Multiple detection primer composition, detection method and kit for replicative retroviruses of different virus vectors

Abstract

The invention belongs to the technical field of biology, and particularly relates to a multiple detection primer composition, a detection method and a kit for replicative retroviruses of different virus vectors, and the multiple detection primer composition comprises nucleotide sequences such as Seq ID No: 1 to Seq ID No: 9. According to the multiple detection method for simultaneously detecting the replicated retroviruses (RCR) of different virus vectors by utilizing a taqman probe technology of real-time fluorescent quantitative PCR and the kit prepared according to the method, the lowest detection quantity limit of the kit for detecting the replicated retroviruses (RCR) of different virus vectors is as low as 50 copies / reaction.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a multiplex detection primer composition, a detection method and a kit for replicating retrovirus (RCR) of different viral vectors. Background Art

[0002] Retroviruses, also known as reverse transcriptases, belong to a class of RNA viruses whose genetic information is stored in ribonucleic acid (RNA) rather than deoxyribonucleic acid (DNA). The retroviral genome is diploid, consisting of two identical single-stranded positive-strand RNA strands flanked by long terminal repeats (LTRs). These strands contain strong promoters and enhancers, which play a crucial role in regulating viral DNA transcription. The viral core contains reverse transcriptase and integrase. Unlike other RNA viruses, retroviral RNA does not replicate itself. Upon entry into host cells, reverse transcriptase synthesizes the RNA into double-stranded DNA, which is then integrated into the host cell's chromosomal DNA by integrase to form a provirus, establishing a lifelong infection that can be transmitted to daughter cells as the host cell divides.

[0003] Replicating retroviral vectors are viral vectors based on the retrovirus family. They can effectively integrate exogenous genes into the chromosomes of host cells, thereby achieving the purpose of persistent expression. These vectors are usually derived from lentiviruses such as human immunodeficiency virus (HIV) and have been modified to ensure their safety in gene therapy. Retroviruses have been widely used as gene carriers in gene and cell therapy products. Currently, common viral vectors include lentiviruses and retroviruses. During the production process, if contaminated by replication-competent viruses or if the vector undergoes recombination, the viral vector may be mixed with replicating viruses.

[0004] GALV (Gibbon Ape Leukemia Virus): A retrovirus. Its replication-defective viral vectors are widely used in gene therapy research to mediate the transfer and expression of target genes in targeted cells. RD114 (Retrovirus-Derived from Domestic Cat): A retrovirus derived from domestic cats. This retrovirus vector is also used in gene therapy and cell therapy research.

[0005] Currently, all retroviruses used in cell therapy are designed to be replication-defective. The genomic RNA of defective viral vectors lacks the gag, pol, and env sequences required for retroviral replication. This theoretically greatly reduces the risk of producing replicative viruses. However, these packaging elements are essential during the production of retroviral vectors, thus creating the possibility of homologous recombination to produce replicative retroviruses. Replicating lentiviruses / retroviruses (RCL / RCR) can integrate the viral genome into the cellular genome, posing the risk of activating oncogenes and disrupting tumor suppressor genes, leading to secondary tumors. Furthermore, their replicative nature increases the potential risks associated with RCR / RCL. Because of the potential pathogenicity of replicating retroviruses (RCR), rigorous testing is necessary to exclude the presence of RCR in retroviral-based human cell therapy products.

[0006] Replicating retrovirus (RCR) detection: According to the current level of research technology, a sensitive indicator cell culture method is generally used to perform RCR detection on γ-retroviral vectors. RCR amplified cells are co-cultured with the sample to be tested to maximize the amplification of RCR. After a certain number of passages and time of subculture, an appropriate amount of supernatant is taken to inoculate RCR indicator cell culture to observe and count cytopathic colonies or detect RCR markers. Conventional methods rely solely on cytopathic effects to judge results, which may result in false positives. The US FDA recommends the use of a cell-based detection protocol, but this protocol is time-consuming, up to 4-6 months, and this method is not suitable for the release of cell therapy products that require fresh cell products. Real-time fluorescence quantitative polymerase chain reaction (qPCR) is a nucleic acid detection technology with high sensitivity, strong specificity, and can be quantified through real-time monitoring. Specific viral sequences are used to design primer probe combinations for qPCR detection to improve the sensitivity of detection and shorten the detection cycle. Summary of the Invention

[0007] The object of the present invention is to provide a multiplex detection primer composition for replicating retroviruses of different viral vectors.

