Molecular marker related to grape dyeing character and application thereof

Abstract

The invention discloses a molecular marker related to grape staining traits and application thereof, the molecular marker is located on a grape chromosome 2, when a corresponding primer is used for detecting non-staining grapes, only one fragment is generated in gel electrophoresis, and when the molecular marker is used for detecting staining grapes, two or more fragments are generated. A proper primer pair is designed aiming at the molecular marker, distinguishing and identification of grape dyeing characters are achieved through PCR amplification and agarose gel electrophoresis technologies, the molecular marker is especially suitable for application in the aspect of grape crossbreeding, large-scale detection and application can be achieved, the prediction accuracy is high, the optimization rate can be effectively increased, the breeding period is shortened, and the breeding efficiency is improved; the breeding process of the grape variety with the dyeing character is accelerated.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, in particular to molecular markers and applications thereof, in particular to molecular markers related to grape staining traits and applications thereof. Background Art

[0002] Dyed grape varieties refer to grape varieties whose skin, flesh and even nutritional tissue are dark (red). The anthocyanin content of their skin and flesh is much higher than that of non-dyed grape varieties. This characteristic of the variety is called the dyeing trait. Through molecular marker-assisted breeding, early prediction and screening of traits can be carried out in the grape seedling stage, seedlings with target traits can be retained, and seedlings without target traits can be eliminated, so as to achieve early screening of grape dyeing traits and improve grape breeding efficiency.

[0003] In the existing grape breeding practice, the grape coloring traits are mostly selected indirectly through phenotypes to genotypes. However, the plant traits of grape seedlings are unstable. Affected by temperature, light and other conditions, some dyed grape seedlings do not show red, but remain green, making it impossible to accurately judge their coloring traits directly by plant color during the seedling stage. In addition, some non-dyed grapes are affected by the environment or disease, and their leaves are red, but this is not a dyeing trait, which causes certain interference in the identification of dyeing grape varieties. Molecular marker technology is not affected by the external environment and can realize the early identification and selection of grape dyeing traits in the seedling stage.

[0004] CN109929942A discloses SNP molecular markers and applications related to grape skin color. The SNP molecular markers are located on the grape VvmybA3 gene, and the SNP site corresponds to the 2688th base of the VvmybA3 gene cDNA sequence. The grape skin with the base A is colorless, and the grape skin with the base C is colored. Through genotyping detection, if the genotype of the SNP site is C / C or C / A, the grape skin shows as colored, and if the genotype of the SNP site is A / A, the grape skin shows as colorless. The method uses the SNP method, which needs to be subjected to genotyping detection, which is time-consuming and labor-intensive, and has a high economic cost. In view of this, a molecular marker technology for screening and identifying staining traits in the grape seedling stage is developed, which is of great significance to grape breeding level and breeding efficiency. Summary of the invention

[0005] In view of the deficiencies of the prior art, the present invention aims to provide a molecular marker related to grape staining traits and its application to solve the problems mentioned in the background technology.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a molecular marker related to grape staining traits. The molecular marker is located upstream of the MYBA1 gene on grape chromosome 2, and the nucleotide sequence is shown in SEQ ID NO:1.

[0008] It should be noted that by comparing the genome of the pigmented grape (Yan 73) with that of common non-pigmented grape varieties (Cabernet Sauvignon and Rosewood), it was found that there were two 408 bp (SEQ ID NO: 1) fragments inserted upstream of the MYBA1 gene promoter on chromosome 2 of the pigmented grape Yan 73. It is precisely because of the quantitative duplication of the 408 bp sequence in the MYBA1 gene promoter region that the metabolism of the anthocyanin biosynthesis pathway is enhanced, and the content of anthocyanins in grape leaves and berries is increased.

[0009] Further, according to an embodiment of the present invention, when the upstream of the MYBA1 gene contains at least 2 SEQ ID NO: 1 sequences, the grapes appear to be colored.

[0010] Furthermore, a primer pair for detecting molecular markers related to grape staining traits, the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0011] Furthermore, the above primers are used to perform PCR amplification on the genomic DNA of the grape to be tested, and agarose gel electrophoresis is used to detect the number of amplified fragments. When the number of amplified fragments is two or more, the grape phenotype is stained grapes; when the number of amplified fragments is only one, the grape phenotype is non-stained grapes.

[0012] Further, a method for detecting the coloring trait of grapes, the method comprising using the primers SEQ ID NO: 2-3 designed by the present invention to perform PCR amplification on the genomic DNA of the grapes to be tested, detecting the number of amplified fragments, and determining the coloring trait of the grapes to be tested based on the number of amplified fragments;

[0013] When the number of amplified fragments is two or more, the grape phenotype is stained grapes; when the number of amplified fragments is only one, the grape phenotype is non-stained grapes.

