Cassava plant height SNP molecular marker, KASP primer group and application of cassava plant height SNP molecular marker and KASP primer group

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a cassava plant height SNP molecular marker, a KASP primer group and application of the cassava plant height SNP molecular marker and the KASP primer group. According to the cassava plant height SNP molecular marker, the allelic variation basic group of the SNP molecular marker site is C / T, and the allelic variation basic group is located at the 3091721 site of a cassava genome 6 # chromosome. The SNP molecular marker is remarkably related to the cassava plant height character, in practical application, the cassava plant height phenotype can be subjected to early-stage auxiliary prediction and identification only by utilizing the KASP primer group to carry out PCR amplification on cassava germplasm leaf sample DNA and detecting a fluorescence signal of the cassava germplasm leaf sample DNA, operation is easy and convenient, cost is low, selection efficiency is high, and the SNP molecular marker can be used for early-stage auxiliary prediction and identification of the cassava germplasm plant height phenotype. Target single plants or a large number of offspring with potential excellent quality can be efficiently screened, the cassava breeding period is shortened, and the breeding efficiency is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a cassava plant height SNP molecular marker, a KASP primer set and applications thereof. Background Art

[0002] Cassava (Manihot esculenta Crantz) is a plant of the genus Cassava in the Euphorbiaceae family. It is the staple food of more than 1 billion people in the world and is listed as the sixth largest food crop in the world. It is also an important raw material for industries such as alcohol, pharmaceuticals, and feed. In recent years, affected by climate change and the epidemic, the global food and energy supply chain has suffered a shock. As a crop with both food and energy characteristics, cassava has huge economic value and market potential and has received widespread attention from all over the world. However, due to various reasons, the problems of low cassava yield, poor lodging resistance, single variety, aging, and low mechanization level have not been solved, which seriously restricts the development of my country's cassava industry. Plant height is one of the most important plant traits of cassava, which has an important impact on the yield and quality of cassava. In addition, dwarfing plant height is conducive to mechanized harvesting, improving yield and photosynthetic efficiency, fertilizer resistance, dense planting resistance, lodging resistance, enhancing the transportation of crop nutrients to reproductive organs, etc., and can also reduce the use of chemical growth regulators, which is conducive to protecting the ecological environment. Therefore, cultivating cassava varieties with dwarfed plant height is an important issue that needs to be urgently solved in the development of my country's cassava industry.

[0003] Due to the complex genetic background and long growth cycle of cassava, the traditional breeding method has low genetic improvement efficiency, long time consumption, and labor-intensive, and the plant height development is easily affected by external factors. It is difficult to screen out cassava varieties with dwarfed plant height through traditional breeding methods. The development of modern molecular biology technology enables us to use molecular markers closely linked to related traits to select parents or pre-screen hybrid offspring, thereby improving breeding efficiency. Therefore, the establishment of an efficient DNA molecular marker and its detection method has become one of the problems that need to be solved in identifying cassava plant height, which is of great significance to cassava breeding.

[0004] Competitive allele specific PCR (KASP) technology is a method for SNP typing based on specific matching of primer terminal bases and universal fluorescent probes. Typing can be achieved using a fluorescent quantitative PCR instrument or a common PCR instrument combined with an enzyme marker. It has the advantages of high throughput, low cost, stability, high efficiency, accuracy, and flexibility. KASP molecular markers have become a new generation of SNP typing markers and have been widely used in gene fine positioning, molecular marker-assisted selection breeding, and germplasm resource identification of various crops. However, the application of KASP markers in cassava breeding has rarely been reported, and there has been no research on cassava plant height-related molecular markers. Therefore, the development and design of KASP molecular markers related to cassava plant height, the genotyping verification of natural populations and hybrid populations, and the support for the use of KASP markers for cassava parent selection and early selection of hybrid offspring will help accelerate the cassava breeding selection process and improve breeding efficiency.

[0005] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0006] The object of the present invention is to provide a SNP molecular marker related to cassava plant height, a KASP primer set and an application thereof. The SNP molecular marker and the KASP primer set can perform early auxiliary prediction and identification of the plant height phenotype of cassava germplasm, are simple and convenient to operate, have low cost and high selection efficiency, can efficiently screen target individual plants or a large number of progeny with potential excellent quality, shorten the cassava breeding cycle and improve the breeding efficiency.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] The first object of the present invention is to provide a cassava plant height SNP molecular marker, the nucleotide sequence of the cassava plant height SNP molecular marker is as follows:

[0009] AGGTTCCTCCACATGATATTTGTTATCAGAGGTTCCCTAAATAAATGATATG ACATGAGCAAATTTACATAACATCTAAAATGCAAAATGGAATTGCCTAAGCTGG TTTGTTAACAGAGCTGAATCTCTGAAAAGTGAACAAAAGATGC[C / T]AAGTAGA CATAAAACAATAGAATTAAAGTCAAAAATCCATTTTCTTGGACTACCAAAAAT TGAAAATTAGCAACTCCTTGCCTCGTAAGCAAGGACAAAGCAATTTATTAAAGA AAAATTCACAATCCCAACAAATATTACAGTTTGCA;

[0010] The allele variation base of the SNP molecular marker site is C / T, which is located at position 3091721 of chromosome 6 of the cassava genome.