[0008] Another object of the present invention is to provide a multiplex qPCR detection kit for replicating retroviruses of different viral vectors.

[0009] The technical solution adopted by the present invention to solve its technical problem is:

[0010] A multiplex detection primer composition for replicating retroviruses of different viral vectors, wherein the viral vectors include two retroviral vectors, GALV (Gibbon simian leukemia virus) and RD114 (feline leukemia virus), and the multiplex detection primer composition includes the following primer probes:

[0011] 5'-TGTWTTACTGGGGTTGGGA-3', Seq ID No: 1;

[0012] GALV reverse primer sequence: 5′-TGACTRAGTCTTGGAGGGC-3′, Seq ID No: 2;

[0013] GALV Taqman probe: 5'-TCGCCAYAGATGCTGACCTCCG-3', Seq ID No: 3;

[0014] RD114 forward primer sequence: 5'-TTACTAGMTGGACTGGGAA-3', Seq ID No: 4 RD114 reverse primer sequence: 5'-TTGTATACWGGGTGACGGA-3', Seq ID No: 5;

[0015] RD114 probe sequence: 5′-ACCGCAGYATTCACCACCG-3′, Seq ID No: 6;

[0016] IPC forward primer sequence: 5'-GCGCTTCCCCATGCCAT-3', Seq ID No: 7

[0017] IPC reverse primer sequence: 5′-GATGTCCCTTACAATTTCCCGCTCA-3′, Seq ID No: 8;

[0018] IPC probe sequence: 5′-TCCCGACCAGCGAGATCCAAACGAA-3′, Seq ID No: 9;

[0019] The 5' end of the GALV Taqman probe is labeled with a fluorescent reporter group, which is VIC, and the 3' end is labeled with a quencher group, which is BHQ1;

[0020] The 5' end of the RD114 Taqman probe is labeled with a fluorescent reporter group, which is FAM, and the 3' end is labeled with a quencher group, which is BHQ1;

[0021] The 5' end of the IPC probe is labeled with a fluorescent reporter group, which is CY5, and the 3' end is labeled with a quencher group, which is BHQ2.

[0022] A multiplex qPCR detection kit for replicating retroviruses of different viral vectors, the kit comprising the multiplex detection primer composition of claim 1. Preferably, the kit further comprises a PCR amplification reaction solution, a primer-probe mixture, an RNA standard, and a nucleic acid diluent.

[0023] Preferably, in the kit: the forward primer concentration in the primer-probe mixture is 0.2-0.5 μmol / L, the reverse primer concentration is 0.2-0.5 μmol / L, and the oligonucleotide probe concentration is 0.1-0.3 μmol / L.

[0024] Preferably, the PCR amplification reaction solution is a fluorescent quantitative PCR reaction premix, comprising 2×One Step RT-PCR Buffer III, Ex Taq HS, RT Enzyme Mix II, ROX Reference Dye internal reference dye, and nuclease-free water, with a reaction volume of 20 μL. The template used can be a standard or a sample nucleic acid to be tested.

[0025] Preferably, the RNA standard contains positive RNA fragments with a concentration of 1×10 8 copies / μL.

[0026] Preferably, the fluorescent quantitative PCR reaction system in the detection kit is 20 μL, including 11 μL of the PCR amplification reaction solution, 4 μL of primer probe mixture and 5 μL of template; the template is the RNA of the sample to be tested, the positive control standard and the negative control standard.

