Enzymes with RUVC domains

Abstract

The present disclosure provides endonucleases having distinct domain features, and methods of using such enzymes or variants thereof.

Description

[0001] Related Applications

[0002] This application is related to PCT Application No. PCT / US21 / 31136, which is incorporated herein by reference in its entirety.

[0003] Cross-references

[0004] This application claims the benefit of U.S. Provisional Application No. 63 / 237,791 filed on August 27, 2021, U.S. Provisional Application No. 63 / 245,629 filed on September 17, 2021, U.S. Provisional Application No. 63 / 252,956 filed on October 6, 2021, U.S. Provisional Application No. 63 / 282,909 filed on November 24, 2021, and U.S. Provisional Application No. 63 / 296,909 filed on March 4, 2022. The invention claims the benefit of U.S. Provisional Application No. 63 / 316,895 filed on March 14, 2022, U.S. Provisional Application No. 63 / 319,681 filed on March 14, 2022, U.S. Provisional Application No. 63 / 322,944 filed on March 23, 2022, and U.S. Provisional Application No. 63 / 369,858 filed on July 29, 2022, each of which is incorporated herein by reference in its entirety. Background Art

[0005] Cas enzymes and their associated clustered regularly interspaced short palindromic repeats (CRISPR) guide RNAs appear to be universal components of the prokaryotic immune system (~45% of bacteria, ~84% of archaea), used to protect such microorganisms from non-self nucleic acids, such as infectious viruses and plasmids, through CRISPR-RNA-guided nucleic acid cleavage. While the deoxyribonucleic acid (DNA) elements encoding CRISPR RNA elements may be relatively conserved in structure and length, their CRISPR-associated (Cas) proteins are highly diverse, containing a variety of nucleic acid interaction domains. Although CRISPR DNA elements were observed as early as 1987, the programmable endonuclease cleavage capabilities of the CRISPR / Cas complex were not recognized until recently, leading to the use of recombinant CRISPR / Cas systems in various DNA manipulation and gene editing applications.

[0006] Sequence Listing

[0007] This application contains a sequence listing that has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy created on August 26, 2022 is named 55921-731_601_SL.xml and is 23,191,225 bytes in size. Summary of the invention

[0008] In some aspects, the present disclosure provides a method of disrupting a beta-2-microglobulin (B2M) locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the B2M locus, wherein the region of the B2M locus comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6387-6468. In some embodiments, the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6305-6386. In some embodiments, the region of the B2M locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6388, 6399, 6401, 6403, 6410, 6413, 6421, 6446, and 6448.

[0009] In some aspects, the present disclosure provides a method of editing a T cell receptor alpha constant (TRAC) locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus, wherein the region of the TRAC locus comprises a targeting sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6509-6548 or 6805. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6469-6508 or 6804. In some embodiments, the region of the TRAC locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6517, 6520, and 6523.

[0010] In some aspects, the present disclosure provides a method of disrupting a hypoxanthine phosphoribosyltransferase 1 (HPRT) locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the HPRT locus, wherein the region of the HPRT locus comprises a targeting sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6616-6682. In some embodiments, the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6549-6615. In some embodiments, the region of the HPRT locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6619, 6634, 6673, 6675, and 6679.

[0011] In some aspects, the present disclosure provides a method for editing a T cell receptor beta constant 1 or T cell receptor beta constant 2 (TRBC1 / 2) locus in a cell, the method comprising contacting the following with the cell: (a) an RNA-guided nuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the nuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRBC1 / 2 locus, wherein the region of the TRBC1 / 2 locus comprises a targeting sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6722-6760 or 6782-6802. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6683-6721 and 6761-6781. In some embodiments, the region of the TRBC1 / 2 locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6734, 6753, 6790 and 6800.

[0012] In some aspects, the present disclosure provides a method of editing a hydroxyacid oxidase 1 (HAO1) ​​locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the HAO1 locus, wherein the region of the HAO1 locus comprises a targeting sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 11802-11820. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the region of the HAO1 locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 11806, 11813, 11816, and 11819.

[0013] In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA comprises (i) 2′-O-methyl nucleotides; (ii) 2′-fluoro nucleotides; or (iii) phosphorothioate bonds, wherein the RNA-guided endonuclease has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 421-431 or a variant thereof. In some embodiments, the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 421.

[0014] In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) an endonuclease having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 421-431 or variants thereof; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid sequence, wherein the system has reduced immunogenicity when administered to a human subject compared to an equivalent system comprising a Cas9 enzyme. In some embodiments, the Cas9 enzyme is a SpCas9 enzyme. In some embodiments, the immunogenicity is antibody immunogenicity. In some embodiments, the engineered guide RNA comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 5466-5467 and 11160-11162. In some embodiments, the engineered nuclease has at least about 75% sequence identity, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NO: 421 or 423, or a variant thereof.

[0015] In some aspects, the present disclosure provides a method of editing a locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease or a nucleic acid encoding the RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the RNA-guided endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize with a region of the locus; wherein the cell is a peripheral blood mononuclear cell (PBMC), a hematopoietic stem cell (HSC), or an induced pluripotent stem cell (iPSC). In some embodiments, the RNA-guided endonuclease is a Class 2 type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease has at least about 75% sequence identity, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 421 or a variant thereof. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6804, 6806, and 6808. In some embodiments, the nucleic acid encoding the RNA-guided endonuclease comprises a sequence comprising at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 6803 or a variant thereof.In some embodiments, the region of the locus comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 nucleotides of any one of SEQ ID NOs: 6805, 6807, and 6809.

[0016] In some aspects, the present disclosure provides a method for editing a CD2 molecule (CD2) locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the CD2 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6853-6894 or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having ... The non-degenerate nucleotides of any of NOs: 6811-6852 have a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 421431.In some embodiments, the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 421 or a variant thereof. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any of SEQ ID NOs: 6813, 6841, 6843-6847, 6852, or 6852 non-degenerate nucleotides. In some embodiments, the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 6A. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6855, 6883, 6885-6889, 6892, or 6984, or is configured to hybridize to said sequence.

[0017] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6811-6852. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 6A.

[0018] In some aspects, the present disclosure provides a method for editing a CD5 molecule (CD5) locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the CD5 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6959-7022 or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having ... The non-degenerate nucleotides of any of NOs: 5466 or 6895-6958 have a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises an endonuclease comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 421-431 or a variant thereof.In some embodiments, the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any of SEQ ID NOs: 6897, 6904, 6906, 6911, 6928, 6930, 6932, 6934, 6938, 6945, 6950, 6952, and 6958. In some embodiments, the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 7A. In some embodiments, the engineered guide RNA is configured to hybridize to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6961, 6968, 6970, 6975, 6992, 6994, 6996, 6998, 7002, 7009, 7014, 7016, and 7022.

[0019] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6895-6958. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 7A.

[0020] In some aspects, the present disclosure provides a method for editing an RNA locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244, or a variant thereof; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the RNA locus, wherein the RNA locus does not comprise bacterial or microbial RNA. In some embodiments, the guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466 or SEQ ID NO: 5539.

[0021] In some aspects, the present disclosure provides a method for destroying a Fas cell surface death receptor (FAS) locus in a cell, the method comprising introducing into the cell: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the human FAS locus, wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7057-7090 or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7057-7090 or is configured to hybridize to the complementary sequence; NO: 7023-7056 has a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease includes a RuvCIII domain, the RuvCIII domain including a sequence with at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to SEQ ID NO: 2242 or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NO: 7059, 7061, 7069, 7070, 7076, 7080, 7083, 7084, 7085, or 7088 or is configured to hybridize to said sequence.In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or a variant thereof. In some embodiments, the guide RNA comprises a sequence at least 80% identical to any one of SEQ ID NO: 7025, 7027, 7035, 7036, 7042, 7046, 7049-7051, or 7054. In some embodiments, the guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 8.

[0022] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7023-7056. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 8.

[0023] In some aspects, the present disclosure provides a method for disrupting a programmed cell death 1 (PD-1) locus in a cell, the method comprising introducing into the cell: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the human PD-1 locus, wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7129-7166, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having ... NO: 7091-7128 has a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence with at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to SEQ ID NO: 2242 or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NO: 7135, 7137, 7146, 7149, 7152, 7156, 7160, 7161, 7164, 7165, or 7166 or is configured to hybridize to said sequence.In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or a variant thereof. In some embodiments, the guide RNA comprises a sequence at least 80% identical to any one of SEQ ID NO: 7097, 7099, 7108, 7111, 7114, 7118, 7122, 7123, 7126, 7127, or 7128. In some embodiments, the guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 9.

[0024] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7091-7128. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 9.

[0025] In some aspects, the disclosure provides a method for disrupting a human Rosa26 (hRosa26) locus in a cell, the method comprising introducing into the cell: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the hRosa26 locus, wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7199-7230, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having a sequence having a sequence having a sequence having a sequence having a sequence identity to any one of SEQ ID NOs: 7199-7230, or is configured to hybridize to the complementary sequence; NO: 7167-7198 has a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence with at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to SEQ ID NO: 2242 or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 7205-7206, 7215, 7220, 7223, or 7225 or is configured to hybridize to said sequence.In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or a variant thereof. In some embodiments, the guide RNA comprises a sequence at least 80% identical to any one of SEQ ID NO: 7173, 7174, 7183, 7188, 7191, or 7193. In some embodiments, the guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 10.

[0026] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7167-7198. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 10.

[0027] In some aspects, the present disclosure provides a method for disrupting a T cell receptor alpha constant (TRAC) locus in a cell, the method comprising introducing into the cell: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus, wherein the engineered guide RNA comprises a spacer sequence having and being identical to SEQ ID NO: 7235-7238, 7248-7256, 7270, or 7278-7284 having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a sequence of at least 18-22 consecutive nucleotides, or configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having a sequence identical to SEQ ID NO: 7235-7238, 7248-7256, 7270, or 7278-7284 having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the sequence. NO: 7231-7234, 7239-7247, 7269 or 7271-7277 has a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity. In some embodiments, the RNA-guided nuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided nuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 1512, 1756, 11711-11713 or a variant thereof. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to non-degenerate nucleotides of SEQ ID NO: 5473, 5475, 11145, 11714, or 11715. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NO: 7235-7238, 7248-7256, 7270, or 7278-7284, or is configured to hybridize to said sequence. In some embodiments, the guide RNA comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 7231-7234, 7239-7244, 7269, or 7271-7277.In some embodiments, the engineered guide RNA further comprises a nucleotide modification pattern described in any of the guide RNAs described in Table 11.

[0028] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7231-7234, 7239-7247, 7269, or 7271-7277. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 11.

[0029] In some aspects, the present disclosure provides a method of disrupting an adeno-associated virus integration site 1 (AAVS1) locus in a cell, the method comprising introducing into the cell: (a) a class II type Cas endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the AAVS1 locus, wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7261-7264 or 7267-7268, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having a sequence having a sequence having a sequence having a sequence having a sequence identity to any one of SEQ ID NOs: 7261-7264 or 7267-7268, or is configured to hybridize to the complementary sequence; NO: 7257-7260 or 7265-7266 has a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 1756 or 11711 or a variant thereof. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5475 or 11715. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NO: 7261-7263 or 7267-7268 or is configured to hybridize to the sequence. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NO: 7257-7260 or 7265-7266. In some embodiments, the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 12.

[0030] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7257-7260 or 7265-7266. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 12.

[0031] In some aspects, the present disclosure provides a method of disrupting a hydroxyacid oxidase 1 (HAO-1) locus in a cell, the method comprising introducing into the cell: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the HAO-1 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11773-11793 or is configured to hybridize to the complementary sequence. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NO: 11773, 11780, 11786, or 11787 or is configured to hybridize to the sequence. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or a variant thereof.

[0032] In some aspects, the present disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11773-11793; and a scaffold sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:5466.

[0033] In some aspects, the present disclosure provides a method for disrupting a human G protein coupled receptor 146 (GPR146) locus in a cell, the method comprising introducing into the cell: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the GPR146 locus, wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11406-11437, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11406-11437, or is configured to hybridize to the complementary sequence; ID NO: 11374-11405 has a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease includes a RuvCIII domain, the RuvCIII domain including a sequence with at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to SEQ ID NO: 2242 or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of SEQ ID NO: 11425 or is configured to hybridize to the sequence. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or a variant thereof.In some embodiments, the guide RNA comprises a sequence having at least 80% identity to SEQ ID NO: 11393. In some embodiments, the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 15.

[0034] In some aspects, the disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11374-11405. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 15.

[0035] In some aspects, the present disclosure provides a method for disrupting a mouse G protein coupled receptor 146 (GPR146) locus in a cell, the method comprising introducing into the cell: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the GPR146 locus, wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11473-11507, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11473-11507, or is configured to hybridize to the complementary sequence; ID NO: 11438-11472 has a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease includes a RuvCIII domain, the RuvCIII domain including a sequence with at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to SEQ ID NO: 2242 or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NO: 11482, 11488, or 11490 or is configured to hybridize to said sequence.In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or a variant thereof. In some embodiments, the guide RNA comprises a sequence at least 80% identical to SEQ ID NO: 11447, 11453, or 11455. In some embodiments, the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 16.

[0036] In some aspects, the disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11438-11472. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 16.

[0037] In some aspects, the present disclosure provides a method for disrupting a T cell receptor alpha constant (TRAC) locus in a cell, the method comprising introducing into the cell: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus, wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11516-11517, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11516-11517, or is configured to hybridize to the complementary sequence; NO: 11514-11515 has a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the engineered guide RNA comprises a sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 11153. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NO: 11516 or is configured to hybridize to said sequence. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 11716 or a variant thereof. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to SEQ ID NO: 11514. In some embodiments, the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 17.

[0038] In some aspects, the disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11514-11515. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 17.

[0039] In some aspects, the disclosure provides a method of disrupting an adeno-associated virus integration site 1 (AAVS1) locus in a cell, the method comprising introducing into the cell: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the AAVS1 locus, wherein the engineered guide RNA comprises a sequence having at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11511-11513, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a sequence having ... NO: 11508-11510 has a nucleotide sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity. In some embodiments, the RNA-guided endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the engineered guide RNA comprises a sequence with at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 11717. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of SEQ ID NO: 11511 or is configured to hybridize to said sequence. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 914 or a variant thereof. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to SEQ ID NO: 11508. In some embodiments, the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 17.

[0040] In some aspects, the disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11508-11510. In some embodiments, the RNA molecule further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 17.

[0041] In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) an endonuclease having at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the PI domain of any of the Cas effector protein sequences described herein, or a variant thereof; and (b) an engineered nuclease system comprising: The invention relates to a method for preparing an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid sequence, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to non-degenerate nucleotides of any of the sgRNA sequences described herein. In some embodiments, the endonuclease further comprises a RuvCIII domain or HNH domain having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a RuvCIII domain or HNH domain of any of the Cas effector nucleases described herein. In some embodiments, the endonuclease is configured to be selective for any of the PAM sequences described herein. In some embodiments, the endonuclease further comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any of the Cas effector sequences described herein.

[0042] In some aspects, the disclosure provides a use of any of the methods described herein for disrupting a B2M locus in a cell.

[0043] In some aspects, the disclosure provides a use of any of the methods described herein or any of the RNA molecules described herein for disrupting a TRAC locus in a cell.

[0044] In some aspects, the disclosure provides a use of any of the methods described herein for disrupting a HPRT locus in a cell.

[0045] In some aspects, the disclosure provides a use of any of the methods described herein for disrupting the TRBC1 / 2 locus in a cell.

[0046] In some aspects, the disclosure provides a use of any of the methods described herein or any of the RNA molecules described herein for disrupting the HAO-1 locus in a cell.

[0047] In some aspects, the disclosure provides a use of any of the methods described herein or any of the RNA molecules described herein for disrupting the CD2 locus in a cell.

[0048] In some aspects, the disclosure provides a use of any of the methods described herein or any of the RNA molecules described herein for disrupting the CD5 locus in a cell.

[0049] In some aspects, the disclosure provides a use of any of the methods described herein or any of the RNA molecules described herein for disrupting a FAS locus in a cell.

[0050] In some aspects, the disclosure provides a use of any of the methods described herein or any of the RNA molecules described herein for disrupting the PD-1 locus in a cell.

[0051] In some aspects, the disclosure provides a use of any of the methods described herein or any of the RNA molecules described herein for disrupting the hRosa26 locus in a cell.

[0052] In some aspects, the disclosure provides a use of any of the methods described herein or any of the RNA molecules described herein for disrupting the AAVS1 locus in a cell.

[0053] In some aspects, the disclosure provides a use of any of the methods described herein or any of the RNA molecules described herein for disrupting the GPR146 locus in a cell.

[0054] In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) a nuclease comprising a RuvC_III domain and a HNH domain, wherein the nuclease is derived from an uncultured microorganism, wherein the nuclease is a Class 2 type II Cas endonuclease; and (b) an engineered guide RNA structure, wherein the engineered guide RNA structure is configured to form a complex with the nuclease, wherein the engineered guide RNA structure comprises: (i) a guide RNA sequence, wherein the guide RNA sequence is configured to hybridize with a target deoxyribonucleic acid sequence; and (ii) a tracr RNA sequence, wherein the tracr RNA sequence is configured to bind to the nuclease. In some embodiments, the RuvC_III domain comprises a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, or at least 98% sequence identity to any one of SEQ ID NOs: 1827-3637.

[0055] In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) a nuclease comprising a RuvC_III domain having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95% or at least 98% sequence identity to any one of SEQ ID NOs: 1827-3637; and (b) an engineered guide RNA structure configured to form a complex with the nuclease, the engineered guide RNA structure comprising: (i) a guide RNA sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr RNA sequence configured to bind to the nuclease.

[0056] In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising SEQ ID NOs: 5512-5537, wherein the endonuclease is a Class 2 type II Cas endonuclease; and (b) an engineered guide RNA structure configured to form a complex with the endonuclease, the engineered guide RNA structure comprising: (i) a guide RNA sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr RNA sequence configured to bind to the endonuclease.

[0057] In some embodiments, the endonuclease is derived from an uncultured microorganism. In some embodiments, the endonuclease has not been engineered to bind to different PAM sequences. In some embodiments, the endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease. In some embodiments, the endonuclease has less than 80% identity to the Cas9 endonuclease. In some embodiments, the endonuclease further includes an HNH domain. In some embodiments, the tracr ribonucleic acid sequence includes a sequence having at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 5476-5511 and SEQ ID NO: 5538.

[0058] In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) an engineered guide RNA structure comprising: (i) a guide RNA sequence configured to hybridize to a target DNA sequence; and (ii) a tracr RNA sequence configured to bind to an endonuclease, wherein the tracr RNA sequence comprises a sequence having at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 5476-5511 and SEQ ID NO: 5538; and (b) 2 class II type Cas endonucleases configured to bind to the engineered guide RNA. In some embodiments, the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 5512-5537.

[0059] In some embodiments, the engineered guide RNA structure comprises at least two RNA polynucleotides. In some embodiments, the engineered guide RNA structure comprises one RNA polynucleotide, the RNA polynucleotide comprising the guide RNA sequence and the tracr RNA sequence.

[0060] In some embodiments, the guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian or human genomic sequence. In some embodiments, the guide ribonucleic acid sequence is 15-24 nucleotides in length. In some embodiments, the endonuclease comprises one or more nuclear localization sequences (NLS) near the N-terminus or C-terminus of the endonuclease. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOs: 5597-5612.

[0061] In some embodiments, the engineered nuclease system further comprises a single-stranded or double-stranded DNA repair template, which comprises from 5' to 3': a first homology arm, the first homology arm comprising a sequence of at least 20 nucleotides located 5' of the target deoxyribonucleic acid sequence; a synthetic DNA sequence of at least 10 nucleotides; and a second homology arm, the second homology arm comprising a sequence of at least 20 nucleotides located 3' of the target sequence. In some embodiments, the first homology arm or the second homology arm comprises a sequence of at least 40, 80, 120, 150, 200, 300, 500 or 1,000 nucleotides.

[0062] In some embodiments, the system further comprises a source of Mg2+.

[0063] In some embodiments, the endonuclease and the tracr ribonucleic acid sequence are derived from different bacterial species within the same phylum. In some embodiments, the endonuclease is derived from a bacterium belonging to the genus Dermabacter. In some embodiments, the endonuclease is derived from a bacterium belonging to the Phylum Verrucomicrobia, the Phylum Candidatus Peregrinibacteria, or the Phylum Candidatus Melainabacteria. In some embodiments, the endonuclease is derived from a bacterium comprising a 16S rRNA gene having at least 90% identity to any one of SEQ ID NOs: 5592-5595.

[0064] In some embodiments, the HNH domain comprises a sequence having at least 70% or at least 80% identity to any one of SEQ ID NOs: 5638-5460. In some embodiments, the endonuclease comprises SEQ ID NOs: 1-1826 or a variant thereof having at least 55% identity thereto. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 1827-1830 or SEQ ID NOs: 1827-2140.

[0065] In some embodiments, the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 3638-3641 or SEQ ID NOs: 3638-3954. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4, or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5615-5632. In some embodiments, the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-4 or SEQ ID NOs: 1-319.

[0066] In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5461-5464, SEQ ID NOs: 5476-5479, or SEQ ID NOs: 5476-5489. In some embodiments, the guide RNA structure comprises an RNA sequence predicted to comprise a hairpin consisting of a stem and a loop, wherein the stem comprises at least 10, at least 12, or at least 14 base-paired ribonucleotides and an asymmetric bulge within 4 base pairs of the loop.

[0067] In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NOs: 5512-5515 or SEQ ID NOs: 5527-5530.

[0068] In some embodiments: (a) the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 1827; (b) the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 5461 or SEQ ID NO: 5476; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5512 or SEQ ID NO: 5527. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 1828; (b) the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 5462 or SEQ ID NO: 5477; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5513 or SEQ ID NO: 5528. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 1829; (b) the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 5463 or SEQ ID NO: 5478; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5514 or SEQ ID NO: 5529. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 1830; (b) the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 5464 or SEQ ID NO: 5479; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5515 or SEQ ID NO: 5530.

[0069] In some embodiments, the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2141-2142 or SEQ ID NOs: 2141-2241. In some embodiments, the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 3955-3956 or SEQ ID NOs: 3955-4055. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4, or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5632-5638. In some embodiments, the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 320-321 or SEQ ID NOs: 320420. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5465, SEQ ID NO: 5490-5491, or SEQ ID NO: 5490-5494. In some embodiments, the guide RNA structure comprises a tracr RNA sequence comprising a hairpin comprising at least 8, at least 10, or at least 12 base-paired ribonucleotides. In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NO: 5516 and SEQ ID NO: 5531. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 2141; (b) the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5490; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5531. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 2142; (b) the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5465 or SEQ ID NO: 5491; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5516.

[0070] In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2245-2246. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4059-4060. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4 or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5639-5648. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 424425. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5498-5499 and SEQ ID NO: 5539. In some embodiments, the guide RNA structure comprises a guide RNA sequence that is predicted to comprise a hairpin having an uninterrupted base pairing region, the hairpin comprising at least 8 nucleotides of the guide RNA sequence and at least 8 nucleotides of the tracr RNA sequence, and wherein the tracr RNA sequence comprises, from 5′ to 3′, a first hairpin and a second hairpin, wherein the first hairpin has a longer stem than the second hairpin.

