, with a minimum number of repeats of 12, 6, 5, 5, 4, and 4, respectively, and the maximum number of bases between two sites of the composite SSR was set to 100. Primers were designed in conjunction with Primerpremier 5 software; The main parameter settings were as follows: primer length was 18-25 bp, PCR amplification product length was between 150 and 300 bp, 52°C≤annealing temperature Tm≤65°C, 20%≤GC content≤80%; at the same time, the results were further verified using Primer-BLAST in the NCBI database, and the main parameters were set as follows: Selfcomplementarity<6, Self′3complementarity<3, and the difference in Tm values ​​between the upstream and downstream primers was no higher than 2°C. Finally, 90 pairs of primers were screened; (3) Using DNA extracted from tetrapod clams as template, the above 90 primer pairs were subjected to PCR amplification. The PCR reaction system was 20 μL, including: 100 ng template DNA, 2 μL 10× buffer, 10 mM Mg 2+ 1 μL of dNTP, 1 μL of forward primer F and reverse primer R, 1U of Taq DNA polymerase; the PCR reaction program was 95℃ pre-denaturation for 3 min; 94℃ denaturation for 45 s, 50-60℃ annealing for 30 s, 72℃ extension for 60 s, a total of 35 cycles; the PCR products were analyzed by capillary gel electrophoresis through a sequencing analyzer, and finally 16 microsatellite markers with clear, stable and rich polymorphism were obtained.

4. Application of the SSR molecular marker as described in claim 1 in the genetic diversity analysis of different populations of tetrapod clams.

5. Use of the SSR molecular marker as claimed in claim 1 in identifying the kinship of tetrapod clams.

6. Use of the SSR molecular marker as described in claim 1 in the construction of a high-density genetic map of Tetrapoda quadrangularis.

7. Use of the SSR molecular marker as described in claim 1 in molecular marker-assisted breeding of tetrapod clams.

Images