[0027] A method for detecting the RCR of replicating retroviruses of different viral vectors in non-diagnostic or therapeutic cell therapy products, the method comprising the following steps:

[0028] S1, sample RNA extraction;

[0029] S2. Establish a multiplex real-time fluorescence quantitative qPCR reaction system using the multiplex detection primer combination and perform PCR amplification. S3. Analyze the test sample results: Calculate the viral content in the test sample based on the resulting standard curve. This detection method achieves a minimum detection limit of 50 copies / reaction for replicating retroviruses (RCRs) from different viral vectors.

[0030] Preferably, the fluorescent quantitative PCR reaction system is 20 μL, comprising 11 μL of the PCR amplification reaction solution, 4 μL of the primer-probe mixture and 5 μL of the template; the template is the RNA of the sample to be tested, a positive control standard and a negative control standard; the PCR amplification reaction solution includes 2×One Step RT-PCR Buffer III, Ex Taq HS, RT Enzyme Mix II, ROX Reference Dye internal reference dye, and nuclease-free water.

[0031] Preferably, the reaction conditions for fluorescence quantitative qPCR detection are: reverse transcription at 42°C for 5 min, pre-denaturation at 95°C for 3 min; denaturation at 95°C for 5 s, annealing at 58°C for 34 s, 5 cycles; denaturation at 95°C for 5 s, annealing at 60°C for 34 s, 40 cycles.

[0032] The beneficial effects of the present invention are:

[0033] 1. The present invention utilizes the Taqman probe technology of real-time fluorescence quantitative PCR to simultaneously detect multiple RNA viruses in retroviral vectors in a single reaction system. By analyzing and comparing with the database, the conserved sequences of the viral genome are found and primer probes are designed.

[0034] 2. The present invention has high sensitivity and strong specificity. The qPCR method can detect very low copy numbers of retroviruses, such as GALV and RD114, making it very effective in the early detection of viral contamination. By using specific primers and probes, qPCR can specifically identify and amplify the genetic material of the target virus, thereby reducing false positive results.

[0035] 3. The kit prepared by the present invention pre-mixes the required raw material components, which reduces the tediousness and complexity of the operation process, improves work efficiency and accuracy, and reduces intra-batch and inter-batch differences.

[0036] 4. Short detection time improves product safety. This invention can complete the entire detection process within 3 hours, and through real-time monitoring of the PCR reaction, quantitative results can be quickly obtained. This provides immediate test results in clinical and production environments, facilitating rapid decision-making. Using qPCR to detect replicating retroviruses such as GALV and RD114 can effectively reduce the risk of viral contamination during the production stage. This helps ensure product safety and quality, and avoids production delays and economic losses caused by viral contamination.

[0037] 5. The present invention adds an internal standard IPC, namely the internal positive control (IPC), which is a key component in the kit for ensuring the reliability and accuracy of the experimental results. IPC is usually included in the qPCR kit and is used to monitor the entire qPCR process, including sample preparation, amplification and detection steps, to ensure that there are no experimental operating errors or the presence of inhibitors that affect the experimental results. IPC can monitor the entire experimental process to ensure that there is no non-specific amplification or inhibitor effects caused by operating errors, and whether there are inhibitors that affect the progress of the qPCR reaction. It not only monitors the reliability of the experimental process, but also provides quality control, verifies the accuracy of the experimental results, and helps standardize experimental conditions.

[0038] 6. The real-time fluorescence quantitative PCR kit provided by this invention is suitable for the detection of specific viruses such as GALV and RD114. This qPCR method can establish standardized detection procedures and quality control standards, helping to ensure the consistency and reproducibility of test results. By using the established standard curve, samples can be quantitatively analyzed, thereby achieving accurate monitoring of retroviruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the GALV primer-probe screening fluorescence quantitative PCR amplification curve;

[0040] Figure 2 This is the fluorescence quantitative PCR amplification curve screened by RD114 primer probe;

[0041] Figure 3 is the fluorescence quantitative PCR amplification curve of GALV of the present invention;

[0042] Figure 4 is the GALV fluorescence quantitative PCR standard curve of the present invention;

[0043] Figure 5 is the fluorescence quantitative PCR amplification curve of RD114 of the present invention;

[0044] Figure 6 This is the standard curve of the RD114 fluorescence quantitative PCR of the present invention. DETAILED DESCRIPTION

[0045] The technical solution of the present invention is further described in detail below through specific examples. It should be understood that the implementation of the present invention is not limited to the following examples, and any form of modification and / or change made to the present invention will fall within the scope of protection of the present invention.