[0071] In some embodiments, the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2242-2244 or SEQ ID NOs: 2247-2249. In some embodiments, the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4056-4058 and SEQ ID NOs: 4061-4063. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4, or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5639-5648. In some embodiments, the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 421-423 or SEQ ID NOs: 426-428. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5466-5467, SEQ ID NOs: 5495-5497, SEQ ID NOs: 5500-5502, and SEQ ID NO: 5539. In some embodiments, the guide RNA structure comprises a guide RNA sequence that is predicted to comprise a hairpin having an uninterrupted base pairing region, the hairpin comprising at least 8 nucleotides of the guide RNA sequence and at least 8 nucleotides of the tracr RNA sequence, and wherein the tract RNA sequence comprises a first hairpin and a second hairpin from 5′ to 3′, wherein the first hairpin has a longer stem than the second hairpin. In some embodiments, the endonuclease is configured to bind to a PAM that comprises a sequence selected from the group consisting of SEQ ID NOs: 5517-5518 or SEQ ID NOs: 5532-5534. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 2247; (b) the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5500; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5517 or SEQ ID NO: 5532. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 2248; (b) the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5501; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5518 or SEQ ID NO: 5533.In some embodiments: (a) the nuclease comprises a sequence that is at least 70%, 80% or 90% identical to SEQ ID NO: 2249; (b) the guide RNA structure comprises a sequence that is at least 70%, 80% or 90% identical to SEQ ID NO: 5502; and (c) the nuclease is configured to bind to a PAM comprising SEQ ID NO: 5534.

[0072] In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 2253 or SEQ ID NOs: 2253-2481. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4067 or SEQ ID NOs: 40674295. In some embodiments, the peptide endonuclease comprises a peptide motif according to SEQ ID NO: 5649. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 432 or SEQ ID NOs: 432-660. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5468 or SEQ ID NO: 5503. In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NO: 5519. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 2253; (b) the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5468 or SEQ ID NO: 5503; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5519.

[0073] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2482-2489. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4296-4303. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 661-668. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2490-2498. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4304-4312. In some embodiments, the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 669-677. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5504.

[0074] In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 2499 or SEQ ID NOs: 2499-2750. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4313 or SEQ ID NOs: 4313-4564. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4, or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5650-5667. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 678 or SEQ ID NOs: 678-929. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5469 or SEQ ID NO: 5505. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5520 or SEQ ID NO: 5535. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 2499; (b) the guide RNA structure comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 5469 or SEQ ID NO: 5505; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5520 or SEQ ID NO: 5535.

[0075] In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 2751 or SEQ ID NOs: 2751-2913. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4565 or SEQ ID NOs: 4565-4727. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4, or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5668-5678. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 930 or SEQ ID NOs: 930-1092. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5470 or SEQ ID NO: 5506. In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NO: 5521 or SEQ ID NO: 5536. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 2751; (b) the guide RNA structure comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 5470 or SEQ ID NO: 5506; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5521 or SEQ ID NO: 5536.

[0076] In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 2914 or SEQ ID NO: 2914-3174. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4728 or SEQ ID NO: 47284988. In some embodiments, the endonuclease comprises at least 1, at least 2 or at least 3 peptide motifs selected from the group consisting of SEQ ID NO: 5676-5678. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1093 or SEQ ID NO: 1093.1353. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5471, SEQ ID NO: 5507, and SEQ ID NOs: 5540-5542. In some embodiments, the guide RNA structure comprises a tracr ribonucleic acid sequence predicted to comprise at least two hairpins comprising less than 5 base-paired ribonucleotides. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5522. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 2914; (b) the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5471 or SEQ ID NO: 5507; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5522.

[0077] In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 3175 or SEQ ID NOs: 3175-3330. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4989 or SEQ ID NOs: 4989-5146. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4 or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5679-5686. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1354 or SEQ ID NOs: 1354-1511. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5472 or SEQ ID NO: 5508. In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NO: 5523 or SEQ ID NO: 5537. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 3175; (b) the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5472 or SEQ ID NO: 5508; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5523 or SEQ ID NO: 5537.

[0078] In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 3331 or SEQ ID NOs: 3331-3474. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5147 or SEQ ID NOs: 5147-5290. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4, or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5674-5675 and SEQ ID NOs: 5687-5693. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1512 or SEQ ID NOs: 1512-1655. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5473 or SEQ ID NO: 5509. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5524. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 3331; (b) the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5473 or SEQ ID NO: 5509; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5524.

[0079] In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 3475 or SEQ ID NOs: 3475-3568. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5291 or SEQ ID NOs: 5291-5389. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4 or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5694-5699. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1656 or SEQ ID NOs: 1656-1755. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5474 or SEQ ID NO: 5510. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5525. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 3475; (b) the guide RNA structure comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 5474 or SEQ ID NO: 5510; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5525.

[0080] In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 3569 or SEQ ID NOs: 3569-3637. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5390 or SEQ ID NOs: 5390-5460. In some embodiments, the endonuclease comprises at least 1, at least 2, at least 3, at least 4 or at least 5 peptide motifs selected from the group consisting of SEQ ID NOs: 5700-5717. In some embodiments, the endonuclease comprises a sequence at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1756 or SEQ ID NOs: 1756-1826. In some embodiments, the guide RNA structure comprises a sequence at least 70%, 80% or 90% identical to SEQ ID NO: 5475 or SEQ ID NO: 5511. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5526. In some embodiments: (a) the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 3569; (b) the guide RNA structure comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 5475 or SEQ ID NO: 5511; and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5526. In some embodiments, sequence identity is determined by BLASTP, CLUSTALW, MUSCLE, MAFFT, or CLUSTALW with Smith-Waterman homology search algorithm parameters. In some embodiments, the sequence identity is determined using the BLASTP homology search algorithm using parameters with a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix with gap penalties set to 11 for existence, 1 for extension, and using a conditional composition scoring matrix adjustment.

[0081] In some aspects, the present disclosure provides an engineered guide ribonucleic acid polynucleotide, comprising: (a) a DNA targeting segment, the DNA targeting segment comprising a nucleotide sequence complementary to a target sequence in a target DNA molecule; and (b) a protein binding segment, the protein binding segment comprising two complementary nucleotide stretches that hybridize to form a double-stranded RNA (dsRNA) duplex, wherein the two complementary nucleotide stretches are covalently linked to each other with an intermediate nucleotide, and wherein the engineered guide ribonucleic acid polynucleotide is configured to form a complex with an endonuclease and target the complex to the target sequence of the target DNA molecule, the endonuclease comprising a RuvC_III domain having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95% or at least 98% sequence identity to any one of SEQ ID NOs: 1827-3637. In some embodiments, the DNA targeting segment is located at 5′ of two complementary nucleotide stretches in the two complementary nucleotide stretches.

[0082] In some embodiments: (a) the protein binding segment comprises a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, or at least 98% identity to a sequence selected from the group consisting of SEQ ID NOs: 5476-5479 or SEQ ID NOs: 5476-5489; (b) the protein binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence selected from the group consisting of (SEQ ID NOs: 5490-5491 or SEQ ID NOs: 5490-5494) and SEQ ID NO: 5538; (c) the protein binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 5498-5499; (d) the protein binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 5495-5497 and SEQ ID NOs: (e) the protein binding segment comprises a sequence that is at least 70%, at least 80% or at least 90% identical to SEQ ID NO: 5503; (f) the protein binding segment comprises a sequence that is at least 70%, at least 80% or at least 90% identical to SEQ ID NO: 5504; (g) the protein binding segment comprises a sequence that is at least 70%, at least 80% or at least 90% identical to SEQ ID NO: 5505; (h) the protein binding segment comprises a sequence that is at least 70%, at least 80% or at least 90% identical to SEQ ID NO: 5506; (i) the protein binding segment comprises a sequence that is at least 70%, at least 80% or at least 90% identical to SEQ ID NO: 5507; (j) the protein binding segment comprises a sequence that is at least 70%, at least 80% or at least 90% identical to SEQ ID NO: 5508; NO:5508 having at least 70%, at least 80% or at least 90% identity; (k) the protein binding segment includes a sequence having at least 70%, at least 80% or at least 90% identity to SEQ ID NO:5509; (1) the protein binding segment includes a sequence having at least 70%, at least 80% or at least 90% identity to SEQ ID NO:5510; or (m) the protein binding segment includes a sequence having at least 70%, at least 80% or at least 90% identity to SEQ ID NO:5511.

[0083] In some embodiments: (a) the guide RNA polynucleotide comprises an RNA sequence comprising a hairpin comprising a stem and a loop, wherein the stem comprises at least 10, at least 12, or at least 14 base-paired ribonucleotides, and an asymmetric bulge within 4 base pairs of the loop; (b) the guide RNA polynucleotide comprises a tracr RNA sequence, and the tract RNA sequence is predicted to comprise a hairpin comprising at least 8, at least 10, or at least 12 base-paired ribonucleotides; (c) the guide RNA polynucleotide comprises a guide RNA sequence The guide RNA sequence is predicted to include a hairpin with an uninterrupted base-paired region, the hairpin includes at least 8 nucleotides of the guide RNA sequence and at least 8 nucleotides of the tracr RNA sequence, and wherein the tracr RNA sequence includes, from 5′ to 3′, a first hairpin and a second hairpin, wherein the first hairpin has a longer stem than the second hairpin; or (d) the guide RNA polynucleotide includes a tracr RNA sequence, the tracr RNA sequence is predicted to include at least two hairpins, and the hairpins include less than 5 base-paired ribonucleotides.

[0084] In some aspects, the present disclosure provides a deoxyribonucleic acid polynucleotide encoding any of the engineered guide ribonucleic acid polynucleotides described herein.

[0085] In some aspects, the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes a Class 2, Type II Cas endonuclease comprising a RuvC_III domain and a HNH domain, and wherein the endonuclease is derived from an uncultured microorganism.

[0086] In some aspects, the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes an endonuclease comprising a RuvC_III domain having at least 70% sequence identity to any one of SEQ ID NOs: 1827-3637. In some embodiments, the endonuclease comprises an HNH domain having at least 70% or at least 80% sequence identity to any one of SEQ ID NOs: 3638-5460. In some embodiments, the endonuclease comprises SEQ ID NOs: 5572-5591 or a variant thereof having at least 70% sequence identity thereto. In some embodiments, the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLS) near the N-terminus or C-terminus of the endonuclease. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOs: 5597-5612.

[0087] In some embodiments, the organism is a prokaryote, a bacterium, a eukaryote, a fungus, a plant, a mammal, a rodent, or a human. In some embodiments, the organism is Escherichia coli (E. coli) and: (a) the nucleic acid sequence is at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5572-5575; (b) the nucleic acid sequence is at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5576-5577; (c) the nucleic acid sequence is at least 70%, 80% or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5578-5580; (d) the nucleic acid sequence is at least 70%, 80% or 90% identical to SEQ ID NO: 5581; (e) the nucleic acid sequence is at least 70%, 80% or 90% identical to SEQ ID NO: 5582; (f) the nucleic acid sequence is at least 70%, 80% or 90% identical to SEQ ID NO: 5583; (g) the nucleic acid sequence is at least 70%, 80% or 90% identical to SEQ ID NO: NO: 5584 is at least 70%, 80% or 90% identical; (h) the nucleic acid sequence is at least 70%, 80% or 90% identical to SEQ ID NO: 5585; (i) the nucleic acid sequence is at least 70%, 80% or 90% identical to SEQ ID NO: 5586; or (j) the nucleic acid sequence is at least 70%, 80% or 90% identical to SEQ ID NO: 5587. In some embodiments, the organism is a human and: (a) the nucleic acid sequence is at least 70%, 80% or 90% identical to SEQ ID NO: 5588 or SEQ ID NO: 5589; or (b) the nucleic acid sequence is at least 70%, 80% or 90% identical to SEQ ID NO: 5590 or SEQ ID NO: 5591.

[0088] In some aspects, the present disclosure provides a vector comprising a nucleic acid sequence encoding a Class 2, Type II Cas endonuclease comprising a RuvC_III domain and a HNH domain, wherein the endonuclease is derived from an uncultured microorganism.

[0089] In some aspects, the disclosure provides a vector comprising any of the nucleic acids described herein. In some embodiments, the vector further comprises a nucleic acid encoding an engineered guide RNA structure configured to form a complex with the endonuclease, the engineered guide RNA structure comprising: (a) a guide RNA sequence configured to hybridize with a target deoxyribonucleic acid sequence; and (b) a tracr RNA sequence configured to bind to the endonuclease. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV)-derived virion, a lentivirus, or a lentivirus.

[0090] In some aspects, the disclosure provides a cell comprising any of the vectors described herein.

[0091] In some aspects, the disclosure provides a method of producing an endonuclease, the method comprising culturing any of the cells described herein.

[0092] In some aspects, the present disclosure provides a method for binding, cleaving, labeling or modifying a double-stranded DNA polynucleotide, the method comprising: (a) contacting the double-stranded DNA polynucleotide with a Class II type Cas endonuclease complexed with an engineered guide RNA structure, the engineered guide RNA structure being configured to bind to the endonuclease and the double-stranded DNA polynucleotide; (b) wherein the double-stranded DNA polynucleotide comprises a protospacer adjacent motif (PAM); and (c) wherein the PAM comprises a sequence selected from the group consisting of SEQ ID NO: 5512-5526 or SEQ ID NO: 5527-5537. In some embodiments, the double-stranded DNA polynucleotide comprises a first strand and a second strand, the first strand comprising a sequence complementary to a sequence of the engineered guide RNA structure, and the second strand comprising the PAM. In some embodiments, the PAM is directly adjacent to the 3′ end of the sequence complementary to the sequence of the engineered guide RNA structure.

[0093] In some embodiments, the 2 types of II type Cas endonucleases are not Cas9 endonucleases, Cas14 endonucleases, Cas12a endonucleases, Cas12b endonucleases, Cas 12c endonucleases, Cas12d endonucleases, Cas12e endonucleases, Cas13a endonucleases, Cas13b endonucleases, Cas13c endonucleases or Cas 13d endonucleases. In some embodiments, the 2 types of II type Cas endonucleases are derived from uncultured microorganisms. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotides are eukaryotic, plant, fungi, mammals, rodents or human double-stranded deoxyribonucleic acid polynucleotides.

[0094] In some embodiments: (a) the PAM comprises a sequence selected from the group consisting of SEQ ID NOs: 5512-5515 and SEQ ID NOs: 5527-5530; (b) the PAM comprises SEQ ID NO: 5516 or SEQ ID NO: 5531; (c) the PAM comprises SEQ ID NO: 5539; (d) the PAM comprises SEQ ID NO: 5517 or SEQ ID NO: 5518; (e) the PAM comprises SEQ ID NO: 5519; (f) the PAM comprises SEQ ID NO: 5520 or SEQ ID NO: 5535; (g) the PAM comprises SEQ ID NO: 5521 or SEQ ID NO: 5536; (h) the PAM comprises SEQ ID NO: 5522; (i) the PAM comprises SEQ ID NO: 5523 or SEQ ID NO: 5537; (j) the PAM comprises SEQ ID NO: 5524; (k) the PAM comprises SEQ ID NO: 5525; or (1) the PAM comprises SEQ ID NO: 5526 or SEQ ID NO: 5527; NO:5526.

[0095] In some aspects, the present disclosure provides a method for modifying a target nucleic acid locus, the method comprising delivering any engineered nuclease system in the engineered nuclease system described herein to the target nucleic acid locus, wherein the endonuclease is configured to form a complex with an engineered guide RNA structure, and wherein the complex is configured so that when the complex is combined with the target nucleic acid locus, the complex modifies the target nuclear locus. In some embodiments, modifying the target nucleic acid locus includes binding, cutting, cutting or marking the target nucleic acid locus. In some embodiments, the target nucleic acid locus includes deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In some embodiments, the target nucleic acid locus includes genomic DNA, viral DNA, viral RNA or bacterial DNA. In some embodiments, the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is in a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell or a human cell.

[0096] In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering any nucleic acid in the nucleic acids described herein or any vector in the vectors described herein. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease. In some embodiments, the nucleic acid comprises a promoter operably connected to the open reading frame encoding the endonuclease. In some embodiments, the engineered nuclease system to the target nucleic acid locus comprises delivering a capped mRNA containing the open reading frame encoding the endonuclease. In some embodiments, the engineered nuclease system to the target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, the engineered nuclease system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered guide RNA structure operably connected to a ribonucleic acid (RNA) pol III promoter. In some embodiments, the endonuclease induces a single-strand break or a double-strand break at or near the target locus.

[0097] In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) a nuclease comprising a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 5718-5846 or 6257; and (b) an engineered guide RNA structure configured to form a complex with the nuclease, the engineered guide RNA structure comprising: (i) a RNA sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a RNA sequence, the tracr RNA sequence configured to bind to the nuclease. In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising SEQ ID NO: 5847-5861 or 6258-6278, wherein the endonuclease is a Class 2 type II Cas endonuclease; and (b) an engineered guide RNA structure configured to form a complex with the endonuclease, the engineered guide RNA structure comprising: (i) a RNA sequence configured to hybridize with a target deoxyribonucleic acid sequence; and (ii) a RNA sequence, the tracr RNA sequence configured to bind to the endonuclease. In some embodiments, the endonuclease is derived from an uncultured microorganism. In some embodiments, the endonuclease has not been engineered to bind to a different PAM sequence. In some embodiments, the endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease. In some embodiments, the endonuclease has less than 80% identity to the Cas9 endonuclease. In some embodiments, the ribonucleic acid sequence includes a sequence having at least 80% sequence identity to a non-degenerate nucleotide of any one of (a) SEQ ID NOs: 5886-5887, 5891, 5893, or 5894; or (b) SEQ ID NOs: 5862-5885, 5888-5890, 5892, 5895-5896, or 6279-6301.In some aspects, the present disclosure provides an engineered nuclease system comprising: (a) an engineered guide RNA structure, the engineered guide RNA structure comprising: (i) a RNA sequence, the RNA sequence being configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a RNA sequence, the RNA sequence being configured to bind to a nuclease, wherein the RNA sequence comprises a sequence having at least 80% sequence identity with a non-degenerate nucleotide of any one of (a) SEQ ID NOs: 5886-5887, 5891, 5893, or 5894; or (b) SEQ ID NOs: 5862-5885, 5888-5890, 5892, 5895-5896, or 6279-6301; and 2 Class II Type Cas endonucleases, the 2 Class II Type Cas endonucleases being configured to bind to the engineered guide RNA. In some embodiments, the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 5847-5861 or 6258-6278. In some embodiments, the guide RNA sequence is 15-24 nucleotides in length or 19-24 nucleotides in length. In some embodiments, the endonuclease comprises one or more nuclear localization sequences (NLS) proximal to the N or C terminus of the endonuclease. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOs: 5597-5612. In some embodiments, the system further comprises a single-stranded or double-stranded DNA repair template, the single-stranded or double-stranded DNA repair template comprising, from 5′ to 3′: a first homology arm comprising a sequence of at least 20 nucleotides located 5′ of the target deoxyribonucleic acid sequence; a synthetic DNA sequence of at least 10 nucleotides; and a second homology arm comprising a sequence of at least 20 nucleotides located 3′ of the target sequence. In certain embodiments, the first homology arm or the second homology arm include at least 40,80,120,150,200,300,500 or 1,000 nucleotide sequences.In certain embodiments, the sequence identity is determined by BLASTP, CLUSTALW, MUSCLE, MAFFT or CLUSTALW with Smith-Waterman homology search algorithm parameters.In certain embodiments, the sequence identity is determined by the BLASTP homology search algorithm using a word length (W) of 3, an expected value (E) of 10 parameters and a BLOSUM62 scoring matrix that gap penalty is set to exist as 11, expanded to 1 and determined using a conditional composition scoring matrix adjustment.

[0098] In some aspects, the disclosure provides an engineered guide ribonucleic acid polynucleotide comprising: (a) a DNA targeting segment comprising a nucleotide sequence complementary to a target sequence in a target DNA molecule; and (b) a protein binding segment comprising two complementary nucleotide stretches that hybridize to form a double-stranded RNA (dsRNA) duplex, wherein the two complementary nucleotide stretches are covalently linked to each other with an intermediate nucleotide, and wherein the engineered guide ribonucleic acid polynucleotide is configured to form a complex with the endonuclease, and target the complex to the target sequence of the target DNA molecule, the endonuclease comprising a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 5718-5846 or 6257. In some embodiments, the DNA targeting segment is located 5′ of two of the two complementary nucleotide stretches.

[0099] In some aspects, the present disclosure provides a deoxyribonucleic acid polynucleotide encoding any of the engineered guide ribonucleic acid polynucleotides described herein.

[0100] In some aspects, the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes an endonuclease comprising a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 5718-5846 or 6257. In some embodiments, the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the endonuclease. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOs: 5597-5612. In some embodiments, the organism is a prokaryote, a bacterium, a eukaryote, a fungus, a plant, a mammal, a rodent, or a human.

[0101] In some aspects, the disclosure provides a vector comprising any of the nucleic acids described herein. In some embodiments, the vector further comprises a nucleic acid encoding an engineered guide RNA structure configured to form a complex with the endonuclease, the engineered guide RNA structure comprising: (a) a RNA sequence configured to hybridize with a target deoxyribonucleic acid sequence; and (b) a RNA sequence, the tracr RNA sequence configured to bind to the endonuclease. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV)-derived virion, a lentivirus, or a lentivirus.

[0102] In some aspects, the disclosure provides a cell comprising any of the vectors described herein.

[0103] In some aspects, the disclosure provides a method of producing an endonuclease, the method comprising culturing any of the cells described herein.

[0104] In some aspects, the present disclosure provides a method for binding, cleaving, labeling or modifying a double-stranded DNA polynucleotide, the method comprising: (a) contacting the double-stranded DNA polynucleotide with a Class II type Cas endonuclease complexed with an engineered guide RNA structure, the engineered guide RNA structure being configured to bind to the endonuclease and the double-stranded DNA polynucleotide; wherein the double-stranded DNA polynucleotide comprises a protospacer adjacent motif (PAM); and wherein the PAM comprises a sequence selected from the group consisting of SEQ ID NO: 5847-5861 or 6258-6278. In some embodiments, the double-stranded DNA polynucleotide comprises a first strand and a second strand, the first strand comprising a sequence complementary to a sequence of the engineered guide RNA structure, and the second strand comprising the PAM. In some embodiments, the PAM is directly adjacent to the 3′ end of the sequence complementary to the sequence of the engineered guide RNA structure. In some embodiments, the 2 class II type Cas endonucleases are not Cas9 endonucleases, Cas14 endonucleases, Cas12a endonucleases, Cas12b endonucleases, Cas 12c endonucleases, Cas12d endonucleases, Cas12e endonucleases, Cas13a endonucleases, Cas13b endonucleases, Cas13c endonucleases, or Cas 13d endonucleases. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotides are eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotides.