[0011] The second object of the present invention is to provide a KASP primer set for detecting the cassava plant height SNP molecular marker, the KASP primer set consists of a forward primer Fc, a forward primer Ft and a universal reverse primer R, and the nucleotide sequences thereof are shown in SEQ ID No.1-3 in sequence.

[0012] Furthermore, one end of the forward primer Fc is connected to a FAM fluorescent label sequence, and one end of the forward primer Ft is connected to a HEX fluorescent label sequence.

[0013] The third object of the present invention is to provide an application of the KASP primer set in identifying high-quality cassava strains.

[0014] A fourth object of the present invention is to provide a method for identifying cassava plant height using the KASP primer set, comprising the following steps:

[0015] S1. extracting genomic DNA of the cassava germplasm to be identified, and performing PCR amplification using the KASP primer set to obtain a PCR amplification product;

[0016] S2. Determine the plant height of the cassava germplasm to be identified based on the fluorescence signal results of the PCR amplification product.

[0017] Further, in step S1, the PCR amplification system is: the PCR amplification system is: template DNA 2 μL, 2×PARMS mastermix 5 μL, 10 μM forward primer Fc 0.15 μL, 10 μM forward primer Ft 0.15 μL, 10 μM reverse primer R 0.4 μL, ddH2O 3.3 μL.

[0018] Furthermore, in step S1, the PCR amplification program is: pre-denaturation at 94°C for 20 min; denaturation at 94°C for 20 s, extension at 65-57°C for 1 min, 10 cycles, with the extension temperature decreasing by 0.8°C in each cycle; denaturation at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles.

[0019] Furthermore, in step S2, if the fluorescence signal result of the PCR amplification product is FAM, it means that the CC homozygous genotype is detected, and the cassava germplasm to be identified is a dwarf variety;

[0020] If the fluorescence signal result of the PCR amplification product is HEX, it means that the TT homozygous genotype is detected, and the cassava germplasm to be identified is a tall-stem variety.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The SNP molecular marker of the present invention is significantly correlated with the cassava plant height trait. In practical applications, it is only necessary to use the KASP primer set of the present invention to perform PCR amplification on the DNA of cassava germplasm leaf samples and detect its fluorescence signal to perform early auxiliary prediction and identification of the cassava germplasm plant height phenotype. The operation is simple and convenient, the cost is low, and the selection efficiency is high. Target single plants or a large number of progeny with potential excellent quality can be efficiently screened, the cassava breeding cycle is shortened, and the breeding efficiency is improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the typing situation of different genotypes of cassava.

[0024] Description of main reference numerals:

[0025] Figure 1 In the figure, the FAM fluorescence signal result is blue on the genotyping diagram, indicating that the CC homozygous genotype is detected;

[0026] The HEX fluorescence signal result is green on the typing diagram, indicating that the TT homozygous genotype is detected;

[0027] The FAMHEX fluorescence signal result is red on the genotyping diagram, indicating that the CT heterozygous genotype has been detected. DETAILED DESCRIPTION

[0028] The following is a clear and complete description of the technical solution of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by technicians in this field without creative work are within the scope of protection of the present invention.

[0029] Example 1 :SNP molecular marker

[0030] A cassava plant height SNP molecular marker, characterized in that the nucleotide sequence of the cassava plant height SNP molecular marker is as follows:

[0031] AGGTTCCTCCACATGATATTTGTTATCAGAGGTTCCCTAAATAAATGATATG ACATGAGCAAATTTACATAACATCTAAAATGCAAAATGGAATTGCCTAAGCTGG TTTGTTAACAGAGCTGAATCTCTGAAAAGTGAACAAAAGATGC[C / T]AAGTAGA CATAAAACAATAGAATTAAAGTCAAAAATCCATTTTCTTGGACTACCAAAAAT TGAAAATTAGCAACTCCTTGCCTCGTAAGCAAGGACAAAGCAATTTATTAAAGA AAAATTCACAATCCCAACAAATATTACAGTTTGCA;

[0032] The allele variation base of the SNP molecular marker site is C / T, which is located at position 3091721 of chromosome 6 of the cassava genome.

[0033] When the mutant base is C, the genotype is CC or CT; when the mutant base is T, the genotype is TT. Among them, when the genotype is CC, the cassava is a short-stem variety; when the genotype is TT, the cassava is a tall-stem variety.

[0034] Example 2 : KASP primer set

[0035] A KASP primer set for detecting the cassava plant height SNP molecular marker, the KASP primer set consists of a forward primer Fc, a forward primer Ft and a universal reverse primer R, and the sequence thereof is shown in Table 1 below.