[0046] In the present invention, unless otherwise specified, all parts and percentages are by weight, and the equipment and raw materials used are commercially available or commonly used in the art. The methods in the following examples are all conventional methods in the art unless otherwise specified.

[0047] The present invention will now be further described in conjunction with specific examples. The following examples are only intended to explain the present invention but do not limit the present invention. The test samples and test procedures used in the following examples include the following (if the specific experimental conditions are not specified in the examples, they are usually based on conventional conditions or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources).

[0048] The experimental materials used in the examples of the present invention are:

[0049] One Step PrimeScript TM The RT-PCR Kit (Perfect Real Time) and ROX were manufactured by TAKARA, and the nuclease-free water was manufactured by Invitrogen;

[0050] RNA extraction kit: purchased from Beyotime;

[0051] RNA standards were synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0052] ABI7500 fluorescence quantitative PCR instrument was purchased from ABI (Applied Biosystems, USA); nucleic acid diluent was prepared using analytical grade reagents.

[0053] Example 1 Primer Design and Detection of RCR by Fluorescence Quantitative PCR

[0054] 1. Design and synthesis of primers and probes

[0055] By comparing the nucleotide sequences of different RCR viral vectors GALV and RD114 in the Genbank database and those reported in published literature domestically and internationally, the main Env gene was used as the amplification target site. A highly conserved region with no secondary structure was selected. Based on the basic principles of primer and probe design, multiple pairs of primers and probes were designed using Oligo7 software and manual methods. An internal reference gene with low homology and a distant relationship to the viral vector was also selected as an internal positive control (IPC). Primers and probes were also designed using Oligo7 software and manual methods based on the basic principles of primer and probe design.

[0056] In the qPCR reaction, the combination of primers and probes is a key factor affecting the detection ability. Under different detection conditions, such as the presence of multiple pathogens or different interfering substances, the primer and probe combination used is required to maintain high specificity and sensitivity, while having a good amplification curve and detection signal intensity. To this end, we screened the primer probes separately, and used two sets of probe primer combinations from Seq ID No: 1 to Seq ID No: 6 and the control primer probe combination (see Table 1 for details) to detect GALV and RD114 references. The control primer probes were control combination 1 and control combination 2, respectively. Among them, control combination 1 was the GALV control primer 1-F, GALV control primer 1-R, and GALV control probe 1-P shown in the table, and control combination 2 included: RD114 control primer 2-F, RD114 control primer 2-R, and RD114 control probe 2-P. In addition, GALV and RD114 references were used as test samples for detection using the ABI 7500 platform, and the results are as follows. Figure 1-2 shown.

[0057] Table 1 Nucleotide sequences of primers and probes in comparative examples of the present invention

[0058] name sequence Modification GALV control primer 1-F TTCCCTGTCCGAGGTAG / GALV control primer 1-R TTCCCTGTCCGAGGTAG / GALV control probe 1-P GCTGTTTTTACATAGACCACTCAGGTG 5'VIC,3'BHQ1 RD114 control primer 2-F TAAAATACGGTCTGGGAGC / RD114 control primer 2-R CGGAGATATGGATGGGGGC / RD114 control probe 2-P CTTGTAGGGGCTCTATAAATCAGC 5'FAM,3'BHQ1

[0059] from Figure 1-2 The results show that, at the same template concentration, the Ct values ​​of control combinations 1 and 2 lag behind those of the present invention by approximately 2 to 4. The present primer and probe combination not only has a lower Ct value, but also has a fluorescence signal value approximately 1.5 to 2 times that of the control combination, demonstrating good reproducibility. Therefore, the present primer and probe combination has higher efficacy and sensitivity.