[0105] In some aspects, the present disclosure provides a method for modifying a target nucleic acid locus, the method comprising delivering any engineered nuclease system in the engineered nuclease system described herein to the target nucleic acid locus, wherein the endonuclease is configured to form a complex with the engineered guide RNA structure, and wherein the complex is configured so that when the complex is bound to the target nucleic acid locus, the complex modifies the target nuclear locus. In some embodiments, the target nucleic acid locus includes binding, cutting, cutting or marking the target nucleic acid locus. In some embodiments, the target nucleic acid locus includes deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In some embodiments, the target nucleic acid locus includes genomic DNA, viral DNA, viral RNA or bacterial DNA. In some embodiments, the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is in a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell or a human cell. In some embodiments, the engineered nuclease system to the target nucleic acid locus includes delivering any nucleic acid in the nucleic acid described herein or any vector in the vector described herein. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease. In some embodiments, the nucleic acid comprises a promoter to which the open reading frame encoding the endonuclease is operably connected. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a capped mRNA containing the open reading frame encoding the endonuclease. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered guide RNA structure operably connected to a ribonucleic acid (RNA) pol III promoter. In some embodiments, the endonuclease induces a single-strand break or a double-strand break at or near the target locus.

[0106] In some aspects, the present disclosure provides a method of editing a TRAC locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus, wherein the engineered guide RNA comprises a spacer sequence that is SEQ ID NO: At least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 consecutive nucleotides of any one of NO: 5950-5958 or 5959-5965 have a targeting sequence with at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity. In some embodiments, the RNA-guided endonuclease is a Class II, Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75% identical, at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 100% identical to SEQ ID NO: 421 or SEQ ID NO: 423.In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 5950-5958, and the endonuclease comprises a sequence that is at least 75% identical to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 5959-5965, and the endonuclease comprises a sequence that is at least 75% identical to SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 5953-5957. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 5960-5961 or 5963-5964.

[0107] In some aspects, the present disclosure provides a method of editing a TRBC locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRBC locus, wherein the engineered guide RNA comprises a spacer sequence that is SEQ ID NO: At least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 consecutive nucleotides of any one of NO: 5966-6004 or 6005-6025 have a targeting sequence of at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity. In some embodiments, the RNA-guided endonuclease is a Class II, Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75% identical, at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 100% identical to SEQ ID NO: 421 or SEQ ID NO: 423.In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 5966-6004, and the endonuclease comprises a sequence that is at least 75% identical to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6005-6025, and the endonuclease comprises a sequence that is at least 75% identical to SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 5970, 5971, 5983, or 5984. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6006, 6010, 6011, or 6012.

[0108] In some aspects, the present disclosure provides a method of editing a GR (NR3C1) locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the GR (NR3C1) locus, wherein the engineered guide RNA comprises a spacer sequence that hybridizes to SEQ IDNO: 6026-6090 or any one of 6091-6121, at least 19, at least 20, at least 21, at least 22, at least 23 or at least 24 consecutive nucleotides have at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity or at least 100% identity of the targeting sequence. In some embodiments, the RNA-guided endonuclease is a Class II Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 421 or SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6026-6090, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6091-6121, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 423.In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6027-6028, 6029, 6038, 6043, 6049, 6076, 6080, 6081, or 6086. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6092, 6115, or 6119.

[0109] In some aspects, the present disclosure provides a method of editing an AAVS1 locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the AAVS1 locus, wherein the engineered guide RNA comprises a spacer sequence that is SEQ ID NO: At least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 consecutive nucleotides of any one of NOs: 6122-6152 have a targeting sequence of at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity. In some embodiments, the RNA-guided endonuclease is a Class II, Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75% identical, at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 100% identical to SEQ ID NO: 421 or SEQ ID NO: 423.In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6122, 6125-6126, 6128, 6131, 6133, 6136, 6141, 6143, or 6148.

[0110] In some aspects, the present disclosure provides a method for editing a TIGIT locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TIGIT locus, wherein the engineered guide RNA comprises a spacer sequence that is SEQ ID NO: At least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 consecutive nucleotides of any one of NOs: 6153-6181 have a targeting sequence of at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity. In some embodiments, the RNA-guided endonuclease is a Class II, Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75% identical, at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 100% identical to SEQ ID NO: 421 or SEQ ID NO: 423. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 66155, 6159, 616, or 6172.

[0111] In some aspects, the present disclosure provides a method of editing a CD38 locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the CD38 locus, wherein the engineered guide RNA comprises a spacer sequence that is SEQ ID NO: At least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 consecutive nucleotides of any one of NO: 6182-6248 or 6249-6256 have a targeting sequence of at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity. In some embodiments, the RNA-guided endonuclease is a Class II, Type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75% identical, at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 100% identical to SEQ ID NO: 421 or SEQ ID NO: 423.In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6182-6248, and the endonuclease comprises a sequence that is at least 75% identical to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6249-6256, and the endonuclease comprises a sequence that is at least 75% identical to SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6182-6183, 6189, 6191, 6208, 6210, 6211, or 6215. In some embodiments, the engineered guide RNA comprises a targeting sequence that is at least 85% identical to at least 18 consecutive nucleotides of SEQ ID NO: 6251.

[0112] In some embodiments of any of the methods for editing a specific locus in a cell described above, the cell is a peripheral blood mononuclear cell, a T cell, a NK cell, a hematopoietic stem cell (HSCT), or a B cell, or any combination thereof.

[0113] In some aspects, the present disclosure provides an engineered guide RNA polynucleotide comprising: (a) a DNA targeting segment comprising a nucleotide sequence complementary to a target sequence in a target DNA molecule; and (b) a protein binding segment comprising two complementary nucleotide stretches that hybridize to form a double-stranded RNA (dsRNA) duplex, wherein the two complementary nucleotide stretches and an intermediate nucleotide are covalently linked to each other, and wherein the engineered guide RNA polynucleotide is configured to form a complex with a Class II type Cas endonuclease and target the complex to the target sequence of the target DNA molecule, wherein the DNA targeting segment comprises a nucleotide sequence complementary to SEQ ID In some embodiments, the protein binding segment comprises a sequence having at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to any one of SEQ ID NOs: 5950-5965, 5966-6025, 6026-6121, 6122-6152, 6153-6181, or 6182-6256. In some embodiments, the protein binding segment comprises a sequence having at least 85% identity to any one of SEQ ID NOs: 5466 or 6304.

[0114] In some aspects, the present disclosure provides a system for generating edited immune cells, the system comprising: (a) RNA-guided endonucleases; (b) an engineered guide RNA polynucleotide according to claim 97, which is configured to bind to the RNA-guided endonucleases; and (c) a single-stranded or double-stranded DNA repair template comprising a first homology arm and a second homology arm flanking a sequence encoding a chimeric antigen receptor (CAR). In some embodiments, the cell is a peripheral blood mononuclear cell, a T cell, a NK cell, a hematopoietic stem cell (HSCT), or a B cell, or any combination thereof. In some aspects, the RNA-guided endonuclease is a class II type II Cas endonuclease. In some aspects, the RNA-guided endonuclease includes a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some aspects, the RNA-guided endonuclease further includes a HNH domain. In some aspects, the RNA-guided endonuclease comprises a sequence that is at least 75% identical, at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 100% identical to SEQ ID NO:421 or SEQ ID NO:423.

[0115] For those skilled in the art, further aspects and advantages of the present disclosure will become apparent through the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be appreciated, the present disclosure is capable of other different embodiments, and its several details can be modified in various obvious aspects, all without departing from the present disclosure. Therefore, the drawings and description are to be regarded as illustrative rather than restrictive in nature.

[0116] In some aspects, the present disclosure provides a method for editing a B2M locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the B2M locus, wherein the region of the B2M locus comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6387-6468. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the Class 2 Type II Cas endonucleases include endonucleases having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a sequence at least 80% identical to any one of SEQ ID NOs: 6305-6386. In some embodiments, the region of the B2M locus comprises a sequence at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6388, 6399, 6401, 6403, 6410, 6413, 6421, 6446, and 6448. In some embodiments, the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6306, 6317, 6319, 6321, 6328, 6331, 6339, 6364, and 6366.

[0117] In some aspects, the present disclosure provides a method of editing a TRAC locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus, wherein the region of the TRAC locus comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6509-6548. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the Class 2 Type II Cas endonucleases comprise endonucleases having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a sequence at least 80% identical to any one of SEQ ID NOs: 6469-6508. In some embodiments, the region of the TRAC locus comprises a sequence at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6517, 6520, and 6523. In some embodiments, the engineered guide RNA comprises a sequence 80% or at least 90% identical to any one of SEQ ID NOs: 6477, 6480, and 6483.

[0118] In some aspects, the present disclosure provides a method for editing a HPRT locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the HPRT locus, wherein the region of the HPRT locus comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6616-6682. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the Class 2 Type II Cas endonucleases comprise endonucleases having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a sequence at least 80% identical to any one of SEQ ID NOs: 6549-6615. In some embodiments, the region of the HPRT locus comprises a sequence at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6619, 6634, 6673, 6675, and 6679. In some embodiments, the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6552, 6567, 6606, 6608, and 6612.

[0119] In some aspects, the present disclosure provides a method of editing a TRBC1 / 2 locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRBC1 / 2 locus, wherein the region of the TRBC1 / 2 locus comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6722-6760 or 6782-6802. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a Class 2 Type II Cas endonuclease. In some embodiments, the Class 2 Type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a sequence at least 80% identical to any one of SEQ ID NOs: 6683-6721 and 6761-6781. In some embodiments, the region of the TRBC1 / 2 locus comprises a sequence at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6734, 6753, 6790, and 6800. In some embodiments, the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6695, 6714, 6769, and 6779.

[0120] In some aspects, the present disclosure provides a method for editing the HAO1 locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize with a region of the HAO1 locus, wherein the region of the HAO1 locus comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 11802-11820. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a Class II type Cas endonuclease. In some embodiments, the Class II type Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242. In some embodiments, the RNA-guided endonuclease further comprises a HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421. In some embodiments, the region of the HAO1 locus comprises a sequence at least 75%, 80% or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 11806, 11813, 11816 and 11819. In some embodiments, the cell is a peripheral blood mononuclear cell (PBMC). In some embodiments, the cell is a T cell or a precursor thereof or a hematopoietic stem cell (HSC).

[0121] Incorporated by Reference

[0122] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0123] The novel features of the present invention are particularly set forth in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description setting forth illustrative embodiments in which the principles of the present invention are utilized, and in the accompanying drawings (also referred to herein as "Figures (Figure / FIG.)"):

[0124] Figure 1Depicted are the results of B2M gene editing at the DNA level.

[0125] Figure 2A and Figure 2B Depicted are the results of gene editing by TRAC in mice at the DNA level.

[0126] Figure 3 Depicted are the results of gene editing by HPRT at the DNA level.

[0127] Figure 4 Depicted are flow cytometry results for gene editing of human TRBC1 / 2.

[0128] Figure 5 Depicted are the results of guide screening in Hepa1-6 cells; guides were delivered as mRNA and gRNA using the liposomal messenger Max.

[0129] Figure 6 Depicted is the analysis of gene editing results of mRNA electroporation in T cells by NGS.

[0130] Figure 7 Depicted are ELISA results from a screen performed at a serum dilution of 1:50 to detect antibodies to MG-3-6 and MG3-8 (n=50). Tetanus toxoid was used as a positive control due to widespread vaccination against this antigen. Serum samples above the dashed line were considered antibody positive; the line represents the mean absorbance of the negative control (human albumin) plus two standard deviations from the mean. *P<0.05, **P<0.01, ****P<0.0001, as determined by unpaired Student's t-test; ns, not significant.

[0131] Figure 8 Depicted are the results of gene editing by TRAC in human peripheral blood B cells at the DNA and cell surface protein levels.

[0132] Fig. 9 Depicted are the results of gene editing by TRAC at the DNA level in hematopoietic stem cells.

[0133] Fig.10 Depicted are gene editing results of TRAC at the DNA and cell surface protein levels in induced pluripotent stem cells (iPSCs) of MG3-6 delivered as ribonucleoprotein.

[0134] Fig.11 Depicted are the results of gene editing by TRAC at the DNA level in induced pluripotent stem cells (iPSCs) of MG3-6 delivered as mRNA.

[0135] Fig.12 Depicted are the results of gene editing of CD2 at the DNA level in primary T cells.

[0136] Fig.13 Depicted are the results of gene editing of CD5 at the DNA level in primary T cells.

[0137] Fig.14 Targeted RNA cleavage by MG3-6 and MG3-8 is depicted.

[0138] Fig.15 Depicted are the results of gene editing of FAS at the DNA level in T cells.

[0139] Fig.16 Depicted are the results of gene editing of PD-1 at the DNA level in T cells.

[0140] Fig.17 Depicted are the results of gene editing of hRosa26 at the DNA level in T cells.

[0141] Fig.18 Describes the results of gene editing of TRAC and AAVS1 at the DNA level in K562 cells.

[0142] Fig.19 Depicted is the activity of the chemically modified MG3-6 human HAO-1 guide in Hep3B cells when delivered using the liposomal messenger Max as both mRNA and gRNA.

[0143] Fig. 20 Depicted are the results of gene editing of human GPR146 at the DNA level in Hep3B cells.

[0144] Fig.21 Depicted are the results of gene editing of mouse GPR146 at the DNA level in Hepa1-6 cells.

[0145] Fig. 22 Depicted are the results of gene editing of mouse GPR146 at the DNA level in primary mouse hepatocytes.

[0146] Fig.23 Describes the results of gene editing of TRAC and AAVS1 at the DNA level in K562 cells.

[0147] Fig.24 Phylogenetic analysis of nucleases from the MG3 and MG150 families is depicted. PAM SeqLogo representations of some active candidates are shown. Reference SaCas9 and SpyCas9 sequences are included.

[0148] Fig.25Phylogenetic analysis of nucleases from the MG15 family is depicted. Active candidates are highlighted with circles. Reference SaCas9, SpyCas9, and AcCas9 sequences are included as outgroups.

[0149] Fig.26 The PAMSeqLogo of MG123-1, MG124-2, MG 125-1 and MG125-2 are depicted.

[0150] Fig. 27 The PAMSeqLogo of MG125-3, MG125-4, MG125-5, and MG150-5 are depicted.

[0151] Fig.28 The PAMSeqLogo of MG150-6, MG150-7, MG150-8 and MG150-9 are depicted.

[0152] Fig.29 The PAM SeqLogo of MG3-18, MG3-89, MG3-90 and MG3-91 are depicted.

[0153] Fig.30 The PAM SeqLogo of MG3-92, MG3-93, MG3-95 and MG3-96 are depicted.

[0154] Fig.31 The PAMSeqLogos of MG3-103, MG15-130, MG15-146, and MG15-164 are depicted.

[0155] Fig.32 The PAMSeqLogo of MG15-166, MG15-171, MG15-172 and MG15-174 are depicted.

[0156] Fig.33 The PAMSeqLogo of MG15-184, MG15-187, MG15-191 and MG15-193 are depicted.

[0157] Fig.34 The PAMSeqLogo of MG15-195, MG15-217, MG15-218 and MG15-219 are depicted.

[0158] Fig.35 The PAM SeqLogo of MG15-177 is depicted.

[0159] Brief Description of Sequence Listing

[0160] The sequence listing submitted herewith provides exemplary polynucleotide and polypeptide sequences for use in the methods, compositions and systems according to the present disclosure.Below is an exemplary description of the sequences therein.

[0161] MG1

[0162] SEQ ID NOs: 1-319 and 7285-7293 show the full-length peptide sequence of MG1 nuclease.

[0163] SEQ ID NOs: 1827-2140 show the peptide sequences of the RuvC_III domain of the above-mentioned MG1 nuclease.

[0164] SEQ ID NOs: 3638-3955 show peptides of the HNH domain of the above-mentioned MG1 nuclease.

[0165] SEQ ID NOs: 5476-5479 show the nucleotide sequences of MG1 tracrRNA derived from the same locus as the above-mentioned MG1 nuclease (eg, the same loci as SEQ ID NOs: 1-4, respectively).

[0166] SEQ ID NOs: 5461-5464 and 11130 show the nucleotide sequences of sgRNAs engineered to function with MG1 nuclease (eg, SEQ ID NOs: 1-4, respectively), where Ns represents the nucleotides of the targeting sequence.

[0167] SEQ ID NOs: 5572-5575 show the nucleotide sequences of E. coli codon-optimized coding sequences for MG1 family enzymes (SEQ ID NOs: 1-4).

[0168] SEQ ID NOs: 5588-5589 show the nucleotide sequences of human codon-optimized coding sequences for MG1 family enzymes (SEQ ID NOs: 1 and 3).

[0169] SEQ ID NOs: 5616-5632 show peptide motifs characteristic of MG1 family enzymes.

[0170] SEQ ID NOs: 9192-9255 show the peptide sequences of the PAM interaction domain of MG1 nuclease.

[0171] SEQ ID NOs: 11229-11269 show the nucleotide sequences of the target sites of MG1 nuclease.

[0172] MG2

[0173] SEQ ID NOs: 320420 and 7294-7358 show the full-length peptide sequence of MG2 nuclease.

[0174] SEQ ID NOs: 2141-2241 show the peptide sequences of the RuvC_III domain of the above-mentioned MG2 nuclease.

[0175] SEQ ID NOs: 3955-4055 show peptides of the HNH domain of the above-mentioned MG2 nuclease.

[0176] SEQ ID NOs: 5490-5494 and 11159 show the nucleotide sequences of MG2 tracrRNA derived from the same loci as the above-mentioned MG2 nucleases (eg, the same loci as SEQ ID NOs: 320, 321, 323, 325, and 326, respectively).

[0177] SEQ ID NO:5465 shows a nucleotide sequence engineered to function with the MG2 nuclease (eg, SEQ ID NO:321 described above).

[0178] SEQ ID NOs: 5572-5575 show the nucleotide sequences of E. coli codon-optimized coding sequences for MG2 family enzymes.

[0179] SEQ ID NOs: 5631-5638 show peptide sequences characteristic of MG2 family enzymes.

[0180] SEQ ID NOs: 9256-9322 show the peptide sequences of the PAM interaction domain of MG2 nuclease.

[0181] SEQ ID NOs: 11270-11275 show the nucleotide sequences of the target sites of MG2 nuclease.

[0182] MG3

[0183] SEQ ID NO: 421431 shows the full-length peptide sequence of MG3 nuclease.

[0184] SEQ ID NO: 6803 shows the nucleotide sequence of MG3-6 nuclease containing 5'UTR, NLS, CDS, NLS, 3'UTR and polyA tail.

[0185] SEQ ID NOs: 2242-2252 show the peptide sequence of the RuvC_III domain of the above-mentioned MG3 nuclease.

[0186] SEQ ID NOs: 4056-4066 show peptides of the HNH domain of the above-mentioned MG3 nuclease.

[0187] SEQ ID NOs: 5495-5502 and 11160-11162 show the nucleotide sequences of MG3 tracrRNA derived from the same loci as the above-mentioned MG3 nucleases (eg, the same loci as SEQ ID NOs: 421-428, respectively).

[0188] SEQ ID NOs: 5466-5467, 11131, and 11567-11576 show nucleotide sequences of sgRNAs engineered to function with MG3 nuclease (eg, SEQ ID NOs: 421-423).

[0189] SEQ ID NOs: 5578-5580 show the nucleotide sequences of E. coli codon-optimized coding sequences for MG3 family enzymes.

[0190] SEQ ID NOs: 5639-5648 show peptide sequences characteristic of MG3 family enzymes.

[0191] SEQ ID NOs: 9323-9329 show the peptide sequences of the PAM interaction domain of MG3 nuclease.

[0192] SEQ ID NOs: 11108 and 11530-11538 show the nucleotide sequence of the single guide PAM of MG3 nuclease.

[0193] SEQ ID NOs: 11276-11294 show the nucleotide sequences of the target sites of MG1 nuclease.

[0194] SEQ ID NO: 11373 shows the nucleotide sequence of the DNA sequence encoding MG3-6 mRNA.

[0195] MG3a

[0196] SEQ ID NOs: 7369-7375 show the full-length peptide sequence of MG3a nuclease.

[0197] SEQ ID NO: 11099 shows the peptide sequence of the PAM interaction domain of MG3a nuclease.

[0198] MG3b

[0199] SEQ ID NOs: 7376-7390 show the full-length peptide sequence of MG3b nuclease.

[0200] SEQ ID NOs: 11100-11107 show the peptide sequences of the PAM interaction domain of MG3b nuclease.

[0201] MG4

[0202] SEQ ID NOs: 432-660 and 7391-7535 show the full-length peptide sequence of MG4 nuclease.

[0203] SEQ ID NOs: 2253-2481 show the peptide sequences of the RuvC_III domain of the above-mentioned MG4 nuclease.

[0204] SEQ ID NOs: 4067-4295 show peptides of the HNH domain of the above-mentioned MG4 nuclease.

[0205] SEQ ID NO: 5503 shows the nucleotide sequence of the MG4 tracrRNA derived from the same locus as the MG4 nuclease described above.

[0206] SEQ ID NO: 5468 shows the nucleotide sequence of an sgRNA engineered to function with the MG4 nuclease.

[0207] SEQ ID NO: 5649 shows a peptide sequence characteristic of the MG4 family enzyme.

[0208] SEQ ID NOs: 9330-9485 show the peptide sequences of the PAM interaction domain of MG4 nuclease.

[0209] SEQ ID NOs: 11295-11303 show the nucleotide sequences of the target sites of MG4 nuclease.

[0210] MG5

[0211] SEQ ID NOs: 7536-7583 show the full-length peptide sequence of MG5 nuclease.

[0212] SEQ ID NOs:9486-9526 show the peptide sequences of the PAM interaction domain of MG5 nuclease.

[0213] MG6

[0214] SEQ ID NOs: 661-668 and 7584-7587 show the full-length peptide sequence of MG6 nuclease.

[0215] SEQ ID NOs: 2482-2489 show the peptide sequence of the RuvC_III domain of the above-mentioned MG6 nuclease.

[0216] SEQ ID NOs: 4296-4303 show peptides of the HNH domain of the above-mentioned MG3 nuclease.

[0217] SEQ ID NOs:9527-9531 show the peptide sequences of the PAM interaction domain of MG6 nuclease.

[0218] MG7

[0219] SEQ ID NOs: 669-677 show the full-length peptide sequence of MG7 nuclease.

[0220] SEQ ID NOs: 2490-2498 show the peptide sequences of the RuvC_III domain of the above-mentioned MG7 nuclease.

[0221] SEQ ID NOs: 4304-4312 show peptides of the HNH domain of the above-mentioned MG3 nuclease.

[0222] SEQ ID NO: 5504 shows the nucleotide sequence of the MG7 tracrRNA derived from the same locus as the MG7 nuclease described above.

[0223] SEQ ID NOs: 9532-9535 show the peptide sequences of the PAM interaction domain of MG7 nuclease.

[0224] MG14

[0225] SEQ ID NOs: 678-929 and 7588-7597 show the full-length peptide sequence of MG14 nuclease.

[0226] SEQ ID NOs: 2499-2750 show the peptide sequences of the RuvC_III domain of the above-mentioned MG14 nuclease.

[0227] SEQ ID NOs: 4313-4564 show peptides of the HNH domain of the above-mentioned MG14 nuclease.

[0228] SEQ ID NOs: 5505 and 11163-11167 show the nucleotide sequence of the MG14 tracrRNA derived from the same locus as the MG14 nuclease described above.

[0229] SEQ ID NO: 5581 shows the nucleotide sequence of the E. coli codon-optimized coding sequence of the MG14 family enzyme.

[0230] SEQ ID NOs: 5650-5667 show peptide sequences characteristic of MG14 family enzymes.

[0231] SEQ ID NOs: 9536-9611 show the peptide sequences of the PAM interaction domain of MG14 nuclease.

[0232] SEQ ID NOs: 11109-11113 show the nucleotide sequences of the single guide PAMs of the MG14 nuclease.