[0014] Furthermore, the method for detecting the amplified fragment is agarose gel electrophoresis.

[0015] The application of the above molecular markers related to grape staining traits and corresponding primers in determining grape staining traits.

[0016] The application of the above molecular markers related to grape staining traits and corresponding primers in grape assisted breeding.

[0017] It should be noted that, according to methods well known to those skilled in the art, the primer pair SEQ ID NO: 2-3 of the present invention is not limited to the described sequences. Adding, deleting, or modifying the corresponding base sequences on the basis of the primer pair of the present invention are all included in the primer pair of the present invention as long as the molecular marker of the present invention can be amplified.

[0018] It should be noted that the molecular markers related to grape staining traits and their applications provided by the present invention have the following advantages:

[0019] 1. The molecular markers related to grape staining traits provided by the present invention are not limited by the growth stage of grapes, can be used for early breeding of grapes, and can significantly promote the breeding process of grapes;

[0020] 2. A method for detecting molecular markers related to grape staining traits as shown in SEQ ID NO: 1, which is accurate, reliable and easy to operate;

[0021] 3. Design appropriate primer pairs for the molecular markers, and distinguish and identify grape staining traits through PCR amplification and agarose gel electrophoresis technology, which is particularly suitable for application in grape hybrid breeding, and can effectively improve the selection rate, shorten the breeding period, improve breeding efficiency, and accelerate the selection and breeding process of dyed grape varieties;

[0022] 4. The molecular marker method and specific operation of the present invention are simple and quick, with small amount of test reagents, fast speed and low cost, and can be applied to molecular marker-assisted breeding of dyed grapes. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0024] Figure 1 The gel electrophoresis results of molecular marker fragments of 30 different grape varieties (1-21 are non-stained grape varieties; 22-30 are stained grape varieties);

[0025] Figure 2 The gel electrophoresis images of molecular marker fragments in adult leaves of stained and non-stained grape varieties;

[0026] Figure 3 These are the characteristics of adult leaves of dyed grape varieties and non-dyed grape varieties (1 is an adult red leaf, 2 is a diseased red leaf, and 3 is an adult green leaf). DETAILED DESCRIPTION

[0027] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0028] The present invention provides a molecular marker related to grape staining traits. The molecular marker is located upstream of the MYBA1 gene on grape chromosome 2, and the nucleotide sequence is shown in SEQ ID NO:1.

[0029] The nucleotide sequence shown in SEQ ID NO: 1 is a gene fragment amplified from the grape staining trait, specifically:

[0030] TGAATGGGACATTACGTAGAAGATTTGGATTCTGATACCACTGTTTCCTTAGACAAAAAGCAACCAAGTGACGGGAACCTTTGAGGGCCACCGCTCCTCTTTCAACTTGAACATTTTCTTTTGTCGACTAACCCATGTTCACTGAAAAGGAAAGCTCCATGGGCCCTCTACCATTATATTATAGCCGCTATGCAGTGGCAGCAG CTAATTAATGGGAATTGTCAGTGAGGAAAGGTACAATCATTAGGATATGCCTCTGGCTGGCGGAGGACTTTGTTTCTGATCAGTAACGTCGATAAAAATATATTTAGAACATTTTCTAATGTCAATTCAATGACCGGGTTCATTCTCAACCATCCATCTGTTGCTTGGGACGTGTGTCATTTCCTACCATGTATTCTTCTCAC

[0031] Furthermore, when the upstream of the MYBA1 gene contains at least 2 SEQ ID NO: 1 sequences, the grapes are colored.

[0032] Furthermore, a primer pair for detecting molecular markers related to grape staining traits, the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3. Specifically:

[0033] Forward primer: 5'-TGAATGGGACATTACGTAGAAGATTT-3' (SEQ ID NO: 2)

[0034] Reverse primer: 5'-GTGAGAAGAATACATGGTAGGAAATGA-3' (SEQ ID NO: 3)

[0035] Furthermore, the above primers are used to perform PCR amplification on the genomic DNA of the grape to be tested, and agarose gel electrophoresis is used to detect the number of amplified fragments. When the number of amplified fragments is two or more, the grape phenotype is stained grapes; when the number of amplified fragments is only one, the grape phenotype is non-stained grapes.

[0036] Further, a method for detecting the coloring trait of grapes, the method comprising using the primers SEQ ID NO: 2-3 designed by the present invention to perform PCR amplification on the genomic DNA of the grapes to be tested, detecting the number of amplified fragments, and determining the coloring trait of the grapes to be tested based on the number of amplified fragments;

[0037] When the number of amplified fragments is two or more, the grape phenotype is stained grapes; when the number of amplified fragments is only one, the grape phenotype is non-stained grapes.