[0060] By screening and comparing the pre-experiments, the best combination is selected:

[0061] 5'-TGTWTTACTGGGGTTGGGA-3', Seq ID No: 1;

[0062] GALV reverse primer sequence: 5′-TGACTRAGTCTTGGAGGGC-3′, Seq ID No: 2;

[0063] GALV Taqman probe: 5'-TCGCCAYAGATGCTGACCTCCG-3', Seq ID No: 3;

[0064] RD114 forward primer sequence: 5'-TTACTAGMTGGACTGGGAA-3', Seq ID No: 4 RD114 reverse primer sequence: 5'-TTGTATACWGGGTGACGGA-3', Seq ID No: 5;

[0065] RD114 probe sequence: 5'-ACCGCAGYATTCACCACCG-3', Seq ID No: 6; IPC forward primer sequence: 5'-GCGCTTCCCCATGCCAT-3', Seq ID No: 7

[0066] IPC reverse primer sequence: 5′-GATGTCCCTTACAATTTCCCGCTCA-3′, Seq ID No: 8;

[0067] IPC probe sequence: 5′-TCCCGACCAGCGAGATCCAAACGAA-3′, Seq ID No: 9;

[0068] The GALV Taqman probe is labeled with a fluorescent reporter group (VIC) at its 5' end and a quencher group (BHQ1) at its 3' end. The RD114 Taqman probe is labeled with a fluorescent reporter group (FAM) at its 5' end and a quencher group (BHQ1) at its 3' end. The IPC probe is labeled with a fluorescent reporter group (CY5) at its 5' end and a quencher group (BHQ2) at its 3' end.

[0069] The primers were synthesized by Shanghai Jierui Bioengineering Co., Ltd.

[0070] RNA reference products were used to test each primer set, and the RNA reference products were diluted in a gradient manner to 1×10 7 copies / μL(ST0), 1×10 6 copies / μL(ST1), 1×10 5 copies / μL(ST2), 1×10 4 copies / μL(ST3), 1×10 3 copies / μL(ST4), 1×10 2 Seven dilutions were prepared, including 10 copies / μL (ST5), 20 copies / μL (ST6), and 10 copies / μL (ST7). 5 μL of nuclease-free water was also used as a negative control template. The qPCR reaction master mix configuration is shown in Table 2.

[0071] Table 2 qPCR reaction system

[0072] Components Volume (μl) 2×OneStepRT-PCRBufferⅢ 10.0 TaKaRaExTaqHS (5U / μL) 0.4 PrimeScript RT Enzyme Mix II 0.4 Forward primer (10 μM) 0.4 Reverse primer (10 μM) 0.4 Probe (10 μM) 0.2 50×ROX 0.4 Nuclease-free water 2.8 Standards / test samples 5.0 total 20.0

[0073] Use an ABI7500 PCR instrument to set the qPCR reaction program according to Table 3 and collect signals at 60°C.

[0074] Table 3 qPCR reaction procedure

[0075]

[0076] Analyzing the standard curve, obtained from the quantitative PCR results, reveals that the amplification curves for each concentration exhibit a distinct exponential growth phase. The Cq values ​​for each gradient in the standard curve are uniformly spaced, indicating that the primer pair and PCR conditions meet the experimental requirements for quantitative PCR.

[0077] Example 2 Establishment of multiplex qPCR detection method

[0078] Positive RNA standards were used to screen the primers and the RNA standards were diluted in a gradient manner with a total of 8 dilutions, starting at 1×10 7 copies / μL(ST0), 1×10 6 copies / μL(ST1), 1×10 5 copies / μL(ST2), 1×10 4 copies / μL(ST3), 1×10 3 copies / μL(ST4), 1×10 2 Seven standards with different concentrations, ST1-ST7, were used to prepare the calibration curve. 5 μL of nuclease-free water was used as a negative control template. The qPCR reaction premix configuration is shown in Table 4:

[0079] Table 4 qPCR reaction premix

[0080] Components Volume (μl) 2XOneStepRT-PCRBufferIII 10.0 TaKaRaExTaqHS (5U / μL) 0.4 PrimeScript RT Enzyme Mix II 0.4 Each set of forward primers (10 μM) 0.4 Each set of reverse primers (10 μM) 0.4 Each probe (10 μM) 0.2 50×ROX 0.4 Nuclease-free water 0.8 Standards / test samples 5.0

[0081] Use an ABI 7500 PCR instrument and set up the qPCR reaction program according to Table 5, collecting signals at 60°C:

[0082] Table 5 qPCR reaction procedure

[0083]

[0084] The results are as follows Figure 3-6 As shown, the standard curve R obtained by GALV primer probe 2 =0.995, Eff%=103.7%, standard curve R obtained by RD114 primer probe 2 =0.998, Eff% =90.5%, both meet the acceptance criteria (R 2 >0.99, 90%≤Eff%≤110%), so it was considered that the primers and probes met the detection requirements.

[0085] Example 3: Specificity and detection limit determination

[0086] Specificity test

[0087] Using GALV and RD114 standards as positive templates, and treating the test samples HEK293 cells, FBS, and DMEM according to the kit instructions, qPCR detection was performed using a multiplex detection method for replicating retroviruses (RCR) with different viral vectors. Each sample was repeated three times to verify the specificity of this method. The results showed that the detection reagent can accurately detect GALV and RD114 standards without false detection or missed detection; and no false positive results were found in the test samples HEK293 cells, FBS, DMEM, and negative control solution.

[0088] Sensitivity measurement

[0089] The detection limit refers to the lowest number of virus copies that can be detected in a sample. Based on the previous primer probe screening and test results, the detection limit lower limit experiment was conducted for the above viruses, and 10 3 copies, 10 2 The groups of 50 copies, 50 copies and 10 copies / reaction were set, and 6 replicates were set for each group to verify the minimum detection limit of the method. The detection limit results are shown in Table 6.

[0090] Table 6 Analysis of minimum detection limit results

[0091]

[0092] The minimum detection limits (LDLs) are shown in Table 6. The LDL for this assay requires detection in all six replicates. The LDL for GALC is 100 copies / reaction, and the LDL for RD114 is 50 copies / reaction.

[0093] Example 4: Anti-interference test - specificity and anti-interference of the detection method

[0094] "Anti-interference capability" refers to the ability of a test reagent to prevent any interfering substances in the sample from affecting the test results. Currently, samples tested often contain high-protein or cell culture components, so the anti-interference capability of the test reagent for such samples needs to be verified.

[0095] Experimental design: 200 mg / mL BSA, 10% FBS, 1E7 / mL cells of interfering substances were mixed with 100 μL of 100 copies / μL standard and used as the test sample. After adding an equal amount of PBS to the control group for nucleic acid extraction, the test sample was tested using the kit. The test results are shown in Table 7. As can be seen from Table 7, the present invention can still accurately detect under the conditions of different exogenous interfering substances, and the Ct value is not significantly different from the control. Under the conditions of different interfering substances, the present invention can accurately detect the presence of RCR of different viral vectors in the test sample. Therefore, the present invention has strong anti-interference ability against various interfering substances and good specificity for GALV and RD114.

[0096] Table 7 Added interfering substances and test results

[0097]

[0098] Example 5: A kit for detecting replicative retroviruses in cell therapy products

[0099] An RCR virus detection kit, the composition of which is shown in Table 8.

[0100] Table 8 RCR virus detection kit composition

[0101]

[0102] The PCR amplification reaction solution is a fluorescent quantitative PCR reaction premix, including 2×One Step RT-PCR Buffer III, Ex Taq HS, RT Enzyme Mix II, ROX Reference Dye internal reference dye, and nuclease-free water. For specific ratios, refer to Table 4.