[0233] SEQ ID NOs: 11132-11136 show the nucleotide sequences of sgRNAs engineered to function with the MG14 nuclease.

[0234] SEQ ID NOs: 11304-11312 show the nucleotide sequences of the target sites of MG14 nuclease.

[0235] MG15

[0236] SEQ ID NOs: 930-1092, 7598-7622 and 11593-11616 show the full-length peptide sequences of MG15 nuclease.

[0237] SEQ ID NOs: 2751-2913 show the peptide sequences of the RuvC_III domain of the above-mentioned MG15 nuclease.

[0238] SEQ ID NOs: 4565-4727 show peptides of the HNH domain of the above-mentioned MG15 nuclease.

[0239] SEQ ID NOs: 5506 and 11168-11172 show the nucleotide sequence of the MG15 tracrRNA derived from the same locus as the MG15 nuclease described above.

[0240] SEQ ID NOs: 5470 and 11577-11592 show the nucleotide sequences of sgRNAs engineered to function with the MG15 nuclease.

[0241] SEQ ID NO: 5582 shows the nucleotide sequence of the E. coli codon-optimized coding sequence of an MG15 family enzyme.

[0242] SEQ ID NOs: 5668-5675 show peptide sequences characteristic of MG15 family enzymes.

[0243] SEQ ID NOs: 9612-9671 show the peptide sequences of the PAM interaction domain of MG15 nuclease.

[0244] SEQ ID NOs: 11539-11554 show the nucleotide sequences of the single guide PAMs of the MG15 nuclease.

[0245] MG16

[0246] SEQ ID NOs: 1093-1353 and 7623-7698 show the full-length peptide sequence of MG16 nuclease.

[0247] SEQ ID NOs: 2914-3174 show the peptide sequences of the RuvC_III domain of the above-mentioned MG16 nuclease.

[0248] SEQ ID NOs: 4728-4988 show peptides of the HNH domain of the above-mentioned MG16 nuclease.

[0249] SEQ ID NOs: 5507 and 11173-11174 show the nucleotide sequence of the MG16 tracrRNA derived from the same locus as the MG16 nuclease described above.

[0250] SEQ ID NOs: 5471 and 11137 show the nucleotide sequences of sgRNAs engineered to function with MG16 nuclease.

[0251] SEQ ID NO: 5583 shows the nucleotide sequence of the E. coli codon-optimized coding sequence of the MG16 family enzyme.

[0252] SEQ ID NOs: 5676-5678 show peptide sequences characteristic of MG16 family enzymes.

[0253] SEQ ID NOs: 9672-9842 show the peptide sequences of the PAM interaction domain of MG16 nuclease.

[0254] SEQ ID NO: 11114 shows the nucleotide sequence of the single guide PAM of MG16 nuclease.

[0255] SEQ ID NOs: 11313-11320 show the nucleotide sequences of the target sites of MG16 nuclease.

[0256] MG17

[0257] SEQ ID NOs: 7699-7715 show the full-length peptide sequence of MG17 nuclease.

[0258] SEQ ID NOs: 9843-9856 show the peptide sequences of the PAM interaction domain of MG17 nuclease.

[0259] SEQ ID NO: 11115 shows the nucleotide sequence of the single guide PAM of MG17 nuclease.

[0260] SEQ ID NO: 11138 shows the nucleotide sequence of the sgRNA engineered to function with the MG17 nuclease.

[0261] SEQ ID NO: 11175 shows the nucleotide sequence of the MG17 tracrRNA derived from the same locus as the MG17 nuclease described above.

[0262] MG18

[0263] SEQ ID NOs: 1354-1511 show the full-length peptide sequence of MG18 nuclease.

[0264] SEQ ID NOs: 3175-3330 show the peptide sequences of the RuvC_III domain of the above-mentioned MG18 nuclease.

[0265] SEQ ID NOs: 4989-5146 show peptides of the HNH domain of the above-mentioned MG18 nuclease.

[0266] SEQ ID NO: 5508 shows the nucleotide sequence of the MG18 tracrRNA derived from the same locus as the MG18 nuclease described above.

[0267] SEQ ID NO: 5472 shows the nucleotide sequence of an sgRNA engineered to function with the MG18 nuclease.

[0268] SEQ ID NO: 5584 shows the nucleotide sequence of the E. coli codon-optimized coding sequence of an MG18 family enzyme.

[0269] SEQ ID NOs: 5679-5686 show peptide sequences characteristic of MG18 family enzymes.

[0270] SEQ ID NOs: 9857-9891 show the peptide sequences of the PAM interaction domain of MG18 nuclease.

[0271] SEQ ID NOs: 11321-11327 show the nucleotide sequences of the target sites of MG18 nuclease.

[0272] MG21

[0273] SEQ ID NOs: 1512-1655 and 7716-7733 show the full-length peptide sequence of MG21 nuclease.

[0274] SEQ ID NOs: 3331-3474 show the peptide sequences of the RuvC_III domain of the above-mentioned MG21 nuclease.

[0275] SEQ ID NOs: 5147-5290 show peptides of the HNH domain of the above-mentioned MG21 nuclease.

[0276] SEQ ID NOs: 5509 and 11176-11178 show the nucleotide sequence of MG21 tracrRNA derived from the same locus as the above-mentioned MG21 nuclease.

[0277] SEQ ID NOs: 5473 and 11139 show the nucleotide sequences of sgRNAs engineered to function with MG21 nuclease.

[0278] SEQ ID NO: 5585 shows the nucleotide sequence of the E. coli codon-optimized coding sequence of the MG21 family enzyme.

[0279] SEQ ID NOs: 5687-5692 and 5674-5675 show peptide sequences characteristic of MG21 family enzymes.

[0280] SEQ ID NOs: 9892-9951 show the peptide sequences of the PAM interaction domain of MG21 nuclease.

[0281] SEQ ID NO: 11116 shows the nucleotide sequence of the single guide PAM of MG21 nuclease.

[0282] SEQ ID NOs: 11328-11336 show the nucleotide sequences of the target sites of MG21 nuclease.

[0283] MG22

[0284] SEQ ID NOs: 1656-1755 show the full-length peptide sequence of MG22 nuclease.

[0285] SEQ ID NOs: 3475-3568 show the peptide sequences of the RuvC_III domain of the above-mentioned MG22 nuclease.

[0286] SEQ ID NOs: 5291-5389 show peptides of the HNH domain of the above-mentioned MG22 nuclease.

[0287] SEQ ID NOs: 5510 and 11179-11180 show the nucleotide sequence of the MG22 tracrRNA derived from the same locus as the MG22 nuclease described above.

[0288] SEQ ID NO: 5474 shows the nucleotide sequence of an sgRNA engineered to function with the MG22 nuclease.

[0289] SEQ ID NO: 5586 shows the nucleotide sequence of the E. coli codon-optimized coding sequence for an MG22 family enzyme.

[0290] SEQ ID NOs: 5694-5699 show peptide sequences characteristic of MG22 family enzymes.

[0291] SEQ ID NOs:9952-9982 show the peptide sequences of the PAM interaction domain of MG22 nuclease.

[0292] SEQ ID NOs: 11337-11344 show the nucleotide sequences of the target sites of MG22 nuclease.

[0293] MG23

[0294] SEQ ID NOs: 1756-1826 and 7734-7735 show the full-length peptide sequence of MG23 nuclease.

[0295] SEQ ID NOs: 3569-3637 show the peptide sequences of the RuvC_III domain of the above-mentioned MG23 nuclease.

[0296] SEQ ID NOs: 5390-5460 show peptides of the HNH domain of the above-mentioned MG23 nuclease.

[0297] SEQ ID NOs: 5511 and 11181-11182 show the nucleotide sequence of MG23 tracrRNA derived from the same locus as the above-mentioned MG23 nuclease.

[0298] SEQ ID NOs: 5475 and 11140 show the nucleotide sequences of sgRNAs engineered to function with MG23 nuclease.

[0299] SEQ ID NO: 5587 shows the nucleotide sequence of the E. coli codon-optimized coding sequence for an MG23 family enzyme.

[0300] SEQ ID NOs: 5700-5717 show peptide sequences characteristic of MG23 family enzymes.

[0301] SEQ ID NOs: 9983-10004 show the peptide sequences of the PAM interaction domain of MG23 nuclease.

[0302] SEQ ID NOs: 11345-11351 show the nucleotide sequences of the target sites of MG23 nuclease.

[0303] MG24

[0304] SEQ ID NOs: 7736-8027 show the full-length peptide sequence of MG24 nuclease.

[0305] SEQ ID NOs: 10005-10162 show the peptide sequences of the PAM interaction domain of MG24 nuclease.

[0306] MG25

[0307] SEQ ID NOs: 8028-8091 show the full-length peptide sequence of MG25 nuclease.

[0308] SEQ ID NOs: 10163-10211 show the peptide sequences of the PAM interaction domain of MG25 nuclease.

[0309] MG38

[0310] SEQ ID NOs: 8092-8095 show the full-length peptide sequence of MG38 nuclease.

[0311] SEQ ID NOs: 10212-10214 show the peptide sequences of the PAM interaction domain of MG38 nuclease.

[0312] MG40

[0313] SEQ ID NOs: 5718-5750 and 8096-8163 show the full-length peptide sequence of MG40 nuclease.

[0314] SEQ ID NOs: 5847-5852 show the protospacer-adjacent motif associated with MG 40 nuclease.

[0315] SEQ ID NOs: 5862-5873 show the nucleotide sequences of sgRNAs engineered to function with the MG40 nuclease.

[0316] SEQ ID NOs: 10215-10263 show the peptide sequences of the PAM interaction domain of MG40 nuclease.

[0317] SEQ ID NOs: 11183-11188 show the nucleotide sequence of MG40 tracrRNA derived from the same locus as the above-mentioned MG40 nuclease.

[0318] MG41

[0319] SEQ ID NOs: 8164-8286 show the full-length peptide sequence of MG41 nuclease.

[0320] SEQ ID NOs: 10264-10304 show the peptide sequences of the PAM interaction domain of MG41 nuclease.

[0321] MG42

[0322] SEQ ID NOs: 8287-8356 show the full-length peptide sequence of MG42 nuclease.

[0323] SEQ ID NOs: 10305-10355 show the peptide sequences of the PAM interaction domain of MG42 nuclease.

[0324] MG43

[0325] SEQ ID NOs: 8357-8453 show the full-length peptide sequence of MG43 nuclease.

[0326] SEQ ID NOs: 10356-10412 show the peptide sequences of the PAM interaction domain of MG43 nuclease.

[0327] SEQ ID NO: 11117 shows the nucleotide sequence of the single guide PAM of MG43 nuclease.

[0328] SEQ ID NO: 11141 shows the nucleotide sequence of an sgRNA engineered to function with the MG43 nuclease.

[0329] SEQ ID NO: 11189 shows the nucleotide sequence of the MG43 tracrRNA derived from the same locus as the MG43 nuclease described above.

[0330] MG44

[0331] SEQ ID NOs: 8454-8496 show the full-length peptide sequence of MG44 nuclease.

[0332] SEQ ID NOs: 10413-10555 show the peptide sequences of the PAM interaction domain of MG44 nuclease.

[0333] SEQ ID NO: 11190 shows the nucleotide sequence of the MG44 tracrRNA derived from the same locus as the MG44 nuclease described above.

[0334] MG46

[0335] SEQ ID NOs: 8497-8634 show the full-length peptide sequence of MG46 nuclease.

[0336] SEQ ID NOs: 10556-10633 show the peptide sequences of the PAM interaction domain of MG46 nuclease.

[0337] SEQ ID NO: 11191 shows the nucleotide sequence of the MG46 tracrRNA derived from the same locus as the MG46 nuclease described above.

[0338] MG47

[0339] SEQ ID NOs: 5751-5768 and 8635-8664 show the full-length peptide sequence of MG47 nuclease.

[0340] SEQ ID NOs: 5853-5854 show the protospacer-adjacent motif associated with the MG47 nuclease.

[0341] SEQ ID NOs: 5878-5881 show the nucleotide sequences of sgRNAs engineered to function with the MG47 nuclease.

[0342] SEQ ID NOs: 10634-10656 show the peptide sequences of the PAM interaction domain of MG47 nuclease.

[0343] SEQ ID NOs: 11192-11193 show the nucleotide sequence of the MG47 tracrRNA derived from the same locus as the MG47 nuclease described above.

[0344] MG48

[0345] SEQ ID NOs: 5769-5804 and 8665 set forth the full length peptide sequence of MG48 nuclease.

[0346] SEQ ID NOs: 5855-5856 show the protospacer-adjacent motif associated with the MG48 nuclease.

[0347] SEQ ID NOs: 5886, 5890, 5893 and 11194 show the nucleotide sequences of MG48 tracrRNA derived from the same locus as the MG48 nuclease described above.

[0348] SEQ ID NOs: 5887, 5891 and 5894 show CRISPR repeat sequences associated with the MG48 nuclease described herein.

[0349] SEQ ID NOs: 5888-5889, 5892, and 5895-5896 show putative sgRNAs designed to function with the MG48 nuclease.

[0350] SEQ ID NOs: 10657-10662 show the peptide sequences of the PAM interaction domain of MG48 nuclease.

[0351] SEQ ID NOs: 11142-11143 show the nucleotide sequences of sgRNAs engineered to function with MG48 nuclease.

[0352] MG49

[0353] SEQ ID NOs: 5805-5823 and 8666-8677 show the full-length peptide sequence of MG49 nuclease.

[0354] SEQ ID NOs: 5857-5858 show the protospacer-adjacent motif associated with the MG49 nuclease.

[0355] SEQ ID NOs: 5862-5873 show the nucleotide sequences of sgRNAs engineered to function with the MG40 nuclease.

[0356] SEQ ID NOs: 5876-5877 show the nucleotide sequences of sgRNAs engineered to function with the MG49 nuclease.

[0357] SEQ ID NOs: 10663-10675 show the peptide sequences of the PAM interaction domain of MG49 nuclease.

[0358] SEQ ID NOs: 11195-11196 show the nucleotide sequence of MG49 tracrRNA derived from the same locus as the MG49 nuclease described above.

[0359] MG50

[0360] SEQ ID NOs: 5824-5826 and 8678-8682 show the full-length peptide sequence of MG50 nuclease.

[0361] SEQ ID NO: 5859 shows the pro-spacer adjacent motif associated with the MG50 nuclease.

[0362] SEQ ID NOs: 5884-5885 show the nucleotide sequences of sgRNAs engineered to function with the MG50 nuclease.

[0363] SEQ ID NOs: 10676-10682 show the peptide sequences of the PAM interaction domain of MG50 nuclease.

[0364] SEQ ID NO: 11197 shows the nucleotide sequence of the MG50 tracrRNA derived from the same locus as the MG50 nuclease described above.

[0365] MG51

[0366] SEQ ID NOs: 5827-5830 and 8683-8705 show the full-length peptide sequence of MG51 nuclease.

[0367] SEQ ID NO: 5860 shows the protospacer-adjacent motif associated with the MG51 nuclease.

[0368] SEQ ID NOs: 5882-5883 show the nucleotide sequences of sgRNAs engineered to function with the MG51 nuclease.

[0369] SEQ ID NOs: 10683-10704 show the peptide sequences of the PAM interaction domain of MG51 nuclease.

[0370] SEQ ID NO: 11198 shows the nucleotide sequence of the MG51 tracrRNA derived from the same locus as the MG51 nuclease described above.

[0371] MG52

[0372] SEQ ID NOs: 5831-5846 and 8706 set forth the full length peptide sequence of MG52 nuclease.

[0373] SEQ ID NO: 5861 shows the protospacer-adjacent motif associated with the MG52 nuclease.

[0374] SEQ ID NOs: 5874-5875 show the nucleotide sequences of sgRNAs engineered to function with the MG52 nuclease.

[0375] SEQ ID NOs: 10705-10710 show the peptide sequences of the PAM interaction domain of MG52 nuclease.

[0376] SEQ ID NO: 11199 shows the nucleotide sequence of the MG52 tracrRNA derived from the same locus as the MG52 nuclease described above.

[0377] MG71

[0378] SEQ ID NOs: 10711-10712 show the peptide sequences of the PAM interaction domain of MG71 nuclease.

[0379] SEQ ID NOs: 11144-11145 show the nucleotide sequences of sgRNAs engineered to function with the MG71 nuclease.

[0380] SEQ ID NOs: 11200-11201 show the nucleotide sequence of MG71 tracrRNA derived from the same locus as the above-mentioned MG71 nuclease.

[0381] MG72

[0382] SEQ ID NO: 11202 shows the nucleotide sequence of the MG72 tracrRNA derived from the same locus as the MG72 nuclease described above.

[0383] MG73

[0384] SEQ ID NOs: 10713-10718 show the peptide sequences of the PAM interaction domain of MG73 nuclease.

[0385] SEQ ID NOs: 11203-11204 show the nucleotide sequence of MG73 tracrRNA derived from the same locus as the MG73 nuclease described above.

[0386] MG74

[0387] SEQ ID NOs: 10719-10732 show the peptide sequences of the PAM interaction domain of MG74 nuclease.

[0388] SEQ ID NO: 11205 shows the nucleotide sequence of the MG74 tracrRNA derived from the same locus as the MG74 nuclease described above.

[0389] MG86

[0390] SEQ ID NOs: 8707-8737 show the full-length peptide sequence of MG86 nuclease.

[0391] SEQ ID NOs: 10733-10791 show the peptide sequences of the PAM interaction domain of MG86 nuclease.

[0392] SEQ ID NO: 11118 shows the nucleotide sequence of the single guide PAM of MG86 nuclease.

[0393] SEQ ID NOs: 11206-11207 show the nucleotide sequence of the MG86 tracrRNA derived from the same locus as the MG86 nuclease described above.

[0394] MG87

[0395] SEQ ID NOs: 8738-8747 show the full-length peptide sequence of MG87 nuclease.

[0396] SEQ ID NOs: 10792-10828 show the peptide sequences of the PAM interaction domain of MG87 nuclease.

[0397] SEQ ID NOs: 11208-11210 show the nucleotide sequence of MG87 tracrRNA derived from the same locus as the MG87 nuclease described above.

[0398] MG88

[0399] SEQ ID NOs: 10829-10841 show the peptide sequences of the PAM interaction domain of MG88 nuclease.

[0400] SEQ ID NOs: 11211-11213 show the nucleotide sequence of MG88 tracrRNA derived from the same locus as the MG88 nuclease described above.

[0401] MG89

[0402] SEQ ID NOs: 10842-10854 show the peptide sequences of the PAM interaction domain of MG89 nuclease.

[0403] SEQ ID NOs: 11214-11215 show the nucleotide sequence of the MG89 tracrRNA derived from the same locus as the MG89 nuclease described above.

[0404] MG94

[0405] SEQ ID NOs: 8748-8781 show the full-length peptide sequence of MG94 nuclease.

[0406] SEQ ID NOs: 10855-10860 show the peptide sequences of the PAM interaction domain of MG94 nuclease.

[0407] SEQ ID NOs: 11119-11120 show the nucleotide sequences of the single guide PAMs of the MG94 nuclease.

[0408] SEQ ID NOs: 11146-11147 show the nucleotide sequences of sgRNAs engineered to function with the MG94 nuclease.

[0409] SEQ ID NOs: 11216-11217 show the nucleotide sequence of the MG94 tracrRNA derived from the same locus as the MG94 nuclease described above.

[0410] MG95

[0411] SEQ ID NOs: 8782-8785 show the full-length peptide sequence of MG95 nuclease.

[0412] SEQ ID NOs: 10861-10863 show the peptide sequences of the PAM interaction domain of MG95 nuclease.

[0413] SEQ ID NOs: 11121-11122 show the nucleotide sequence of the single guide PAM of MG95 nuclease.

[0414] SEQ ID NOs: 11148-11149 show the nucleotide sequences of sgRNAs engineered to function with the MG95 nuclease.

[0415] SEQ ID NOs: 11218-11219 show the nucleotide sequence of the MG95 tracrRNA derived from the same locus as the MG95 nuclease described above.

[0416] MG96

[0417] SEQ ID NOs: 8786-8814 show the full-length peptide sequence of MG96 nuclease.

[0418] SEQ ID NOs: 10864-10884 show the peptide sequences of the PAM interaction domain of MG96 nuclease.

[0419] SEQ ID NO: 11123 shows the nucleotide sequence of the single guide PAM of MG96 nuclease.

[0420] SEQ ID NO: 11150 shows the nucleotide sequence of the sgRNA engineered to function with the MG96 nuclease.

[0421] SEQ ID NO: 11220 shows the nucleotide sequence of the MG96 tracrRNA derived from the same locus as the MG96 nuclease described above.

[0422] MG97

[0423] SEQ ID NOs: 8815-8818 show the full-length peptide sequence of MG97 nuclease.

[0424] SEQ ID NOs: 10885-10887 show the peptide sequences of the PAM interaction domain of MG97 nuclease.

[0425] MG98

[0426] SEQ ID NOs: 8819-8959 show the full-length peptide sequence of MG98 nuclease.

[0427] SEQ ID NOs: 10888-10936 show the peptide sequences of the PAM interaction domain of MG98 nuclease.

[0428] SEQ ID NOs: 11124-11125 show the nucleotide sequences of the single guide PAMs of the MG98 nuclease.

[0429] SEQ ID NOs: 11151-11152 show the nucleotide sequences of sgRNAs engineered to function with the MG98 nuclease.

[0430] SEQ ID NOs: 11221-11222 show the nucleotide sequence of the MG98 tracrRNA derived from the same locus as the MG98 nuclease described above.

[0431] MG99

[0432] SEQ ID NO: 11153 shows the nucleotide sequence of the sgRNA engineered to function with the MG99 nuclease.

[0433] SEQ ID NO: 11223 shows the nucleotide sequence of the MG99 tracrRNA derived from the same locus as the MG99 nuclease described above.

[0434] MG100

[0435] SEQ ID NOs: 8960-9036 show the full-length peptide sequence of MG100 nuclease.

[0436] SEQ ID NOs: 10937-10991 show the peptide sequences of the PAM interaction domain of MG100 nuclease.

[0437] SEQ ID NO: 11126 shows the nucleotide sequence of the single guide PAM of MG100 nuclease.

[0438] SEQ ID NOs: 11154-11155 show the nucleotide sequences of sgRNAs engineered to function with the MG100 nuclease.

[0439] SEQ ID NOs: 11224-11225 show the nucleotide sequence of MG100 tracrRNA derived from the same locus as the above-mentioned MG100 nuclease.

[0440] MG111

[0441] SEQ ID NOs: 9037-9126 show the full-length peptide sequence of MG111 nuclease.

[0442] SEQ ID NOs: 10992-11046 show the peptide sequences of the PAM interaction domain of the MG111 nuclease.

[0443] SEQ ID NOs: 11127-11128 show the nucleotide sequence of the single guide PAM of MG111 nuclease.

[0444] SEQ ID NOs: 11156-11157 show the nucleotide sequences of sgRNAs engineered to function with the MG111 nuclease.

[0445] SEQ ID NOs: 11226-11227 show the nucleotide sequence of the MG111 tracrRNA derived from the same locus as the MG111 nuclease described above.

[0446] MG112

[0447] SEQ ID NOs: 9127-9149 show the full-length peptide sequence of MG112 nuclease.

[0448] SEQ ID NOs: 11047-11062 show the peptide sequences of the PAM interaction domain of MG112 nuclease.