[0036] Table 1 Molecular detection primer set sequences

[0037]

[0038] Example 3 :KASP primer set and cassava strains with high specificity

[0039] 1. At maturity, 214 cassava germplasms were selected and their plant heights (the distance from the base of the cassava plant to the highest point of the cassava plant) were measured with a ruler. Three plants were selected from each germplasm for measurement and the average value was taken as the plant height value of the germplasm;

[0040] 2. Take a cassava germplasm leaf sample with a length and width of about 1 cm and place it in a deep well plate (96 wells, 1.2 mL), add 100 μL of 0.3 mol / L sodium hydroxide solution, and grind at 50 Hz until the sample is completely ground;

[0041] 3. The ground product was centrifuged at 300 rpm for 1 min, boiled in water for 2 min, 200 μL of 0.2 mol / L Tris-HCl (pH 6.8-7.0) was added and mixed, and boiled in water for 2 min again;

[0042] 4. After the water bath, centrifuge at 300 rpm for 1 min, dilute the supernatant 20 times, and store at -20°C as the template DNA for subsequent PCR amplification;

[0043] 5. Construct the PCR amplification reaction system in Table 2 below, and perform PCR amplification according to the PCR amplification program in Table 3;

[0044] Table 2 PCR amplification reaction system

[0045]

[0046] Table 3 PCR amplification program (dual-head 384 PCR instrument ABI GeneAmp 9700)

[0047]

[0048] 6. After PCR amplification, the fluorescence signal was read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results were output according to different colors. The results are shown in Tables 4-5 and Figure 1 .

[0049] Table 4 Plant height phenotypes and fluorescence signal results of different cassava germplasms

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Table 5 TT test statistical results

[0059]

[0060] Combining Table 4, Table 5 and Figure 1 , 214 cassava germplasm samples were genotyped using the KASP primer set of the present invention, and combined with the actual plant height types of the cassava germplasm samples, it was found that the genotyping results were clustered significantly and highly matched with the actual plant height phenotype, and at the same time, the fluorescence signal results of the PCR amplification products of the KASP primer set were significantly different. This shows that the KASP primer set of the present invention is specific to the cassava plant height phenotype.

[0061] Example 4 :Validity verification

[0062] At the maturity stage, the main cassava varieties currently in production were selected, and the plant heights of these varieties were measured with a ruler. Three plants of each variety were measured and the average value was taken as the actual height of the variety. Then the steps and methods in Example 3 were followed, and the results are shown in Table 6.

[0063] Table 6 Results of plant height phenotype and fluorescence signal type of cassava germplasm

[0064]

[0065] As shown in Table 6, the plant heights of different cassava germplasm phenotypes correspond to the types of fluorescent signals detected by the KASP primer set of the present invention, and the verification accuracy is 100%.

[0066] In summary, the KASP primer set of the present invention can be used as a primer set for detecting SNP molecular markers of cassava plant height, and can assist in the prediction and identification of plant height phenotypes of cassava germplasm.

[0067] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. The scope of the present invention is intended to be limited by the claims and their equivalents.

Claims

1. A cassava plant height SNP molecular marker, characterized in that: The allele variation base of the SNP molecular marker site is C / T, which is located at position 3091721 of chromosome 6 of the cassava genome.

2. A KASP primer set for detecting the cassava plant height SNP molecular marker, characterized in that: The KASP primer set consists of a forward primer Fc, a forward primer Ft and a reverse primer R, and the nucleotide sequences thereof are shown in SEQ ID No. 1-3 in sequence.

3. The KASP primer set according to claim 2, characterized in that: One end of the forward primer Fc is connected to a FAM fluorescent label sequence, and one end of the forward primer Ft is connected to a HEX fluorescent label sequence.

4. Use of the KASP primer set according to claim 2 in identifying high-quality cassava strains.

5. A method for identifying cassava plant height using the KASP primer set according to claim 2, characterized in that: The following steps are involved: S1. extracting genomic DNA from the cassava germplasm to be identified, and performing PCR amplification using the KASP primer set according to claim 2 to obtain a PCR amplification product; S2. Determine the plant height of the cassava germplasm to be identified based on the fluorescence signal results of the PCR amplification product.

6. The method according to claim 5, characterized in that In step S1, the PCR amplification system is: template DNA 2 μL, 2×PARMS mastermix 5 μL, 10 μM forward primer Fc 0.15 μL, 10 μM forward primer Ft 0.15 μL, 10 μM reverse primer R 0.4 μL, ddH2O 3.3 μL.

7. The method according to claim 5, characterized in that In step S1, the PCR amplification program is: pre-denaturation at 94°C for 20 min; denaturation at 94°C for 20 s, extension at 65-57°C for 1 min, 10 cycles, with the extension temperature decreasing by 0.8°C in each cycle; denaturation at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles.

8. The method according to claim 5, characterized in that In step S2, if the fluorescence signal result of the PCR amplification product is FAM, it means that the CC homozygous genotype is detected, and the cassava germplasm to be identified is a dwarf variety; If the fluorescence signal result of the PCR amplification product is HEX, it means that the TT homozygous genotype is detected, and the cassava germplasm to be identified is a tall-stem variety.

Images