[0103] Take 8 new 1.5ml low-adsorption centrifuge tubes, mark them as ST0, ST1, ST2, ST3, ST4, ST5, ST6, ST7, and perform gradient dilution of RNA standards for a total of 8 dilutions, diluting to 1×10 7 copies / μL(ST0), 1×10 6 copies / μL(ST1), 1×10 5 copies / μL(ST2), 1×10 4 copies / μL(ST3), 1×10 3 copies / μL(ST4), 1×10 210 copies / μL (ST5), 20 copies / μL (ST6), and 10 copies / μL (ST7). ST1-ST7 were selected for calibration curve detection. The reaction system consisted of 11 μl of PCR amplification reaction solution, 4 μl of primer-probe mix, and 5 μl of standard or sample. PCR amplification was performed on an ABI 7500 Fast fluorescent quantitative PCR instrument. Reverse transcription was performed at 42°C for 5 minutes, followed by pre-denaturation at 95°C for 3 minutes, 5 cycles of denaturation at 95°C for 5 seconds, annealing at 58°C for 34 seconds, and 40 cycles of denaturation at 95°C for 5 seconds, annealing at 60°C for 34 seconds. Standards were added simultaneously to generate a standard curve.

[0104] After the reaction is complete, the test data file is saved. Analysis parameters are adjusted based on the curve graph generated by the PCR amplification results to optimize the standard curve in the standard curve window (i.e., a correlation coefficient greater than 0.97 and an amplification efficiency between 90% and 110%). Finally, the instrument automatically analyzes the results, confirming that the kit's test results are consistent with those of the individual detection methods and primer-probe combinations.

[0105] Example 6 Precision of the Kit

[0106] The RNA standard was diluted to 10,000 copies / μL as the test sample. The assay was then performed using the methods and kits of Examples 1 and 5, respectively. Each example was tested 10 times in parallel, and the RSD% between the data from the 10 replicates of the two examples was calculated. The results are shown in Table 9.

[0107] Table 9 Precision of the kit

[0108]

[0109] Comparing Examples 1 and 5, it can be seen that the RSD% value of Example 1 is larger, which indicates that the precision of Example 5 is better. This may be because the diluent in the kit in Example 4 contains 1% Tween 20 protective solution. Tween 20 (Tween-20), chemically known as polysorbate 20, is a commonly used non-ionic surfactant. When diluting the sample, especially when the sample contains lipids or other insoluble components, Tween 20 can help these components be evenly dispersed in the solution to prevent precipitation or stratification. Tween 20 can increase the solubility of insoluble substances in water. In the process of diluting the sample, if the sample contains compounds that are not easily soluble in water, Tween 20 can help these compounds dissolve better in the diluent through its solubilizing effect, thereby improving the uniformity and stability of the sample. Again, Tween 20 can act as a stabilizer to prevent proteins and other biomolecules from aggregation or denaturation during the dilution process. 1% Tween 20 plays a major role in emulsification, solubilization, and stabilization in diluted samples, helping to improve sample uniformity, stability, and the accuracy of experimental results, thereby ensuring the precision of the test kit.

[0110] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on its differences from the other embodiments. Reference can be made to the descriptions of the identical or similar parts between the various embodiments. For the devices disclosed in the embodiments, since they correspond to the methods disclosed in the embodiments, the descriptions are relatively simple, and the relevant parts can be referred to the descriptions of the methods.