[0449] MG116

[0450] SEQ ID NOs: 9150-9191 show the full-length peptide sequence of MG116 nuclease.

[0451] SEQ ID NOs: 11063-11098 show the peptide sequences of the PAM interaction domain of MG116 nuclease.

[0452] SEQ ID NO: 11129 shows the nucleotide sequence of the single guide PAM of MG116 nuclease.

[0453] SEQ ID NO: 11158 shows the nucleotide sequence of the sgRNA engineered to function with the MG116 nuclease.

[0454] SEQ ID NO: 11228 shows the nucleotide sequence of the MG116 tracrRNA derived from the same locus as the MG116 nuclease described above.

[0455] MG123

[0456] SEQ ID NOs: 11617-11624 show the full-length peptide sequence of MG123 nuclease.

[0457] SEQ ID NO: 11518 shows the nucleotide sequence of the single guide PAM of MG123 nuclease.

[0458] SEQ ID NO: 11555 shows the nucleotide sequence of the sgRNA engineered to function with the MG123 nuclease.

[0459] MG124

[0460] SEQ ID NOs: 11625-11626 show the full-length peptide sequence of MG124 nuclease.

[0461] SEQ ID NO: 11519 shows the nucleotide sequence of the single guide PAM of MG124 nuclease.

[0462] SEQ ID NO: 11556 shows the nucleotide sequence of the sgRNA engineered to function with the MG124 nuclease.

[0463] MG125

[0464] SEQ ID NOs: 11627-11707 show the full-length peptide sequence of MG125 nuclease.

[0465] SEQ ID NOs: 11520-11524 show the nucleotide sequences of the single guide PAMs of the MG125 nuclease.

[0466] SEQ ID NOs: 11557-11561 show the nucleotide sequences of sgRNAs engineered to function with the MG125 nuclease.

[0467] MG150

[0468] SEQ ID NOs: 7359-7368 and 11708-11710 show the full-length peptide sequence of MG150 nuclease.

[0469] SEQ ID NOs: 11525-11529 show the nucleotide sequences of the single guide PAMs of the MG150 nuclease.

[0470] SEQ ID NOs: 11562-11566 show the nucleotide sequences of sgRNAs engineered to function with the MG150 nuclease.

[0471] B2M Targeting

[0472] SEQ ID NOs: 6305-6386 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target B2M.

[0473] SEQ ID NOs: 6387-6468 show the DNA sequences of the B2M target sites.

[0474] TRAC targeting

[0475] SEQ ID NOs: 6469-6508 and 6804 show the nucleotide sequences of sgRNAs engineered to function with the MG3-6 nuclease to target TRAC.

[0476] SEQ ID NOs: 6509-6548 and 6805 show the DNA sequences of the TRAC target sites.

[0477] HPRT Targeting

[0478] SEQ ID NOs: 6549-6615 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target HPRT.

[0479] SEQ ID NOs: 6616-6682 show the DNA sequence of the HPRT target site.

[0480] MG3-6 TRBC1 / 2 targeting

[0481] SEQ ID NOs: 6683-6721 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target TRBC1 / 2.

[0482] SEQ ID NOs: 6722-6760 show the DNA sequences of the TRBC1 / 2 target sites.

[0483] MG3-8 TRBC1 / 2 targeting

[0484] SEQ ID NOs: 6761-6781 show the nucleotide sequences of sgRNAs engineered to function with MG3-8 nuclease to target TRBC1 / 2.

[0485] SEQ ID NOs: 6782-6802 show the DNA sequences of the TRBC1 / 2 target sites.

[0486] MG3-6 CD2 targeting

[0487] SEQ ID NOs: 6811-6852 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target CD2.

[0488] SEQ ID NOs: 6853-6894 show the DNA sequences of the CD2 target sites.

[0489] MG3-6 CD5 targeting

[0490] SEQ ID NOs: 6895-6958 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target CD5.

[0491] SEQ ID NOs: 6959-7022 show the DNA sequences of the CD5 target sites.

[0492] MG3-6 FAS targeting

[0493] SEQ ID NOs: 7023-7056 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target FAS.

[0494] SEQ ID NOs: 7057-7090 show the DNA sequences of the FAS target sites.

[0495] MG3-6 PD-1 targeting

[0496] SEQ ID NOs: 7091-7128 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target PD-1.

[0497] SEQ ID NOs: 7129-7166 show the DNA sequences of the PD-1 target sites.

[0498] MG3-6 hRosa26 targeting

[0499] SEQ ID NOs:7167-7198 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target hRosa26.

[0500] SEQ ID NOs: 7199-7230 show the DNA sequence of the hRosa26 target site.

[0501] MG21-1TRAC targeting

[0502] SEQ ID NOs: 7231-7234 show the nucleotide sequences of sgRNAs engineered to function with the MG21-1 nuclease to target TRAC.

[0503] SEQ ID NOs: 7235-7238 show the DNA sequences of the TRAC target sites.

[0504] MG23-1 TRAC targeting

[0505] SEQ ID NOs: 7239-7247 show the nucleotide sequences of sgRNAs engineered to function with the MG23-1 nuclease to target TRAC.

[0506] SEQ ID NOs: 7248-7256 show the DNA sequences of the TRAC target sites.

[0507] MG14-241 AAVS1 targeting

[0508] SEQ ID NOs: 11508-11510 show the nucleotide sequences of sgRNAs engineered to function with the MG14-241 nuclease to target AAVS1.

[0509] SEQ ID NOs: 11511-11513 show the DNA sequences of the AAVS1 target sites.

[0510] MG23-1 AAVS1 targeting

[0511] SEQ ID NOs: 7257-7260 show the nucleotide sequences of sgRNAs engineered to function with the MG23-1 nuclease to target AAVS1.

[0512] SEQ ID NOs: 7261-7264 show the DNA sequences of the AAVS1 target sites.

[0513] MG71-2 AAVS1 targeting

[0514] SEQ ID NOs: 7265-7266 show the nucleotide sequences of sgRNAs engineered to function with the MG71-2 nuclease to target AAVS1.

[0515] SEQ ID NOs: 7267-7268 show the DNA sequence of the AAVS1 target site.

[0516] MG73-1 TRAC targeting

[0517] SEQ ID NO: 7269 shows the nucleotide sequence of the sgRNA engineered to function with the MG73-1 nuclease to target TRAC.

[0518] SEQ ID NO: 7270 shows the DNA sequence of the TRAC target site.

[0519] MG89-2 TRAC targeting

[0520] SEQ ID NOs: 7271-7277 show the nucleotide sequences of sgRNAs engineered to function with the MG89-2 nuclease to target TRAC.

[0521] SEQ ID NOs: 7278-7284 show the DNA sequences of the TRAC target sites.

[0522] MG99-1 TRAC targeting

[0523] SEQ ID NOs: 11514-11515 show the nucleotide sequences of sgRNAs engineered to function with the MG99-1 nuclease to target TRAC.

[0524] SEQ ID NOs: 11516-11517 show the DNA sequence of the TRAC target site.

[0525] MG3-6 Human HAO-1 Targeting

[0526] SEQ ID NOs: 11352-11372 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target human HAO-1.

[0527] MG3-6 Human GPR146 Targeting

[0528] SEQ ID NOs: 11374-11405 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target human GPR146.

[0529] SEQ ID NOs: 11406-11437 show the DNA sequences of human GPR146 target sites.

[0530] GPR146 targeting in MG3-6 mice

[0531] SEQ ID NOs: 11438-11472 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target mouse GPR146.

[0532] SEQ ID NOs: 11473-11507 show the DNA sequences of mouse GPR146 target sites. DETAILED DESCRIPTION

[0533] Although various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided as examples only. Without departing from the present invention, a variety of variations, changes and substitutions may be envisioned by those skilled in the art. It should be understood that various alternatives to the embodiments of the present invention described herein may be employed.

[0534] Unless otherwise indicated, the practice of certain methods disclosed herein employs techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA. See, e.g., Sambrook and Green et al., Molecular Cloning: A Laboratory Manual, 4th edition (2012); the book series Current Protocols in Molecular Biology (FM Ausubel et al., eds.); the book series Methods In Enzymology (Academic Press, Inc.), PCR 2: A Practical Approach (MJ MacPherson, BD Hames and GR Taylor, eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual, and Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th edition (RI Freshney, ed. (2010)) (each of which is incorporated herein by reference in its entirety).

[0535] As used herein, the singular forms "a / an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. In addition, where the terms "including", "include", "having", "has", "with" or variations thereof are used in the detailed description and / or claims, such terms are intended to be inclusive in a manner similar to the term "comprising".

[0536] The term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within one or more than one standard deviation, as practiced in the art. Alternatively, "about" can mean a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 1% of a given value.

[0537] As used herein, "cell" generally refers to a biological cell. A cell can be the basic structure, function or biological unit of a living organism. A cell can be derived from any organism having one or more cells. Some non-limiting examples include: prokaryotic cells, eukaryotic cells, bacterial cells, archaeal cells, cells of unicellular eukaryotic organisms, protozoan cells, cells from plants (e.g., cells from cultivated crops, fruits, vegetables, grains, soybeans, corn, maize, wheat, seeds, tomatoes, rice, cassava, sugar cane, pumpkin, hay, potatoes, cotton, hemp, tobacco, flowering plants, conifers, gymnosperms, ferns, lycopodiella, hornwort, liverwort, mosses), algae cells (e.g., Botryococcus braunii, Chlamydomonas reinhardtii, Nannochloropsis gaditana, Chlorella pyrenoidosa, C. agardh Sargassum paeoniae), C. Agardh, etc.), algae (e.g., kelp), fungal cells (e.g., yeast cells, cells from mushrooms), animal cells, cells from invertebrates (e.g., fruit flies, cnidarians, echinoderms, nematodes, etc.), cells from vertebrates (e.g., fish, amphibians, reptiles, birds, mammals), cells from mammals (e.g., pigs, cows, goats, sheep, rodents, rats, mice, non-human primates, humans, etc.), etc. Sometimes, the cell is not derived from a natural organism (e.g., the cell can be synthetically manufactured, sometimes referred to as an artificial cell).

[0538] As used herein, the term "nucleotide" generally refers to a base-sugar-phosphate combination. Nucleotide may include synthetic nucleotides. Nucleotide may include synthetic nucleotide analogs. Nucleotide may be a monomeric unit of a nucleic acid sequence (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)). The term nucleotide may include ribonucleoside triphosphates, adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP) and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP or derivatives thereof. Such derivatives may include, for example, [αS] dATP, 7-deaza-dGTP and 7-deaza-dATP, and nucleotide derivatives that impart nuclease resistance to nucleic acid molecules containing them. As used herein, the term nucleotide may refer to dideoxyribonucleoside triphosphates (ddNTP) and derivatives thereof. Illustrative examples of dideoxyribonucleoside triphosphates may include, but are not limited to: ddATP, ddCTP, ddGTP, ddITP and ddTTP. Nucleotides can be unlabeled or detectably labeled, such as using a portion comprising an optically detectable portion (e.g., a fluorophore). Quantum dots can also be used for labeling. Detectable labels can include, for example, radioisotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels, and enzyme labels. The fluorescent labeling of nucleotides can include, but is not limited to, fluorescein, 5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N, N, N', N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxyl-X-rhodamine (ROX), 4-(4'dimethylaminophenylazo)benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, cyanine, and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS).Specific examples of fluorescently labeled nucleotides can include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP, available from Perkin Elmer, Foster City, Calif.; FluoroLink deoxynucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink FluorX-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5-dUTP; fluorescein-15-dATP, fluorescein-12-dUTP, tetramethyl-rhodamine-6-dUTP, IR770-9-dATP, fluorescein-12-ddUTP, fluorescein-12-UTP, and fluorescein-15-2′-dATP available from Boehringer Mannheim, Indianapolis, Ind.; and fluorescein-15-2′-dATP available from Molecular Probes, Inc., Eugene, Oregon. Probes, Eugene, Oreg.), BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade Blue-7-UTP, Cascade Blue-7-dUTP, fluorescein-12-UTP, fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine Green-5-UTP, Rhodamine Green-5-dUTP, Tetramethylrhodamine-6-UTP, Tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and Texas Red-12-dUTP. Nucleotides can also be labeled or indicated by chemical modification. The chemically modified single nucleotide may be a biotin-dNTP.Some non-limiting examples of biotinylated dNTPs can include biotin-dATP (e.g., bio-N6-ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).

[0539] The terms "polynucleotide," "oligonucleotide," and "nucleic acid" are used interchangeably to refer generally to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof, in single-stranded, double-stranded or multi-stranded form. The polynucleotides may be exogenous or endogenous to the cell. The polynucleotides may be present in a cell-free environment. The polynucleotides may be genes or fragments thereof. The polynucleotides may be DNA. The polynucleotides may be RNA. The polynucleotides may have any three-dimensional structure and may perform any function. The polynucleotides may include one or more analogs (e.g., altered backbones, sugars, or nucleobases). If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. Some non-limiting examples of analogs include: 5-bromouracil, peptide nucleic acids, heterologous nucleic acids, morpholinos, locked nucleic acids, glycerol nucleic acids, threose nucleic acids, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g., rhodamine or fluorescein linked to a sugar), thiol-containing nucleotides, biotin-linked nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, braided nucleotides, and wyosine. Non-limiting examples of polynucleotides include coding or non-coding regions of genes or gene fragments, multiple loci (one locus) defined according to linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated DNA of any sequence, cell-free polynucleotides including cell-free DNA (cfDNA) and cell-free RNA (cfRNA), nucleic acid probes and primers. Nucleotide sequences may be interspersed with non-nucleotide components.

[0540] The term "transfection" or "transfected" generally refers to the introduction of nucleic acid into cells by non-viral or viral-based methods. The nucleic acid molecule can be a gene sequence encoding a complete protein or a functional portion thereof. See, for example, Sambrook et al. (1989), Molecular Cloning: A Laboratory Manual, 18.1-18.88.

[0541] The terms "peptide", "polypeptide" and "protein" are used interchangeably herein to generally refer to a polymer of at least two amino acid residues connected by a peptide bond. This term does not indicate the specific length of the polymer, nor is it intended to imply or distinguish whether the peptide is produced using recombinant technology, chemical or enzymatic synthesis, or is naturally present. The term is applicable to naturally occurring amino acid polymers and amino acid polymers including at least one modified amino acid. In some cases, the polymer may be interspersed with non-amino acids. The term includes amino acid chains of any length, including full-length proteins and proteins with or without secondary or tertiary structures (e.g., domains). The term also encompasses amino acid polymers that have been modified; for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, oxidation, and any other operations, such as conjugation with a labeling component. As used herein, the terms "amino acid" and "amino acids" generally refer to natural and non-natural amino acids, including but not limited to modified amino acids and amino acid analogs. Modified amino acids may include natural and non-natural amino acids that have been chemically modified to include groups or chemical moieties that are not naturally present on amino acids. Amino acid analogs may refer to amino acid derivatives. The term "amino acid" encompasses D-amino acids and L-amino acids.

[0542] As used herein, "non-natural" can generally refer to nucleic acid or polypeptide sequences not found in natural nucleic acids or proteins. Non-natural can refer to affinity tags. Non-natural can refer to fusions. Non-natural can refer to naturally occurring nucleic acid or polypeptide sequences including mutations, insertions or deletions. Non-natural sequences can show or encode activities (e.g., enzymatic activity, methyltransferase activity, acetyltransferase activity, kinase activity, ubiquitination activity, etc.) that can also be shown by nucleic acid or polypeptide sequences fused to non-natural sequences. Non-natural nucleic acids or polypeptide sequences can be connected to naturally occurring nucleic acids or polypeptide sequences (or variants thereof) by genetic engineering to produce chimeric nucleic acids or polypeptide sequences encoding chimeric nucleic acids or polypeptides.

[0543] As used herein, the term "promoter" generally refers to a regulatory DNA region that controls gene transcription or expression and can be located adjacent to or overlapping a nucleotide or nucleotide region that initiates RNA transcription. A promoter can contain a specific DNA sequence that binds a protein factor (commonly referred to as a transcription factor) that promotes the binding of RNA polymerase to DNA, thereby leading to gene transcription. 'Basic promoter', also referred to as 'core promoter', generally refers to a promoter containing all basic elements that promote transcriptional expression of an operably linked polynucleotide. A eukaryotic basal promoter can contain a TATA box or a CAAT box.

[0544] As used herein, the term "expression" generally refers to the process of transcribing a nucleic acid sequence or polynucleotide from a DNA template (e.g., transcribed into mRNA or other RNA transcripts) or subsequently translating the transcribed mRNA into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides may be collectively referred to as "gene products." If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.

[0545] As used herein, "operably linked," "operably connected," "operably linked," or their grammatical equivalents generally refer to the juxtaposition of genetic elements, such as promoters, enhancers, polyadenylation sequences, etc., wherein the elements are in a relationship that permits them to operate in an intended manner. For example, a regulatory element, which may include a promoter or enhancer sequence, is operably linked to a coding region if the regulatory element helps to initiate transcription of the coding sequence. Intervening residues may exist between the regulatory element and the coding region as long as this functional relationship is maintained.

[0546] As used herein, "vector" generally refers to a macromolecule or macromolecular association that includes or associates with a polynucleotide and can be used to mediate the delivery of the polynucleotide to a cell. Examples of vectors include plasmids, viral vectors, liposomes, and other gene delivery vehicles. Vectors generally include genetic elements, such as regulatory elements, that are operably linked to a gene to promote expression of the gene in a target.

[0547] As used herein, "expression cassette" and "nucleic acid cassette" are generally used interchangeably to refer to a combination of nucleic acid sequences or elements that are expressed together or operably linked for expression. In some cases, an expression cassette refers to a combination of regulatory elements and one or more genes to which they are operably linked for expression.

[0548] A "functional fragment" of a DNA or protein sequence generally refers to a fragment that retains a biological activity (function or structure) substantially similar to that of the full-length DNA or protein sequence. The biological activity of a DNA sequence may be its ability to affect expression in a manner attributed to the full-length sequence.

[0549] As used herein, an "engineered" object generally indicates that the object has been modified by human intervention. According to non-limiting examples: a nucleic acid can be modified by changing its sequence to a sequence that does not exist in nature; a nucleic acid can be modified by connecting it to a nucleic acid that is not associated with it in nature, so that the connection product has a function that does not exist in the original nucleic acid; an engineered nucleic acid can be synthesized in vitro with a sequence that does not exist in nature; a protein can be modified by changing its amino acid sequence to a sequence that does not exist in nature; an engineered protein can acquire a new function or property. An "engineered" system includes at least one engineered component.

[0550] As used herein, "synthetic" and "artificial" are used interchangeably to refer to proteins or domains thereof that have low sequence identity (e.g., less than 50% sequence identity, less than 25% sequence identity, less than 10% sequence identity, less than 5% sequence identity, less than 1% sequence identity) to naturally occurring human proteins. For example, VPR and VP64 domains are synthetic transactivation domains.

[0551] As used herein, the term "tracrRNA" or "tracr sequence" generally can refer to a nucleic acid having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% sequence identity or sequence similarity with a wild-type exemplary tracrRNA sequence (e.g., tracrRNA from S. pyogenes, S. aureus, etc. or SEQ ID NOs: 5476-5511). TracrRNA can refer to a nucleic acid having at most about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% sequence identity or sequence similarity with a wild-type exemplary tracrRNA sequence (e.g., tracrRNA from S. pyogenes, S. aureus, etc.). TracrRNA can refer to a modified form of tracrRNA, which can include nucleotide changes, such as deletions, insertions or substitutions, variants, mutations or chimeras. TracrRNA can refer to a nucleic acid that is at least about 60% identical to a wild exemplary tracrRNA sequence (e.g., tracrRNA from Streptococcus pyogenes, Staphylococcus aureus, etc.) over a period of at least 6 consecutive nucleotides. For example, the tracrRNA sequence can be at least about 60% identical, at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical or 100% identical to a wild-type exemplary tracrRNA sequence (e.g., tracrRNA from Streptococcus pyogenes, Staphylococcus aureus, etc.) over a period of at least 6 consecutive nucleotides. The type II tracrRNA sequence can be predicted on the genomic sequence.

[0552] As used herein, "guide nucleic acid" may generally refer to a nucleic acid that can hybridize with another nucleic acid. A guide nucleic acid may be RNA. A guide nucleic acid may be DNA. A guide nucleic acid may be programmed to specifically bind to a nucleic acid sequence site. A nucleic acid or target nucleic acid to be targeted may include nucleotides. A guide nucleic acid may include nucleotides. A portion of a target nucleic acid may be complementary to a portion of a guide nucleic acid. A strand of a double-stranded target polynucleotide that is complementary to and hybridized with a guide nucleic acid may be referred to as a complementary strand. A strand of a double-stranded target polynucleotide that is complementary to a complementary strand and therefore may not be complementary to a guide nucleic acid may be referred to as a non-complementary strand. A guide nucleic acid may include a polynucleotide strand and may be referred to as a "single guide nucleic acid". A guide nucleic acid may include two polynucleotide strands and may be referred to as a "dual guide nucleic acid". If not otherwise specified, the term "guide nucleic acid" may be included to refer to both a single guide nucleic acid and a dual guide nucleic acid. A guide nucleic acid may include a segment that may be referred to as a "nucleic acid targeting segment" or a "nucleic acid targeting sequence". A nucleic acid targeting segment may include a subsegment that may be referred to as a "protein binding segment" or a "protein binding sequence" or a "Cas protein binding segment".

[0553] In the context of two or more nucleic acids or polypeptide sequences, the term "sequence identity" or "percent identity" generally refers to sequences of two (e.g., in a pairwise comparison) or more (e.g., in a multiple sequence alignment) identical or having the same specific percentage of amino acid residues or nucleotides when compared and aligned within a local or global comparison window for maximum correspondence, as measured using a sequence comparison algorithm. Suitable sequence comparison algorithms for polypeptide sequences include, for example, BLASTP using a word length (W) of 3, an expected value I of 10, and a BLOSUM62 scoring matrix to set the gap penalty to 11 for presence, 1 for extension, and using a conditional composition scoring matrix adjustment for polypeptide sequences longer than 30 residues; using a word length (W) of 2, an expected value (E) of 1000000, and a PAM30 scoring matrix (for sequences less than 30 residues, the gap penalty is set to 9 to open a gap, and is set to 1 to expand the gap) (these are BLAST sets BLASTP with default parameters in NCBI (available at https: / / blast.ncbi.nlm.nih.gov); CLUSTALW with parameters; Smith-Waterman homology search algorithm with the following parameters: matches of 2, mismatches of -1, and gaps of -1; MUSCLE with default parameters; MAFFT with the following parameters: retree of 2 and maxiterations of 1000; Novafold with default parameters; HMMER hmmalign with default parameters.

[0554] The present disclosure includes variants of any enzyme in the enzymes with one or more conservative amino acid substitutions described herein. Such conservative substitutions can be carried out in the amino acid sequence of a polypeptide without destroying the three-dimensional structure or function of the polypeptide. Conservative substitutions can be completed by replacing each other with amino acids having similar hydrophobicity, polarity and R chain length. Additionally or alternatively, by comparing the alignment sequences of homologous proteins from different species, conservative substitutions can be identified by positioning the amino acid residues that mutate between species (e.g., non-conservative residues) without changing the basic function of the encoded protein. 48, MG49, MG50, MG51, MG52, MG71, MG72, MG73, MG74, MG86, MG87, MG88, MG89, MG94, MG95, MG96, MG97, MG98, MG99, MG100, MG101, MG102, MG103, MG104, MG105, MG106, MG107, MG108, MG109, MG110, MG111, MG112, MG113, MG114, MG115, MG116, MG117, MG118, MG119, MG120, MG121, MG122, MG123, MG124, In some embodiments, the invention relates to variants having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to a nucleic acid sequence of the invention. In some embodiments, such conservatively substituted variants are functional variants. Such functional variants may encompass sequences with substitutions such that the activity of key active site residues of the endonuclease is not destroyed. In some embodiments, the functional variants of any protein in the proteins described herein lack substitutions of at least one conserved residue or functional residue.