[0038] Furthermore, the method for detecting the amplified fragment is agarose gel electrophoresis.

[0039] Example 1 Genome extraction and fragment amplification

[0040] Thirty grape varieties were randomly selected, young grape leaves were collected, quickly frozen with liquid nitrogen, and stored in a -80°C refrigerator for later use.

[0041] 1. Extraction of genomic DNA from grape leaves

[0042] 1. Take 1-2 fresh leaves and put them into a pre-cooled mortar, add liquid nitrogen, and grind them into powder;

[0043] 2. Transfer the powder into a 2 ml centrifuge tube, and before thawing, quickly add 800 μL of preheated extract (2×CTAB, 20 g / L; Tris-HCl, 100 mmol / L; EDTA, 20 mmol / L; NaCl, 81 g / L; β-mercaptoethanol, 0.1%, added after sterilization and before use; PVP, 1%, added after sterilization and before use), mix well, and place in a 65°C water bath for 60 min, inverting and mixing thoroughly every 10 min;

[0044] 3. Add 800 μL of chloroform / isoamyl alcohol (24:1) to the centrifuge tube, gently invert to mix, centrifuge at 12000 rpm for 10 min at room temperature, and pipette the supernatant into another new 1.5 ml centrifuge tube;

[0045] 4. Add an equal volume of isopropanol to the centrifuge tube, invert and mix thoroughly, and a white flocculent precipitate will appear. Freeze at -20℃ for 1h, and centrifuge at 12000rpm for 5min at room temperature;

[0046] 5. Wash twice with 75% ethanol, i.e. add 75% ethanol, flick to mix, centrifuge at 12000 rpm for 5 min, repeat once;

[0047] 6. After the ethanol evaporates, add 100 μL of sterile water, dissolve for 30 minutes, and store at -20°C for later use.

[0048] 2. Design primer pairs based on the upstream and downstream sequences of the molecular marker site

[0049] Forward primer sequence: 5′-TGAATGGGACATTACGTAGAAGATTT-3′, reverse primer sequence: 5′-GTGAGAAGAATACATGGTAGGAAATGA-3′.

[0050] The PCR reaction system is as follows:

[0051]

[0052] The PCR reaction program was as follows: pre-denaturation at 95°C for 3 minutes; then the following cycles were performed: denaturation at 95°C for 30 seconds, annealing at 66°C for 30 seconds, and extension at 72°C for 30 seconds, for a total of 35 cycles; and finally extension at 72°C for 5 minutes.

[0053] Finally, different DNA fragments were amplified. The DNA fragment of the stained grapes had two or more bands, that is, there were at least 408bp and 816bp bands; the DNA fragment of the non-stained grapes had only one band, that is, 408bp. The correlation between this fragment and the staining trait is as follows Figure 1 As shown, the PCR results showed that the number of repeats of the sequence completely matched the grape staining trait.

[0054] Example 2 Validation of Molecular Markers

[0055] The labeled primers were used to identify whether the leaves of adult plants had the dyeing trait, and PCR identification was performed on grape leaves of multiple varieties and different states. The extraction method of grape leaf genomic DNA and the PCR reaction system refer to the method in Example 1.

[0056] like Figure 2 and Figure 3 Marselan and Beimei are non-staining grape varieties, and their leaves in different states have only one fragment, namely 408bp; Yan73 is a staining grape variety (its skin, flesh and nutrient tissue are red), and there are three fragments, namely 408bp, 816bp and 1224bp. This shows that this molecular marker can be used to identify the staining trait of grapes.

[0057] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should be included in the scope of the claims of the present invention. The techniques, shapes, and structural parts not described in detail in the present invention are all well-known technologies.

Claims

1. A molecular marker related to grape staining traits, characterized in that: The molecular marker is located upstream of the MYBA1 gene on grape chromosome 2, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO:

1.

2. The molecular marker related to grape staining traits according to claim 1, characterized in that: When there are at least two SEQ ID NO: 1 sequences upstream of the MYBA1 gene on chromosome 2 of the grape, the trait is colored grapes.

3. A primer pair for detecting the molecular marker according to claim 1, characterized in that: The nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

4. The primer pair according to claim 3, characterized in that: The primers are used to perform PCR amplification on the genomic DNA of the grape to be tested, and the number of amplified fragments is detected by agarose gel electrophoresis. When the number of amplified fragments is two or more, the grape phenotype is a stained grape; when the number of amplified fragments is only one, the grape phenotype is a non-stained grape.

5. Use of the molecular marker according to claim 1 or the primer pair according to claim 3 in determining the staining trait of grapes.

6. Use of the molecular marker according to claim 1 or the primer pair according to claim 3 in grape assisted breeding.

Images