[0111] The above is a detailed introduction to the multiple detection primer composition, detection method and kit for replicating retroviruses of different viral vectors provided by the present invention. Specific examples are used herein to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core concept. It should be pointed out that for those of ordinary skill in the art, without departing from the principles of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. A multiplex detection primer composition for replicating retroviruses of different viral vectors, characterized in that: The viral vectors include two retroviral vectors, GALV (Gibbon Ape Leukemia Virus) and RD114 (Feline Leukemia Virus), and the multiplex detection primer composition includes the following primer probes: GALV forward primer sequence: 5′-TGTWTTACTGGGGTTGGGA-3′, Seq ID No: 1; GALV reverse primer sequence: 5′-TGACTRAGTCTTGGAGGGC-3′, Seq ID No: 2; GALV Taqman probe: 5'-TCGCCAYAGATGCTGACCTCCG-3', Seq ID No: 3; RD114 forward primer sequence: 5'-TTACTAGMTGGACTGGGAA-3', Seq ID No: 4 RD114 reverse primer sequence: 5′-TTGTATACWGGGTGACGGA-3′, Seq ID No: 5; RD114 probe sequence: 5'-ACCGCAGYATTCACCACCG-3', Seq ID No: 6; IPC forward primer sequence: 5'-GCGCTTCCCCATGCCAT-3', Seq ID No: 7 IPC reverse primer sequence: 5′-GATGTCCCTTACAATTTCCCGCTCA-3′, Seq ID No: 8; IPC probe sequence: 5′-TCCCGACCAGCGAGATCCAAACGAA-3′, Seq ID No: 9; The 5' end of the GALV Taqman probe is labeled with a fluorescent reporter group, which is VIC, and the 3' end is labeled with a quencher group, which is BHQ1; The 5' end of the RD114 Taqman probe is labeled with a fluorescent reporter group, which is FAM, and the 3' end is labeled with a quencher group, which is BHQ1; The 5' end of the IPC probe is labeled with a fluorescent reporter group, which is CY5, and the 3' end is labeled with a quencher group, which is BHQ2.

2. A multiplex qPCR detection kit for replicating retroviruses of different viral vectors, characterized in that The kit contains the multiple detection primer combination according to claim 1.

3. The multiplex qPCR detection kit according to claim 2, characterized in that The kit also includes a PCR amplification reaction solution, a primer-probe mixture, an RNA standard and a nucleic acid diluent.

4. The multiplex qPCR detection kit according to claim 2, characterized in that The kit contains: In the primer-probe mixture, the forward primer concentration was 0.2-0.5 μmol / L, the reverse primer concentration was 0.2-0.5 μmol / L, and the oligonucleotide probe concentration was 0.1-0.3 μmol / L.

5. The multiplex qPCR detection kit according to claim 3, characterized in that: The PCR amplification reaction solution is a fluorescent quantitative PCR reaction premix, including 2×One Step RT-PCR Buffer III, Ex Taq HS, RT Enzyme Mix II, ROX Reference Dye internal reference dye, and nuclease-free water, and the reaction system is 20uL. The template used can be a standard and a sample nucleic acid to be tested.

6. The multiplex qPCR detection kit according to claim 3, characterized in that: The RNA standards contain positive RNA fragments with a concentration of 1×10 8 copies / μL.

7. The multiplex qPCR detection kit according to claim 2, characterized in that: The fluorescent quantitative PCR reaction system in the detection kit is 20 μL, including 11 μL of the PCR amplification reaction solution, 4 μL of the primer probe mixture and 5 μL of the template; the template is the RNA of the sample to be tested, the positive control standard and the negative control standard.

8. A method for detecting the RCR of replicative retroviruses of different viral vectors in non-diagnostic or therapeutic cell therapy products, characterized in that The method comprises the following steps: S1. Sample RNA extraction; S2. Using the multiple detection primer combination according to claim 1 to establish a multiple real-time fluorescence quantitative qPCR reaction system, and perform PCR amplification; S3. Analysis of test sample results: Calculate the virus content in the test sample based on the obtained standard curve.

9. The detection method according to claim 8, characterized in that: The fluorescent quantitative PCR reaction system is 20 μL, including 11 μL of the PCR amplification reaction solution, 4 μL of the primer-probe mixture and 5 μL of the template; the template is the RNA of the sample to be tested, a positive control standard and a negative control standard; the PCR amplification reaction solution includes 2×One Step RT-PCR Buffer III, Ex Taq HS, RT Enzyme Mix II, ROX Reference Dye internal reference dye, and nuclease-free water.

10. The detection method according to claim 8, characterized in that: The reaction conditions of fluorescence quantitative qPCR detection were as follows: reverse transcription at 42°C for 5 min, pre-denaturation at 95°C for 3 min; denaturation at 95°C for 5 s, annealing at 58°C for 34 s, 5 cycles; denaturation at 95°C for 5 s, annealing at 60°C for 34 s, 40 cycles.

Images