[0555] Conservative substitution tables providing functionally similar amino acids are available from various references (see, for example, Creighton, Proteins: Structures and Molecular Properties (WH Freeman & Co.); 2nd edition (December 1993)). The following eight groups each contain amino acids that are conservatively substituted for each other:

[0556] 1) Alanine (A), glycine (G);

[0557] 2) Aspartic acid (D), glutamic acid (E);

[0558] 3) Asparagine (N), glutamine (Q);

[0559] 4) Arginine (R), Lysine (K);

[0560] 5) Isoleucine (I), leucine (L), methionine (M), valine (V);

[0561] 6) Phenylalanine (F), tyrosine (Y), tryptophan (W);

[0562] 7) serine (S), threonine (T); and

[0563] 8) Cysteine ​​(C), Methionine (M)

[0564] The disclosure also includes variants of any of the nucleic acid sequences described herein with one or more substitutions. Such variants may include variants having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any of the nucleic acid sequences described herein.

[0565] As used herein, the term "RuvC_III domain" generally refers to the third discontinuous segment of the RuvC nuclease domain (the RuvC nuclease domain comprises three discontinuous segments, RuvC_I, RuvC_II and RuvC_III). RuvC domains or their segments can generally be identified by comparing with recorded domain sequences, with the structural comparison of proteins with annotated domains, or by comparing with a Hidden Markov Model (HMM) constructed based on recorded domain sequences (e.g., Pfam HMM PF18541 of RuvC_III).

[0566] As used herein, the term "HNH domain" generally refers to an endonuclease domain having characteristic histidine and asparagine residues. HNH domains can generally be identified by comparison with recorded domain sequence alignments, with structural alignments of proteins with annotated domains, or by comparison with a hidden Markov model (HMM) constructed based on recorded domain sequences (e.g., Pfam HMM PF01844 for domain HNH).

[0567] Overview

[0568] The discovery of new Cas enzymes with unique functions and structures may offer the potential to further disrupt deoxyribonucleic acid (DNA) editing technologies, thereby improving speed, specificity, functionality, and ease of use. Relative to the predicted prevalence of clustered regularly interspaced short palindromic repeat (CRISPR) systems in microorganisms and the sheer diversity of microbial species, relatively few functionally characterized CRISPR / Cas enzymes exist in the literature. This is in part because a large number of microbial species may not be easily cultured under laboratory conditions. Metagenomic sequencing of natural environmental niches representing a large number of microbial species may offer the potential to substantially increase the number of new CRISPR / Cas systems documented and accelerate the discovery of new oligonucleotide editing functions. A recent example of the fruitfulness of this approach was demonstrated by the discovery of the CasX / CasY CRISPR system in 2016 through metagenomic analysis of natural microbial communities.

[0569] The CRISPR / Cas system is an RNA-guided nuclease complex that has been described as acting as an adaptive immune system in microorganisms. In the natural environment of the CRISPR / Cas system, the CRISPR / Cas system appears in a CRISPR (clustered regularly spaced short palindromic repeats) operon or locus, which generally includes two parts: (i) an array of short repeats (30-40bp) separated by equally short spacer sequences, which encodes RNA-based targeting elements; and (ii) an ORF encoding Cas, which encodes a nuclease polypeptide guided by RNA-based targeting elements and auxiliary proteins / enzymes. Effective nuclease targeting of a specific target nucleic acid sequence generally requires the following two: (i) complementary hybridization between the first 6-8 nucleic acids of the target (target seed) and the crRNA guide: and (ii) the presence of a protospacer adjacent motif (PAM) sequence (PAM is generally a sequence not often represented in the host genome) near the definition of the target seed. According to the exact function and organization of the system, the CRISPR-Cas system is generally divided into 2 categories, 5 types, and 16 subtypes based on shared functional properties and evolutionary similarities.

[0570] Class I CRISPR-Cas systems have large multi-subunit effector complexes and include types I, III, and IV.

[0571] Type I CRISPR-Cas systems are considered to have medium complexity in terms of components. In type I CRISPR-Cas systems, RNA targeting element arrays are transcribed into long precursor crRNAs (pre-crRNAs), which are processed at repeat elements to release short mature crRNAs, when they are followed by a suitable short consensus sequence called a protospacer adjacent motif (PAM), and the short mature crRNA guides the nuclease complex to the nucleic acid target. This treatment is carried out by an endoribonuclease subunit (Cas6) of a large endonuclease complex called a cascade, and the endonuclease complex also includes a nuclease (Cas3) protein component of the nuclease complex guided by crRNA. Cas I nucleases mainly serve as DNA nucleases.

[0572] Type III CRISPR systems may be characterized by the presence of a central nuclease called Cas10 and repeat-associated mysterious proteins (RAMPs) including Csm or Cmr protein subunits. As in type I systems, mature crRNAs are processed by pre-crRNA using a Cas6-like enzyme. Unlike type I and type II systems, type III systems appear to target and cleave DNA-RNA duplexes (such as DNA chains used as templates for RNA polymerases).

[0573] Type IV CRISPR-Cas systems have an effector complex consisting of a highly reduced large subunit nuclease (csf1), two genes for the Cas5 (csf3) and Cas7 (csf2) groups of RAMP proteins, and in some cases a gene for a predicted small subunit; such systems are often found on endogenous plasmids.

[0574] Class II CRISPR-Cas systems typically have single-polypeptide multi-domain nuclease effectors and include types II, V, and VI.

[0575] Type II CRISPR-Cas systems are considered to be the simplest in terms of components. In type II CRISPR-Cas systems, the CRISPR array is processed into mature crRNA without the presence of special endonuclease subunits, but requires a small trans-encoded crRNA (tracrRNA), whose region is complementary to the array repeat sequence; tracrRNA interacts with its corresponding effector nuclease (e.g., Cas9) and repeat sequence to form a precursor dsRNA structure, which is cut by endogenous RNase III, thereby generating a mature effector enzyme that loads both tracrRNA and crRNA. Cas II nucleases are referred to as DNA nucleases. Type 2 effectors generally exhibit a structure consisting of a RuvC-like endonuclease domain, which is folded using an RNase H, wherein an unrelated HNH nuclease domain is inserted into the fold of the RuvC-like nuclease domain. The RuvC-like domain is responsible for the cutting of the target (e.g., crRNA complementary) DNA chain, and the HNH domain is responsible for the cutting of the replaced DNA chain.

[0576] The V-type CRISPR-Cas system is characterized by a nuclease effector (e.g., Cas12) structure similar to that of the type II effector including a RuvC-like domain. Similar to type II, most (but not all) V-type CRISPR systems use tracrRNA to process pre-crRNA into mature crRNA; however, unlike the type II system that requires RNase III to cut pre-crRNA into multiple crRNAs, the V-type system is able to use the effector nuclease itself to cut pre-crRNA. Like the type II CRISPR-Cas system, the V-type CRISPR-Cas system is again referred to as a DNA nuclease. Unlike the type II CRISPR-Cas system, some V-type enzymes (e.g., Cas12a) appear to have a strong single-stranded nonspecific deoxyribonuclease activity activated by the first crRNA-directed cutting of the double-stranded target sequence.

[0577] Type VI CRIPSR-Cas systems have RNA-guided RNA endonucleases. The single polypeptide effector of a type VI system (e.g., Cas13) includes two HEPN ribonuclease domains, rather than a RuvC-like domain. Unlike type II and type V systems, type VI systems also do not appear to require tracrRNA to process pre-crRNA into crRNA. However, similar to type V systems, some type VI systems (e.g., C2C2) appear to have powerful single-stranded nonspecific nuclease (ribonuclease) activity activated by the first crRNA-directed cutting of the target RNA.

[0578] Class II CRISPR-Cas has been most widely used for engineering and development as a designer nuclease / genome editing application due to its simpler architecture.

[0579] One of the early adaptations of such a system for in vitro use can be found in Jinek et al. (Science. 2012 Aug 17;337(6096):816-21, which is incorporated herein by reference in its entirety). The Jinek study first described a system involving (i) recombinantly expressed, purified full-length Cas9 (e.g., class II, type II Cas enzyme) isolated from Streptococcus pyogenes SF370; (ii) purified mature, approximately 42 nt crRNA with an approximately 20 nt 5′ sequence complementary to the desired target DNA sequence to be cleaved, followed by a 3′ tracr binding sequence (the entire crRNA was in vitro transcribed from a synthetic DNA template carrying a T7 promoter sequence); (iii) purified tracrRNA transcribed in vitro from a synthetic DNA template carrying a T7 promoter sequence; and (iv) Mg2+. Jinek later described an improved engineered system in which the crRNA of (ii) was linked to the 5′ end of (iii) via a linker (e.g., GAAA) to form a single fused synthetic guide RNA (sgRNA) that could itself direct Cas9 to the target.

[0580] Mali et al. (Science 2013 Feb 15;339(6121):823-826.), which is incorporated herein by reference in its entirety, later applied this system to mammalian cells by providing a DNA vector encoding the following: (i) an ORF encoding a codon-optimized Cas9 (e.g., a class II, type II Cas enzyme) under a suitable mammalian promoter with a C-terminal nuclear localization sequence (e.g., SV40 NLS) and a suitable polyadenylation signal (e.g., a TK pA signal); and (ii) an ORF encoding a sgRNA (having a 5′ sequence starting with G followed by a 20 nt complementary targeting nucleic acid sequence linked to a 3′ tracr binding sequence, a linker, and a tracrRNA sequence) under a suitable polymerase III promoter (e.g., the U6 promoter).

[0581] MG enzyme

[0582] On the one hand, the present disclosure provides an engineered nuclease system discovered by metagenomic sequencing. In some cases, the sample is subjected to metagenomic sequencing. In some cases, the sample can be collected in various environments. Such environments can be human microbiome, animal microbiome, high temperature environment, low temperature environment. Such environments can include sediments.

[0583] MG3 enzyme

[0584] On the one hand, the present disclosure provides an engineered nuclease system, the engineered nuclease system comprising (a) an endonuclease. In some cases, the endonuclease is a Cas endonuclease. In some cases, the endonuclease is a type II class II Cas endonuclease. The endonuclease may include a RuvC_III domain, wherein the RuvC_III domain has at least about 70% sequence identity with any one of SEQ ID NOs: 2242-2251. In some cases, the endonuclease may include a RuvC_III domain, wherein the RuvC_III domain has at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of SEQ ID NOs: 2242-2251. In some cases, the endonuclease may include a RuvC_III domain, wherein it is substantially identical to any one of SEQ ID NOs: 2242-2251. The endonuclease may include a RuvC_III domain having at least about 70% sequence identity to any one of SEQ ID NOs: 2242-2244. In some cases, the endonuclease may include a RuvC_III domain having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of SEQ ID NOs: 2242-2244. In some cases, the endonuclease can include a RuvC_III domain substantially identical to any one of SEQ ID NOs: 2242-2244.

[0585] The endonuclease may include a HNH domain that is at least about 70% identical to any one of SEQ ID NOs: 4056-4066. In some cases, the endonuclease may include a HNH domain that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to any one of SEQ ID NOs: 4056-4066. The endonuclease may include a HNH domain that is substantially identical to any one of SEQ ID NOs: 4056-4066. The endonuclease may include a HNH domain that is at least about 70% identical to any one of SEQ ID NOs: 4056-4058. In some cases, the endonuclease can include a HNH domain that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to any one of SEQ ID NOs: 4056-4058. The endonuclease can include a HNH domain that is substantially identical to any one of SEQ ID NOs: 4056-4058.

[0586] In some cases, the endonuclease can include a variant having at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 421-431. In some cases, the endonuclease can be substantially identical to any one of SEQ ID NOs: 421-431. In some cases, the endonuclease can include a variant having at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 421-423. In some cases, the endonuclease can be substantially identical to any one of SEQ ID NOs: 421-423.

[0587] In some cases, the endonuclease may include a variant having one or more nuclear localization sequences (NLS). The NLS may be proximal to the N or C terminus of the endonuclease. The NLS may be appended to the N or C terminus of any one of SEQ ID NOs: 421-431, or to a variant having at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 421-431. The NLS may be a SV40 large T antigen NLS. The NLS may be a c-myc NLS. The NLS may comprise a sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99% identical to any one of SEQ ID NOs: 5593-5608. The NLS may comprise a sequence substantially identical to any one of SEQ ID NOs: 5593-5608.

[0588] In some cases, sequence identity is measured by BLASTP, CLUSTALW, MUSCLE, MAFFT, Novafold, or CLUSTALW with Smith-Waterman homology search algorithm parameters.Can be by described BLASTP algorithm use word length (W) be 3, expected value (E) be 10 parameter and use BLOSUM62 scoring matrix that gap penalty is set to existence be 11, be expanded to 1 and use condition composition scoring matrix adjustment to determine sequence identity.

[0589] In some cases, the above system may include (b) at least one engineered synthetic guide RNA (sgRNA) that is capable of forming a complex with an endonuclease with a 5′ targeting region complementary to the desired cleavage sequence. In some cases, the 5′ targeting region may include a PAM sequence compatible with the endonuclease. In some cases, the 5′ most terminal nucleotide of the targeting region may be G. In some cases, the length of the 5′ targeting region may be 15-23 nucleotides. The guide sequence and the tracr sequence may be provided as separate ribonucleic acids (RNAs) or single ribonucleic acids (RNAs). The guide RNA may include a crRNA tracrRNA binding sequence located at 3′ of the targeting region. The guide RNA may include a tracrRNA sequence preceded by a 4-nucleotide linker located at 3′ of the crRNA tracrRNA binding region. The sgRNA may include from 5′ to 3′: a non-natural guide nucleic acid sequence capable of hybridizing with a target sequence in a cell; and a tracr sequence. In some cases, the non-natural guide nucleic acid sequence and the tracr sequence are covalently linked.

[0590] In some cases, the tracr sequence can have a specific sequence. The tracr sequence can have at least about 80% to at least about 60-100 (e.g., at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, or at least about 90) consecutive nucleotides of a natural tracrRNA sequence. The tracr sequence can have at least about 80% sequence identity with at least about 60-100 (e.g., at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, or at least about 90) consecutive nucleotides of any one of SEQ ID NOs: 5495-5502. In some cases, the tracrRNA can be at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to at least about 60-90 (e.g., at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, or at least about 90) consecutive nucleotides of any one of SEQ ID NOs: 5495-5502. In some cases, the tracrRNA can be substantially identical to at least about 60-100 (e.g., at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, or at least about 90) consecutive nucleotides of any one of SEQ ID NOs: 5495-5502. The tracrRNA may include any one of SEQ ID NOs: 5495-5502.

[0591] In some cases, at least one engineered synthetic guide RNA (sgRNA) capable of forming a complex with an endonuclease can include a sequence having at least about 80% identity to any one of SEQ ID NOs: 5466-5467. The sgRNA can include a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 5466-5467. The sgRNA can include a sequence substantially identical to any one of SEQ ID NOs: 5466-5467.

[0592] In some cases, the above system may include two different sgRNAs that target a first region and a second region to cut in a target DNA locus, wherein the second region is located 3′ to the first region. In some cases, the above system may include a single-stranded or double-stranded DNA repair template, the template comprising from 5′ to 3′: a first homology arm comprising a sequence of at least about 20 (e.g., at least about 40, 80, 120, 150, 200, 300, 500, or 1 kb) nucleotides located 5′ to the first region, a synthetic DNA sequence of at least about 10 nucleotides; and a second homology arm comprising a sequence of at least about 20 (e.g., at least about 40, 80, 120, 150, 200, 300, 500, or 1 kb) nucleotides located 3′ to the second region.

[0593] On the other hand, the present disclosure provides a method for modifying a target nucleic acid locus of interest. The method may include delivering any non-natural system disclosed herein to the target nucleic acid locus, comprising an enzyme disclosed herein and at least one synthetic guide RNA (sgRNA). The enzyme may form a complex with at least one sgRNA, and when the complex is combined with the target nucleic acid locus of interest, the target nucleic acid locus of interest may be modified. The enzyme may be delivered to the locus and may include transfecting cells with nucleic acids of a system or coding system. The delivery of a nuclease to the locus may include electroporating cells with nucleic acids of a system or coding system. The delivery of a nuclease to the locus may include incubating the system with a nucleic acid including the locus of interest in a buffer. In some cases, the target nucleic acid locus includes deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The target nucleic acid locus may include genomic DNA, viral DNA, viral RNA, or bacterial DNA. The target nucleic acid locus may be in a cell. The target nucleic acid locus may be in vitro. The target nucleic acid locus may be in a eukaryotic cell or a prokaryotic cell. The cell may be an animal cell, a human cell, a bacterial cell, an archaeal cell, or a plant cell. The enzyme can induce single-stranded or double-stranded breaks at or near the target locus of interest.

[0594] In the case where the target nucleic acid locus can be within the cell, the enzyme can be provided as a nucleic acid containing an open reading frame, which encodes an enzyme having a RuvC_III domain, wherein the RuvC_III domain is at least about 75% (e.g., at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%) identical to any one of SEQ ID NOs: 2242-2251. The deoxyribonucleic acid (DNA) containing the open reading frame encoding the endonuclease may include a sequence substantially identical to any one of SEQ ID NOs: 5578-5580 or a variant having at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% identity to any one of SEQ ID NOs: 5578-5580. In some cases, the nucleic acid includes a promoter operably linked to the open reading frame encoding the endonuclease. The promoter may be a CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, TRE or CaMKIIa promoter. The endonuclease can be provided as a capped mRNA containing the open reading frame encoding the endonuclease. The endonuclease can be provided as a polypeptide that can be translated. The at least one engineered sgRNA can be provided as a deoxyribonucleic acid (DNA), the DNA containing a gene sequence encoding the at least one engineered sgRNA, the gene sequence being operably connected to a ribonucleic acid (RNA) pol III promoter. In some cases, the organism can be a eukaryote. In some cases, the organism can be a fungus. In some cases, the organism can be a human.

[0595] The systems disclosed herein can be used for various applications, such as nucleic acid editing (e.g., gene editing), binding to nucleic acid molecules (e.g., sequence-specific binding). Such systems can be used, for example, to address (e.g., remove or replace) genetic mutations that may cause a subject's disease, inactivate genes to determine their function in cells, as a diagnostic tool for detecting pathogenic genetic elements (e.g., by cleaving retroviral RNA or amplified DNA sequences encoding pathogenic mutations), as an inactivating enzyme combined with a probe to target and detect specific nucleotide sequences (e.g., sequences encoding bacterial antibiotic resistance), inactivate viruses or make them unable to infect host cells by targeting viral genomes, add genes or modify metabolic pathways to engineer organisms to produce valuable small molecules, macromolecules, or secondary metabolites, establish gene drive elements for evolutionary selection, and as biosensors to detect interference of foreign small molecules and nucleotides with cells.

[0596] Examples

[0597] Example 1 - Metagenomic Analysis of Novel Proteins

[0598] Metagenomic samples were collected from sediments, soils, and animals. Deoxyribonucleic acid (DNA) was extracted using the Zymobiomics DNA Miniprep Kit and analyzed at Illumina. 2500 sequencing. Samples were collected with the consent of the property owner. Additional raw sequence data from public sources include animal microbiota, sediments, soils, hot springs, deep-sea hydrothermal vents, oceans, peat bogs, permafrost, and sewage sequences. Hidden Markov Models (Hidden Markov Models) generated based on recorded Cas protein sequences containing type II Cas effector proteins were searched for metagenomic sequence data to identify new Cas effectors. The novel effector proteins identified by searching were compared with the recorded proteins to identify potential active sites. This metagenomic workflow produced a depiction of the class II, type II CRISPR nuclease family described herein.

[0599] Example 2 - (General Protocol) PAM sequence identification / confirmation of the endonucleases described herein

[0600] The PAM sequence was determined by sequencing a plasmid containing a randomly generated PAM sequence that can be cleaved by a putative endonuclease expressed in an expression system based on E. coli lysate (myTXTL, Arbor Biosciences). In this system, an E. coli codon-optimized nucleotide sequence was transcribed and translated from a PCR fragment under the control of a T7 promoter. A second PCR fragment was transcribed in the same reaction, the second PCR fragment having a tracr sequence under a T7 promoter and a minimal CRISPR array consisting of a T7 promoter, followed by a repeating spacer repeat sequence. Successful expression of the endonuclease and tracr sequence in the TXTL system, followed by CRISPR array processing, provided an active in vitro CRISPR nuclease complex.

[0601] The target plasmid library containing the spacer sequence matching the spacer sequence in the minimum array is incubated with the product of the TXTL reaction, followed by 8N mixed bases (presumed PAM sequence). After 1-3 hours, the reaction is stopped, and DNA is recovered by DNA cleaning kits such as Zymo DCC, AMPure XP beads, QiaQuick, etc. The adapter sequence is flat-ended and connected to the DNA with the active PAM sequence cut by endonuclease, and the uncut DNA cannot be close to the connection. Then, the DNA segment including the active PAM sequence is amplified by PCR with primers specific to the library and the adapter sequence. The PCR amplification product is resolved on a gel to identify the amplicon corresponding to the cutting event. The amplification segment of the cutting reaction is also used as a template for preparing an NGS library. This resulting library (a subset of the starting 8N library) is sequenced to reveal the sequence of the correct PAM containing the active CRISPR complex. For PAM testing with single RNA constructs, the same procedure was repeated except that in vitro transcribed RNA was added with the plasmid library and the tracr / minimal CRISPR array template was omitted. For endonucleases used to prepare NGS libraries, seqLogo (see, e.g., Huber et al. Nat Methods. 2015 Feb;12(2):115-21) representations were constructed. The scqLogo module used to construct these representations takes a position weight matrix of DNA sequence motifs (e.g., PAM sequences) and plots the corresponding sequence logos as described by Schneider and Stephens (see, e.g., Schneider et al. Nucleic Acids Res. 1990 Oct 25;18(20):6097-100. The letters representing the sequence in the seqLogo representation have been stacked on top of each other at each position in the sequence being compared (e.g., PAM sequence). The height of each letter is proportional to its frequency, and the letters have been ordered so that the most common letters are at the top.

[0602] Example 3 - (General approach) RNA folding of tracrRNA and sgRNA structures

[0603] The folded structure of the guide RNA sequence at 37°C was calculated using the following method: Andronescu et al. Bioinformatics. 2007 Jul 1;23(13):i19-28, which is incorporated herein by reference in its entirety.

[0604] Example 4 - (General Protocol) In vitro cleavage efficiency of MG CRISPR complex

[0605] In protease-deficient Escherichia coli B strain, endonuclease is expressed as a fusion protein of the His tag from an inducible T7 promoter. Cells expressing His-tagged proteins are lysed by ultrasonic treatment, and His-tagged proteins are purified by Ni-NTA affinity chromatography on the HisTrap FF column (General Life Sciences) on AKTA Avant FPLC (General Life Sciences). Eluent is resolved by SDS-PAGE on acrylamide gel (Bio-Rad), and stained with InstantBlue Ultrafast coomassie (Sigma-Aldrich). Densitometric determination of protein bands is used to determine purity with ImageLab software (Bio-Rad). Purified endonuclease is dialyzed into a storage buffer consisting of 50mM Tris-HCl, 300mM NaCl, 1mMTCEP, 5% glycerol; pH 7.5 and stored at -80 °C.

[0606] The target DNA containing spacer sequence and PAM sequence (for example, as determined in Example 2) is constructed by DNA synthesis. When PAM has degenerate bases, a single representative PAM is selected for testing. The target DNA includes 2200bp of linear DNA derived from plasmid by PCR amplification, wherein PAM and spacer are positioned to 700bp from one end. Successful cutting produces a fragment of 700 and 1500bp. The target DNA, the single RNA transcribed in vitro and the purified recombinant protein are combined in the cutting buffer (10mM Tris, 100mM NaCl, 10mM MgCl2) containing excessive protein and RNA, and incubated for 5 minutes to 3 hours, generally 1 hour. The reaction is stopped by adding RNase A and incubated at 60 minutes. Then the reaction is resolved on 1.2% TAE agarose gel, and the fraction of the target DNA quantitatively cut in ImageLab software.

[0607] Example 5 - (General Protocol) Testing the genome cleavage activity of the MG CRISPR complex in E. coli

[0608] E. coli lacks the ability to effectively repair double DNA breaks. Therefore, cleavage of genomic DNA can be a lethal event. Taking advantage of this phenomenon, endonuclease activity was tested in E. coli by recombinantly expressing the endonuclease and tracrRNA in a target strain that has the spacer / target and PAM sequences integrated into its genomic DNA.

[0609] In this assay, the PAM sequence is specific for the tested endonuclease determined by the method described in Example 2. The sgRNA sequence is determined based on the sequence and predicted structure of the tracrRNA. Starting from the 5' end of the repeat sequence, a repeat-anti-repeat pairing of 8-12bp (usually 10bp) is selected. The remaining 3' end of the repeat sequence and the 5' end of the tracrRNA are replaced with a tetraloop. Typically, the tetraloop is GAAA, but other tetraloops can be used, specifically if the GAAA sequence is predicted to interfere with folding. In these cases, the TTCG tetraloop is used.

[0610] Engineered strains with PAM sequences integrated into their genomic DNA were transformed with DNA encoding an endonuclease. The transformants were then chemically competent and transformed with 50 ng of a single guide RNA that was specific for the target sequence ("on target") or nonspecific for the target ("off target"). After heat shock, the transformants were recovered in SOC for 2 hours at 37°C. The nuclease efficiency was then determined by a 5-fold dilution series grown on induction medium. The dilution series was quantified in triplicate for colonies.

[0611] Example 6a - (General Protocol) Testing the genome cleavage activity of the MG CRISPR complex in mammalian cells

[0612] To show targeting and cleavage activity in mammalian cells, MG Cas effector protein sequences were tested in two mammalian expression vectors: (a) one with a C-terminal SV40 NLS and a 2A-GFP tag; and (b) one without a GFP tag and two SV40 NLS sequences, one at the N-terminus and one at the C-terminus. In some cases, the nucleotide sequence encoding the endonuclease was codon-optimized for expression in mammalian cells.

[0613] The corresponding single guide RNA sequence (sgRNA) connected to the targeting sequence is cloned into a second mammalian expression vector. The two plasmids are co-transfected into HEK293T cells. After 72 hours of co-transfection of the expression plasmid and the sgRNA targeting plasmid into HEK293T cells, DNA is extracted and used to prepare NGS libraries. The NHEJ percentage is measured by insertion and deletion in the sequencing of the target site to demonstrate the targeting efficiency of the enzyme in mammalian cells. At least 10 different target sites are selected to test the activity of each protein.

[0614] Example 6b - (General Protocol) Testing the genome cleavage activity of the MG CRISPR complex in mammalian cells

[0615] To show targeting and cleavage activity in mammalian cells, the MG Cas effector protein sequence was cloned into two mammalian expression vectors: (a) one flanked by N- and C-terminal SV40 NLS sequences, a C-terminal His tag, and a 2A-GFP tag at the C-terminus after the His tag (backbone 1); and (b) one flanked by NLS sequences and a C-terminal His tag, but without a T2A GFP tag (backbone 2). In some cases, the nucleotide sequence encoding the endonuclease is the native sequence, codon-optimized for expression in E. coli, or codon-optimized for expression in mammalian cells.

[0616] The corresponding single guide RNA sequence (sgRNA) connected to the targeting sequence is cloned into a second mammalian expression vector. The two plasmids are co-transfected into HEK293T cells. After 72 hours of co-transfection of the expression plasmid and the sgRNA targeting plasmid into HEK293T cells, DNA is extracted and used to prepare NGS libraries. The NHEJ percentage is measured by indel in the sequencing of the target site to demonstrate the targeting efficiency of the enzyme in mammalian cells. About 7-12 different target sites are selected for testing the activity of each protein. An arbitrary threshold of 5% indel is used to identify active candidates.

[0617] Example 7-Gene editing results of B2M at the DNA level

[0618] Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. MG3-6 RNPs (106 pmol protein / 160 pmol guide) (SEQ ID NOs: 6305-6386) were nucleofected into T cells (200,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared five days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (SEQ ID NOs: 6387-6468). Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Figure 1 ).

[0619] Table 1A: Guide sequences used in Example 7

[0620]

[0621]

[0622]

[0623]

[0624]

[0625]

[0626]

[0627]

[0628]

[0629]

[0630]

[0631]

[0632]

[0633]

[0634] Table 1B: Sites targeted in Example 7

[0635]

[0636]

[0637]

[0638] Example 8 - Gene editing results of mouse TRAC at the DNA level

[0639] Primary T cells were purified from the spleen of C57BL / 6 mice. MG3-6RNP (126pmol protein / 160pmol guide) (SEQ ID NO: 6469-6508) was nuclear transfected into T cells (200,000) using a Lonza 4D electroporator and 100pmol transfection enhancer (IDT). Cells were harvested and genomic DNA was prepared five days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences (SEQ ID NO: 6509-6548) for each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing (Figure 2). For analysis by flow cytometry, 3 days after nucleofection, 100,000 mouse T cells were stained with anti-mouse CD3 antibody (clone 17A2, Invitrogen 11-0032-82) for 30 minutes at 4°C and analyzed on an Attune Nxt flow cytometer.

[0640] Table 2A: Guide sequences used in Example 8

[0641]

[0642]

[0643]

[0644]

[0645]

[0646]

[0647]

[0648] Table 2B: List of sites targeted in Example 8

[0649]

[0650]

[0651] Example 9-Gene editing results of HPRT at the DNA level

[0652] Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi Biotec) according to the manufacturer's recommendations. MG3-6 RNPs (126 pmol protein / 160 pmol guide) (SEQ ID NOs: 6549-6615) were nuclear transfected into T cells (200,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared five days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (SEQ ID NOs: 6616-6682). Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Figure 3 ).

[0653] Table 3A: Guide sequences used in Example 9

[0654]

[0655]

[0656]

[0657]

[0658]

[0659]

[0660]

[0661]

[0662]

[0663]

[0664]

[0665] Table 3B: Sites targeted in Example 9

[0666]

[0667]

[0668]

[0669] Example 10 - Gene editing results of human TRBC1 / 2 at the DNA level

[0670] Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi Biotec) according to the manufacturer's recommendations. MG3-6 and MG3-8 RNPs (106 pmol protein / 160 pmol guide) (MG3-6: SEQ ID NO: 6683-6721; MG3-8: SEQ ID NO: 6761-6781) were nucleofected into T cells (200,000) using a Lonza 4D electroporator. For analysis by flow cytometry, 100,000 T cells were stained with anti-CD3 antibody at 4°C for 30 minutes 3 days after nucleofection and analyzed on an Attune Nxt flow cytometer ( Figure 4 ).

[0671] Table 4A: Guide sequences used in Example 10

[0672]

[0673]

[0674]

[0675]

[0676]

[0677]

[0678]

[0679]

[0680]

[0681]

[0682] Table 4B: Sites targeted in Example 10

[0683]

[0684]

[0685]

[0686] Example 11 - MG3-6 Guide Screening of Mouse HAO-1 Gene Using mRNA Transfection

[0687] The guide discovery algorithm that searches for appropriate PAM sequences was used to identify the guide of MG3-6 in exons 1, 2, 3, and 4 of the human HAO1 gene. A total of 19 guides were selected for evaluation in mammalian cells. 300ng mRNA and 120ng single guide RNA were transfected into Hepa1-6 cells as follows. One day before transfection, Hepa1-6 cells that had been cultured in DMEM, 10% FBS, 1xNEAA medium for less than 10 days were inoculated into 24-well plates treated with TC without Pen / step. The cells were counted and a volume equivalent to 60,000 viable cells was added to each well. Additional pre-equilibrated culture medium was added to each well to bring the total volume to 500 μL. On the day of transfection, 25 μL of OptiMEM culture medium and 1.25 μL of Liposome Messenger Max solution (Thermo Fisher) were mixed in the main mixed solution, vortexed, and allowed to stand at room temperature for at least 5 minutes. In a separate tube, 300 ng of MG3-6 mRNA and 120 ng of sgRNA were mixed with 25 μL of OptiMEM medium and vortexed briefly. An appropriate volume of MessengerMax solution was added to each RNA solution, mixed by flicking the tube, and briefly vortexed at low speed. The complete editing reagent solution was incubated at room temperature for 10 minutes and then added directly to Hepa1-6 cells. Two days after transfection, the medium was aspirated from each well of Hepa1-6 cells and transfected by vortexing with MagMAX. TM KingFisher Flex DNA Multi-Sample Ultra 2.0 Kit was used to purify genomic DNA by automated magnetic bead purification. The activities of the guides are summarized in Tables 5A and Figure 5 The primers used are summarized in Table 5B.

[0688] Table 5A: Average activity of MG3-6 guides at mouse HAO1 delivered by mRNA transfection

[0689]

[0690] Table 5B: Primers designed for the mouse HAO1 gene for PCR and Sanger sequencing at each of the first four exons

[0691]

[0692]

[0693] Example 12 - Guided chemistry optimization of MG3-6 type II nuclease (predictive)

[0694] The activity of various chemically modified guides was designed and tested. The most active guides in the mouse hepatocyte (Hepa1-6 cell)-targeted albumin intron 1 guide screening were selected as models for insertion of various chemically modified spacer sequences. The gRNA included a spacer located at the 5′, followed by a CRISPR repeat sequence and a trans-activating CRISPR RNA (tracr). The CRISPR repeat sequence and tracr were identical to those of MG3-6. The CRISPR repeat sequence and tracr formed a structured RNA including three stem-loops. Different regions of the stem-loops were modified by replacing the 2′ hydroxyl group in the ribose with a 2′-O-methyl group or replacing the phosphodiester backbone with a phosphorothioate (PS) bond. In addition, the spacer in the 5′ of the guide was modified by adding a 2′-O-methyl group, a PS bond, and a 2′-fluorine. The editing activity of guides with exactly the same base sequence but different chemical modifications was evaluated in Hepa1-6 cells by co-transfection of the mRNA encoding MG3-6 and the guide. Commercially available chemically modified guides with the same base sequence and called AltR1 / AltR2 were used as controls. The spacer sequences in these guides target a 22-nucleotide region in albumin intron 1 of the mouse genome.

[0695] To test the stability of the chemically modified guides compared to guides without chemical modification (natural RNA), stability assays were performed using crude cell extracts. Crude cell extracts from mammalian cells were selected because they contain a mixture of nucleases to which the guide RNA will be exposed when delivered to mammalian cells in vitro or in vivo. Hepa1-6 cells were collected by adding 3 ml of cold PBS to confluent cells per 15 cm culture dish and releasing cells from the surface of the culture dish using a cell scraper. The cells were precipitated at 200 g for 10 minutes and frozen at -80°C for future use. For stability assays, the cells were resuspended in 4 volumes of cold PBS (e.g., for 100 mg of precipitation, the cells were resuspended in 400 μL of cold PBS). Triton X-100 was added to a concentration of 0.2% (v / v), the cells were vortexed for 10 seconds, placed on ice for 10 minutes, and vortexed again for 10 seconds. Triton X-100 is a mild non-ionic detergent that destroys cell membranes but does not inactivate or denature proteins at the concentrations used. Stability reactions were set up on ice and included 20 μL of crude cell extract, 2 pmol of each guide (1 μL in a 2 μM stock solution). Six reactions were set up for each guide, including: input, 0.5 hour, 1 hour, 4 hours, 9 hours, and in some cases 21 hours (time in hours refers to the length of time each sample was incubated). The samples were incubated at 37°C for 0.5 hours to 21 hours, while the input control was placed on ice for 5 minutes. After each incubation period, the reaction was stopped by adding 300 μL of a mixture of phenol and guanidine thiocyanate (Tri reagent, Zymo Research), which immediately denatured all proteins and effectively inhibited ribonucleases and facilitated subsequent recovery of RNA. After adding Tri reagent, the samples were vortexed for 15 seconds and stored at -20°C. RNA was extracted from the samples using the Direct-zol RNA microprep kit (Zymo Research) and eluted in 100 μL of nuclease-free water. Modified guides were detected using Taqman RT-qPCR and Taqman miRNA assay technology (Thermo Fisher Scientific). Data were plotted as a function of the percentage of remaining sgRNA relative to the input sample.

[0696] Example 13 - Efficiency of mRNA electroporation in T cells

[0697] Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi Biotec) according to the manufacturer's recommendations. Nuclear transfection of mRNA was performed as follows: 200,000 cells were co-transfected with 500 ng of mRNA and a specified amount of guide RNA using a Lonza 4D electroporator (DS-120). Cells were harvested and genomic DNA was prepared three days after the initial transfection. For conditions marked as "+gRNA": 15 hours after the initial transfection, cells were nuclear transfected with a specified amount of additional guides. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Figure 6 ).

[0698] Example 14 - ELISA assay to assess pre-existing antibody responses

[0699] Using Expi293 TM The expression system kit (Thermo Fisher Scientific) expresses MG3-6 and MG3-8 in human HEK293 cells and purifies them therefrom. In brief, 293 cells were lipofected with a plasmid encoding a nuclease driven by a strong viral promoter. The cells were grown in suspension culture under agitation and harvested two days after transfection. The nuclease protein was fused to a Six-His affinity tag and purified to between 50-60% purity by metal affinity chromatography. Parallel lysates were prepared from cells transfected with a mock and subjected to the same metal affinity chromatography process. Cas9 was purchased from IDT and had a purity of >95%.

[0700] Will ELISA plates (Thermo Fisher Scientific) were coated with 0.5 μg of nuclease or control protein diluted in 1X phosphate buffered saline (PBS) and incubated overnight at room temperature. The plates were then washed and incubated for one hour at room temperature with 1% (w / v) bovine serum albumin (BSA) (Sigma-Aldrich) / 1X PBS solution (1% BSA-PBS). After another washing step, the wells were incubated for 1 hour at room temperature with more than 50 individual serum samples obtained from randomly selected donors (1:50 dilution in 1% BSA-PBS). The plates were then washed and incubated for one hour at room temperature with peroxidase-labeled goat anti-human (Fcγ fragment specific) secondary antibodies (Jackson Immuno Research), diluted 1:50,000 in 1% BSA-PBS. The assay was developed using the 3,3′,5,5′-tetramethylbenzidine (TMB) liquid substrate system kit (Sigma-Aldrich) according to the manufacturer's instructions. Antibody titers are reported as absorbance values ​​measured at 450 nm ( Figure 7 ). Tetanus toxoid was used as a positive control due to widespread vaccination against this antigen and was purchased from Sigma-Aldrich.

[0701] Example 15 - Gene Editing Results of TRAC in Human Peripheral Blood B Cells at the DNA and Cell Surface Protein Levels

[0702] Human peripheral blood B cells were purchased from STEMCELL Technologies and cultured using ImmunoCult TM Human B cell expansion kit was used for 2 days. MG3-6 RNP (106 pmol protein / 160 pmol guide) was nuclear transfected into B cells (200,000) using a Lonza 4D electroporator. After nuclear transfection, cells were immediately restored to culture medium containing AAV-6 from Virovek (Virovek). Cells were harvested and genomic DNA was prepared five days after transfection. For NGS analysis, the target sequence of the TRAC 6 guide RNA (SEQ ID NO: 6804) was amplified using PCR primers suitable for NGS-based DNA sequencing. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing. For analysis by flow cytometry, antibodies against viability, B cell surface marker CD19 (CD19 monoclonal antibody (HIB19), APC, eBioscience TM) expression and transgene (SEQ ID NO: 6810) insertion, 100,000 cells were stained, as determined by tLNGFR (CD271 (LNGFR) antibody, anti-human, REAfinity TM ) expression. Cells were stained for 30 min at 4°C and data acquired on an Attune Nxt flow cytometer. Cells expressing tLNGFR were gated on single live CD19+ cells ( Figure 8 ).

[0703] Table 6: Guide sequences used in Example 15

[0704]

[0705] Example 16 - Gene Editing Results of TRAC and AAVS1 at the DNA Level in Hematopoietic Stem Cells (HSCs)

[0706] Activated peripheral blood CD34+ cells were obtained from AllCells and supplemented with StemSpan prior to nucleofection. TM CC110 Cytokine Cocktail for StemSpan TM Cultured in SFEM II medium for 48 hours. MG3-6 RNP (standard dose of 106pmol protein / 120pmol guide, half dose of 52pmol protein / 60pmol guide) was nuclear transfected into HSC (200,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared three days after transfection. PCR primers suitable for Sanger- and NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (SEQ ID NO: 6804, 6806, and 6808). NGS amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing. ICE amplicons were sent to Elim Biopharmaceuticals Inc. for Sanger sequencing and analyzed with a proprietary Python script to measure gene editing ( Fig. 9 ).

[0707] Table 7: Guide sequences used in Example 16

[0708]

[0709]

[0710] Example 17 - Gene Editing Results of TRAC at the DNA and Cell Surface Protein Levels in MG3-6 Induced Pluripotent Stem Cells (iPSCs) Delivered as Ribonucleoprotein

[0711] Prior to nuclear transfection, ATCC-BXS0116 human [non-Hispanic female Caucasian] induced pluripotent stem (IPS) cells were cultured on Corning Matrigel-coated plasticware for 24 hours in mTESR Plus medium (Stem Cell Technology) containing 10 μM ROCK inhibitor Y-27632. MG3-6RNP (106pmol protein / 120pmol guide) was nuclear transfected into iPSCs (200,000) using a Lonza 4D electroporator. Cells were harvested with Accutase five days after transfection for flow cytometry and genomic DNA extraction. A separate target sequence (SEQ ID NO: 6804) for TRAC 6gRNA was amplified using PCR primers suitable for NGS-based DNA sequencing. The amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing. For analysis by flow cytometry, 5 days after nucleofection, cells were plated with LIVE / DEAD TM Fixable Near IR Dead Cell Stain Kit and CD271 (LNGFR) Antibody, Anti-Human, REAfinity TM 100,000 iPSCs per sample were stained to measure viability and transgene (SEQ ID NO: 6810) insertion, respectively. Cells were fixed and permeabilized (in-house staining kit, Miltenyi Biotec) and further stained for pluripotency transcription factors Oct4 and Sox2 (anti-Oct3 / 4 isoform A-APC, human and mouse REA3381; anti-Sox2-FITC, human and mouse REA320). Cells were acquired on an Attune NxT flow cytometer and tLNGFR expression was analyzed based on gating on single live Oct4+Sox2+ cells ( Fig.10 ).

[0712] Table 8: Guide sequences used in Example 17

[0713]

[0714] Example 18 - Gene Editing Results of TRAC at the DNA-Protein Level in MG3-6 Induced Pluripotent Stem Cells (iPSCs) Delivered as mRNA

[0715] ATCC-BXS0116 human [non-Hispanic female Caucasian] induced pluripotent stem (IPS) cells were cultured on Corning Matrigel-coated plasticware for 24 hours in mTESR Plus (Stem Cell Technologies) containing 10 μM ROCK inhibitor Y-27632. MG3-6 RNPs (106 pmol protein / 120 pmol guide) or mRNA (250 or 500 ng mRNA / 12 pmol guide) were nuclear transfected into iPSCs (200,000) using a Lonza 4D electroporator. Cells were harvested with Akuzyme five days after transfection for genomic DNA extraction. A separate target sequence for TRAC 6gRNA (SEQ ID NO: 6804) was amplified using PCR primers suitable for NGS-based DNA sequencing. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig.11 ).

[0716] Table 9: Guide sequences used in Example 18

[0717]

[0718] Example 19-Gene editing results of CD2 at the DNA level

[0719] Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi Biotec) according to the manufacturer's recommendations. MG3-6 RNPs (106 pmol protein / 160 pmol guide) were nuclear transfected into T cells (200,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared five days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig.12 ).

[0720] Table 10A: Guide sequences used in Example 19

[0721]

[0722]

[0723]

[0724]

[0725]

[0726]

[0727]

[0728] Table 10B: Sites targeted in Example 19

[0729]

[0730]

[0731] Example 20-Gene editing results of CD5 at the DNA level

[0732] Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi Biotec) according to the manufacturer's recommendations. MG3-6 RNPs (106 pmol protein / 160 pmol guide) were nuclear transfected into T cells (200,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared five days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig.13 ).

[0733] Table 11A: Guide sequences used in Example 20

[0734]

[0735]

[0736]

[0737]

[0738]

[0739]

[0740]

[0741]

[0742]

[0743]

[0744] Table 11B: Sites targeted in Example 20

[0745]

[0746]

[0747]

[0748] Example 21 - Targeted RNA cleavage of MG3-6 and MG3-8

[0749] According to the manufacturer's instructions, a 101nt RNA containing a spacer (GGUCAGGGCGCGUCAGCGGGUGUUGGCGGGUGUCGGGGCUGGCUUAAAUUUUGGACCAGUCGAGGCUUGCGACGUGGUGGCUUUUCCAGUCGGGAAACCUG) was prepared using a T7 Megascript kit (NEB) by transcribing a PCR product containing a T7 promoter, wherein the spacer has a 5' adjacent sequence UUGGACCA. The resulting RNA was purified using a Monarch RNA preparative spin column (NEB) and then labeled with a 5'EndTag kit (Vector labs) using FAM-maleimide dye according to the recommended instructions. The resulting RNA has a 5' tag, and if cleavage is performed at a single position of the spacer, the expected band size is 60nt. To test RNA cleavage, 2pmol of protein and sgRNA were pre-incubated for 15 minutes before adding the ssRNA target. The RNP complex was added to the labeled RNA in cleavage buffer (10 mM Tris, 100 mM NaCl, and 10 mM MgCl2) at a ratio of 10:1 (200 nM RNA: 2 μM RNP) and incubated at 37°C for 1 hour. The reaction was quenched with proteinase K and resolved on a 15% TBE urea-PAGE gel (Bio-Rad). The gel shows site-directed RNA cleavage of MG3-6 and MG3-8 and the commercial positive control SauCas9 (NEB) ( Fig.14 ). The results showed that MG3-6 and MG3-8 were able to target RNA cleavage and were comparable to SauCas9 in RNA cleavage.

[0750] Example 22-Gene editing results of FAS at the DNA level

[0751] Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi Biotec) according to the manufacturer's recommendations. MG3-6 RNPs (104 pmol protein / 120 pmol guide) (SEQ ID NO: 7023-7056) were nuclear transfected into T cells (200,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared three days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (SEQ ID NO: 7057-7090). Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig.15 ).

[0752] Table 12: Guide RNA and sequences targeting Example 22

[0753]

[0754]

[0755]

[0756]

[0757]

[0758]

[0759]

[0760] Example 23-Results of gene editing of PD-1 at the DNA level

[0761] Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi Biotec) according to the manufacturer's recommendations. MG3-6RNP (104 pmol protein / 120 pmol guide) (SEQ ID NO: 7091-7128) was nuclear transfected into T cells (200,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared three days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (SEQ ID NO: 7129-7166). Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig.16 ).

[0762] Table 13: Guide RNA and sequences targeting Example 23

[0763]

[0764]

[0765]

[0766]

[0767]

[0768]

[0769]

[0770] Example 24-Gene editing results of hRosa26 at the DNA level

[0771] Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi Biotec) according to the manufacturer's recommendations. MG3-6 RNPs (104 pmol protein / 120 pmol guide) (SEQ ID NOs: 7167-7198) were nuclear transfected into T cells (200,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared three days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (SEQ ID NOs: 7199-7230). Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig.17 ).

[0772] Table 14: Guide RNA and sequences targeting Example 24

[0773]

[0774]

[0775]

[0776]

[0777]

[0778]

[0779] Example 25-Gene editing results of TRAC and AAVS1 at the DNA level in K562 cells

[0780] MG21-1, MG23-1, MG73-1, MG89-2, and MG71-2 mRNAs were nuclear transfected into K562 cells (200,000) using a Lonza 4D electroporator along with matching guide RNAs (500 ng mRNA / 150 pmol guide). Cells were harvested and genomic DNA was prepared three days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig.18 ).

[0781] Table 15: Guide RNA and sequences targeting Example 25 when targeting TRAC

[0782]

[0783]

[0784]

[0785]

[0786] Table 16: Guide RNA and sequences targeting Example 25 when targeting AAVS1

[0787]

[0788]

[0789] Example 26 - Screening of the human HAO-1 gene using MG3-6 nuclease guide using mRNA transfection of Hep3B cells

[0790] Guide RNAs targeting MG3-6 nucleases from exons 1 to 4 of the human HAO-1 gene (encoding glycolate oxidase) were identified in silico by searching for the PAM sequence 5′NNRGRYY 3′. A total of 21 guides with minimal predicted off-target sites in the human genome were chemically synthesized as single guide RNAs with AltR1 / AltR2 end modifications (IDT Corporation). The full sequences of sgRNAs are SEQ ID NOs: 11352-11372.

[0791] Table 17: Guide sequences used in Example 26

[0792]

[0793]

[0794]

[0795] Hep3B transfection protocol

[0796] mRNA encoding MG3-6 was generated by T7 polymerase in vitro transcription from a plasmid into which the coding sequence for MG3-6 had been cloned. The MG3-6 coding sequence was codon optimized using a human codon usage table and flanked by nuclear localization signals derived from SV40 (at the N-terminus) and from nucleoplasmin (at the C-terminus). In addition, a 5' untranslated region (5'UTR) was included at the 5' end of the coding sequence to improve translation. A 3'UTR was included in the mRNA at the 3' end of the coding sequence (encoded in the plasmid) followed by an approximately 90 to 110 nucleotide polyA track to improve mRNA stability in vivo. The DNA sequence encoding the MG3-6 mRNA without the polyA tail is shown in SEQ ID 22. The in vitro transcription reaction contained a clean Capping reagent (Trilink BioTechnologies) and using MEGAClear TM The resulting RNA was purified using the Transcription Clean Up Kit (Invitrogen) and assessed for purity using the TapeStation (Agilent) and found to consist of >90% full-length RNA.

[0797] 300ng MG3-6 mRNA and 120ng of each single guide RNA were transfected into Hep3B cells as follows. One day before transfection, Hep3B cells that had been cultured in EMEM-10% FBS-2mM glutamine-1% NEAA medium for less than 10 days were seeded into TC-treated 24-well plates without Pen / step. The cells were counted and a volume equivalent to 60,000 viable cells was added to each well. Additional pre-equilibrated medium was added to each well to bring the total volume to 500μL. On the day of transfection, 25μL of OptiMEM medium and 1.25μL of liposome messenger Max solution (Thermo Fisher Scientific) were mixed in the master mix, vortexed, and allowed to stand at room temperature for at least 5 minutes. In a separate tube, 300ng of MG3-6 / 3-4mRNA and 120ng of sgRNA were mixed with 25μL of OptiMEM medium and vortexed briefly. An appropriate volume of MessengerMax solution was added to each RNA solution, mixed by flicking the tube, and briefly spun at low speed. The complete editing reagent solution was incubated at room temperature for 10 minutes and then added directly to the Hep3B cells. Two days after transfection, the medium was aspirated from each well of Hep3B cells and the cells were transfected with MagMAX. TMGenomic DNA was purified using automated magnetic bead purification on a KingFisherFlex robot using the DNA Multi-Sample Ultra 2.0 Kit.

[0798] PCR amplification and editing analysis by Sanger sequencing

[0799] HAO-1 gene sequences targeted by different sgRNAs were amplified by PCR from purified genomic DNA using exon-specific primers in Table 18 and Phusion Fast High-Fidelity PCR Master Mix (Thermo Fisher Scientific).

[0800] Table 18: Primers designed for the human HAO1 gene for PCR and Sanger sequencing at each of the first four exons.

[0801]

[0802] The PCR product was purified and concentrated using DNA Clean and Concentrator 5 (Zymo Research), and 40 ng of the PCR product was subjected to Sanger sequencing (Elion Biosciences).

[0803] Sanger sequencing chromatograms were analyzed for indels at the predicted target sites of each sgRNA by an algorithm called Tracking Insertions and Deletions by Decomposition (INDEL) (TIDE) as described by Brinkman et al. (Nucleic Acids Res. 2014 Dec 16;42(22):e168. Published online Oct 9, 2014. doi:10.1093 / nar / gku936). Based on this screening guide, hH364-1, 14, and 15 were identified as having the highest editing activity in Hep3B cells ( Fig.19 and Table 19).

[0804] Table 19: Editing activity of MG3-6 guides at human HAO1 delivered by mRNA transfection

[0805]

[0806] Example 27 - Gene editing results of human GPR146 at the DNA level

[0807] MG3-6RNP (104pmol protein / 120pmol guide) (SEQ ID NO: 11374-11405) was nucleofected into Hep3B cells (100,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared three days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (SEQ ID NO: 11406-11437). Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig. 20 ).

[0808] Table 20: Guide RNA and sequences targeting Example 25 when targeting GPR146

[0809]

[0810]

[0811]

[0812]

[0813]

[0814]

[0815] Example 28 - Gene editing results of mouse GPR146 at the DNA level in Hepa1-6 cells

[0816] MG3-6 RNP (104 pmol protein / 120 pmol guide) (SEQ ID NO: 11438-11472) was nucleofected into Hepa1-6 cells (100,000) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared five days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (SEQ ID NO: 11473-11507). Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig.21 ).

[0817] Table 21: Guide RNA and sequences targeting Example 25 when targeting GPR146

[0818]

[0819]

[0820]

[0821]

[0822]

[0823]

[0824]

[0825] Example 29 - Gene editing results of mouse GPR146 at the DNA level in primary mouse hepatocytes

[0826] Using the guide RNAs described in Example 28 above, MG3-6 mRNA and guides (0.42ug mRNA, 1:20 nuclease:guide molar ratio) were lipofected with Messenger Max in primary mouse hepatocytes (1E5 viable cells / guide). Cells were harvested and genomic DNA was prepared three days after transfection. PCR primers suitable for NGS-based DNA sequencing were used to amplify the individual target sequences for each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing ( Fig. 22 ). The results showed that GPR146-H2 sgRNA was very effective for editing in mouse hepatocytes.

[0827] Example 30-Gene editing results of TRAC and AAVS1 at the DNA level in K562 cells

[0828] MG14-241 and MG99-1 mRNAs were nuclear transfected into 200,000 human lymphoblastoid cells (K562 cells) along with matching guide RNAs (500 ng mRNA / 150 pmol guide) using a Lonza 4D electroporator. Cells were harvested and genomic DNA was prepared three days after transfection. PCR primers suitable for NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing. ( Fig.23 ).

[0829] Table 22: Guide RNA and sequences targeting Example 30

[0830]

[0831] Example 31 - Novel type II CRISPR effectors are active nucleases with diverse PAM requirements

[0832] Based on phylogenetic analysis, novel nucleases of the MG3, MG15, MG150, MG123, MG124, and MG125 families were identified. The MG150 nuclease family is more closely related to the MG3 family than to any other identified family ( Fig.24 ), and a new set of distinct effectors expands the MG15 nuclease family ( Fig.25 In vitro cleavage activity assays showed that the nucleases reported here generally preferentially cleave at the third or fourth position of the PAM ( Table 23 ). In addition, the PAM sequence determination of type II nucleases indicates multiple PAM requirements, as shown in the SeqLogo image from NGS data. ( Figure 26-35 )

[0833] Table 23: Cleavage sites of MG family variants

[0834]

[0835]

[0836]

[0837]

[0838] Example

[0839] The following examples are illustrative in nature and are not intended to be limiting in any way:

[0840] 1. A method of editing a B2M locus in a cell, the method comprising contacting the cell with:

[0841] (a) RNA-guided endonucleases; and

[0842] (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the B2M locus,

[0843] wherein the region of the B2M locus comprises a targeting sequence that is at least 85% identical to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6387-6468.

[0844] 2. The method of embodiment 1, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

[0845] 3. The method of embodiment 1, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244.

[0846] 4. The method of embodiment 3, wherein the RNA-guided endonuclease further comprises an HNH domain.

[0847] 5. The method of embodiment 1, wherein the engineered guide RNA comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 6305-6386.

[0848] 6. A method according to embodiment 1, wherein the region of the B2M locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6388, 6399, 6401, 6403, 6410, 6413, 6421, 6446 and 6448.

[0849] 7. A method of editing a TRAC locus in a cell, the method comprising contacting the cell with:

[0850] (a) RNA-guided endonucleases; and

[0851] (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus,

[0852] wherein the region of the TRAC locus comprises a targeting sequence that is at least 85% identical to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6509-6548.

[0853] 8. The method of embodiment 7, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

[0854] 9. The method of embodiment 7, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244.

[0855] 10. The method of embodiment 9, wherein the RNA-guided endonuclease further comprises a HNH domain.

[0856] 11. The method of embodiment 7, wherein the engineered guide RNA comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 6469-6508.

[0857] 12. The method of embodiment 7, wherein the region of the TRAC locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6517, 6520 and 6523.

[0858] 13. A method of editing a HPRT locus in a cell, the method comprising contacting the cell with:

[0859] (a) RNA-guided endonucleases; and

[0860] (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the HPRT locus,

[0861] wherein the region of the HPRT locus comprises a targeting sequence that is at least 85% identical to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6616-6682.

[0862] 14. The method of embodiment 13, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

[0863] 15. The method of embodiment 13, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244.

[0864] 16. The method of embodiment 15, wherein the RNA-guided endonuclease further comprises a HNH domain.

[0865] 17. The method of embodiment 13, wherein the engineered guide RNA comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 6549-6615.

[0866] 18. The method of embodiment 13, wherein the region of the HPRT locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6619, 6634, 6673, 6675 and 6679.

[0867] 19. A method of editing the TRBC1 / 2 locus in a cell, the method comprising contacting the cell with:

[0868] (a) RNA-guided endonucleases; and

[0869] (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRBC1 / 2 locus,

[0870] wherein the region of the TRBC1 / 2 locus comprises a targeting sequence that is at least 85% identical to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6722-6760 or 6782-6802.

[0871] 20. The method of embodiment 19, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

[0872] 21. The method of embodiment 19, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244.

[0873] 22. The method of embodiment 21, wherein the RNA-guided endonuclease further comprises a HNH domain.

[0874] 23. The method of embodiment 19, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6683-6721 and 6761-6781.

[0875] 24. A method according to embodiment 19, wherein the region of the TRBC1 / 2 locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6734, 6753, 6790 and 6800.

[0876] 25. A method of editing the HAO1 locus in a cell, the method comprising contacting the cell with:

[0877] (a) RNA-guided endonucleases; and

[0878] (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the HAO1 locus,

[0879] wherein the region of the HAO1 locus comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 11802-11820.

[0880] 26. A method according to embodiment 25, wherein the RNA-guided nuclease is a Class 2 Type II Cas nuclease.

[0881] 27. The method of embodiment 25, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242.

[0882] 28. The method of embodiment 27, wherein the RNA-guided endonuclease further comprises a HNH domain.

[0883] 29. The method of embodiment 25, wherein the region of the HAO1 locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 11806, 11813, 11816, and 11819.

[0884] 30. The method of embodiment 1, wherein the RNA-guided endonuclease is a Cas endonuclease.

[0885] 31. The method of embodiment 2, wherein the 2 Class II type Cas endonucleases comprise an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431.

[0886] 32. The method of any one of embodiments 1-4, 30-31, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421.

[0887] 33. The method of any one of embodiments 1 to 4, 30 to 32, wherein the engineered guide RNA comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 6305-6386.

[0888] 34. The method of any one of embodiments 1 to 4, 30 to 32, wherein the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6306, 6317, 6319, 6321, 6328, 6331, 6339, 6364, and 6366.

[0889] 35. The method of embodiment 7, wherein the RNA-guided endonuclease is a Cas endonuclease.

[0890] 36. The method of embodiment 8, wherein the 2 Class II type Cas endonucleases comprise an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431.

[0891] 37. The method of any one of embodiments 7-10, 35-36, wherein said RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421.

[0892] 38. The method of any one of embodiments 7 to 10, 35 to 37, wherein the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6477, 6480, and 6483.

[0893] 39. The method of embodiment 13, wherein the RNA-guided endonuclease is a Cas endonuclease.

[0894] 40. The method of embodiment 14, wherein the 2 Class II type Cas endonucleases comprise an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431.

[0895] 41. The method of any one of embodiments 13-16, 39-40, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421 or SEQ ID NO: 423.

[0896] 42. The method of any one of embodiments 13 to 16, 39 to 40, wherein the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6552, 6567, 6606, 6608, and 6612.

[0897] 43. A method according to embodiment 19, wherein the RNA-guided nuclease is a Cas nuclease.

[0898] 44. A method according to embodiment 20, wherein the 2 Class II type Cas endonucleases include endonucleases having at least 75% sequence identity with any one of SEQ ID NOs: 421-431.

[0899] 45. The method of any one of embodiments 19-22, 43-44, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421 or SEQ ID NO: 423.

[0900] 46. ​​A method according to any one of embodiments 19 to 22, 43 to 45, wherein the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6695, 6714, 6769 and 6779.

[0901] 47. The method of embodiment 25, wherein the RNA-guided endonuclease is a Cas endonuclease.

[0902] 48. A method according to embodiment 26, wherein the 2 Class II type Cas endonucleases include endonucleases having at least 75% sequence identity with any one of SEQ ID NOs: 421-431.

[0903] 49. The method of any one of embodiments 25-28, 47-48, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421.

[0904] 50. The method of any one of embodiments 1-24, 30-46, wherein the cells are peripheral blood mononuclear cells (PBMC).

[0905] 51. A method according to any one of embodiments 1 to 24, 30 to 46, wherein the cell is a T cell or a precursor thereof or a hematopoietic stem cell (HSC).

[0906] Although preferred embodiments of the present invention have been shown and described herein, it is obvious to those skilled in the art that such embodiments are provided by way of example only. The present invention is not intended to be limited by the specific embodiments provided in the specification. Although the present invention has been described with reference to the foregoing description, the description and illustration of the embodiments herein are not intended to be carried out in a restrictive sense. Without departing from the present invention, those skilled in the art will now be aware of many variations, changes and substitutes. In addition, it should be understood that all aspects of the present invention are not limited to the specific description, configuration or relative proportions set forth herein, which depend on various conditions and variables. It should be understood that each alternative of the embodiments of the present invention described herein can be used to practice the present invention. Therefore, it is considered that the present invention should also cover any such alternatives, modifications, variations or equivalents. The appended claims are intended to define the scope of the present invention, and thus cover methods and structures within the scope of these claims and their equivalents.

[0907]

[0908]

[0909]

[0910]

[0911]

[0912]

[0913]

[0914]

[0915]

[0916]

[0917]

[0918]

[0919]

[0920]

[0921]

[0922]

[0923]

[0924]

[0925]

[0926]

[0927]

[0928]

[0929]

[0930]

[0931]

[0932]

[0933]

[0934]

[0935]

[0936]

[0937]

[0938]

[0939]

[0940]

[0941]

[0942]

[0943]

[0944]

[0945]

[0946]

[0947]

[0948]

[0949]

[0950]

[0951]

[0952]

[0953]

[0954]

[0955]

[0956]

[0957]

[0958]

[0959]

[0960]

[0961]

[0962]

[0963]

[0964]

[0965]

[0966]

Claims

1. A method of disrupting a beta-2-microglobulin (B2M) locus in a cell, the method comprising contacting the cell with: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the B2M locus, wherein the region of the B2M locus comprises a targeting sequence that is at least 85% identical to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6387-6468.

2. The method of claim 1, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

3. The method of claim 1, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244.

4. The method of claim 3, wherein the RNA-guided endonuclease further comprises a HNH domain.

5. The method of claim 1, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6305-6386.

6. The method of claim 1, wherein the region of the B2M locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6388, 6399, 6401, 6403, 6410, 6413, 6421, 6446 and 6448.

7. A method of disrupting a T cell receptor alpha constant (TRAC) locus in a cell, the method comprising contacting the cell with: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus, wherein the region of the TRAC locus comprises a targeting sequence that is at least 85% identical to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6509-6548 or 6805.

8. The method of claim 7, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

9. The method of claim 7, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244.

10. The method of claim 9, wherein the RNA-guided endonuclease further comprises a HNH domain.

11. The method of claim 7, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6469-6508 or 6804.

12. The method of claim 7, wherein the region of the TRAC locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6517, 6520 and 6523.

13. A method of disrupting a hypoxanthine phosphoribosyltransferase 1 (HPRT) locus in a cell, the method comprising contacting the cell with: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the HPRT locus, wherein the region of the HPRT locus comprises a targeting sequence that is at least 85% identical to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6616-6682.

14. The method of claim 13, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

15. The method of claim 13, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244.

16. The method of claim 15, wherein the RNA-guided endonuclease further comprises a HNH domain.

17. The method of claim 13, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6549-6615.

18. The method of any one of claims 13, wherein the region of the HPRT locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6619, 6634, 6673, 6675 and 6679.

19. A method of disrupting a T cell receptor beta constant 1 or T cell receptor beta constant 2 (TRBC1 / 2) locus in a cell, the method comprising contacting the cell with: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRBC1 / 2 locus, wherein the region of the TRBC1 / 2 locus comprises a targeting sequence that is at least 85% identical to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6722-6760 or 6782-6802.

20. The method of claim 19, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

21. The method of claim 19, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244.

22. The method of claim 21, wherein the RNA-guided endonuclease further comprises a HNH domain.

23. The method of claim 19, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6683-6721 and 6761-6781.

24. The method of claim 19, wherein the region of the TRBC1 / 2 locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 6734, 6753, 6790 and 6800.

25. A method of disrupting a hydroxy acid oxidase 1 (HAO1) ​​locus in a cell, the method comprising contacting the cell with: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the HAO1 locus, wherein the region of the HAO1 locus comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 11802-11820.

26. The method of claim 25, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

27. The method of claim 25, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242.

28. The method of claim 27, wherein the RNA-guided endonuclease further comprises a HNH domain.

29. The method of claim 25, wherein the region of the HAO1 locus comprises a sequence that is at least 75%, 80% or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 11806, 11813, 11816 and 11819.

30. An engineered nuclease system comprising: (a) RNA-guided endonucleases; as well as (b) an engineered guide RNA, wherein the engineered guide RNA comprises: (i) 2′-O-methyl nucleotides; (ii) 2′-fluoro nucleotides; or (iii) phosphorothioate bonds; wherein the RNA-guided endonuclease has at least 75% sequence identity to any one of SEQ ID NOs: 421-431 or a variant thereof.

31. The engineered nuclease system of claim 30, wherein the RNA-guided endonuclease comprises a sequence having at least 75% sequence identity to SEQ ID NO:

421.

32. An engineered nuclease system comprising: (a) an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431 or a variant thereof; (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid sequence, Wherein the system has reduced immunogenicity when administered to a human subject compared to an equivalent system comprising a Cas9 enzyme.

33. The system of claim 32, wherein the Cas9 enzyme is a SpCas9 enzyme.

34. The system of claim 32 or 33, wherein the immunogenicity is antibody immunogenicity.

35. The system of any one of claims 32 to 34, wherein the engineered guide RNA comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 5466-5467 and 11160-11162.

36. The system of any one of claims 32 to 35, wherein the engineered nuclease has at least about 75% sequence identity, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NO: 421 or 423, or a variant thereof.

37. A method of disrupting a locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease or a nucleic acid encoding the RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the RNA-guided endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the locus; The cells are peripheral blood mononuclear cells (PBMC), hematopoietic stem cells (HSC) or induced pluripotent stem cells (iPSC).

38. The method of claim 37, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

39. The method of claim 37 or 38, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or a variant thereof.

40. The method of any one of claims 37 to 39, wherein the RNA-guided endonuclease further comprises a HNH domain.

41. The method of any one of claims 37 to 40, wherein the RNA-guided endonuclease has at least about 75% sequence identity, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 421 or a variant thereof.

42. The method of any one of claims 37 to 41, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6804, 6806, and 6808.

43. The method of any one of claims 37 to 42, wherein the nucleic acid encoding the RNA-guided endonuclease comprises a sequence comprising at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 6803 or a variant thereof.

44. A method according to any one of claims 37 to 43, wherein the region of the locus comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to at least 18 nucleotides of any one of SEQ ID NOs: 6805, 6807 and 6809.

45. A method of disrupting a CD2 molecule (CD2) locus in a cell, the method comprising contacting the cell with: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the CD2 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6853-6894, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 6811-6852.

46. ​​The method of claim 45, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

47. The method of claim 45 or 46, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244 or a variant thereof.

48. The method of any one of claims 45 to 47, wherein the RNA-guided endonuclease further comprises a HNH domain.

49. The method of any one of claims 45 to 48, wherein the RNA-guided endonuclease comprises a sequence having at least about 75% sequence identity to any one of SEQ ID NOs: 421-431.

50. The method of any one of claims 45 to 49, wherein the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 421 or a variant thereof.

51. The method of any one of claims 45 to 50, wherein the engineered guide RNA comprises a sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the non-degenerate nucleotides of any one of SEQ ID NOs: 6813, 6841, 6843-6847, 6852, or 6852.

52. The method of claim 51, wherein the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 6A.

53. The method of any one of claims 45 to 52, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6855, 6883, 6885-6889, 6892, or 6984, or is configured to hybridize to said sequence.

54. An isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6811-6852.

55. The isolated RNA molecule of claim 54, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 6A.

56. A method of disrupting a CD5 molecule (CD5) locus in a cell, the method comprising contacting the cell with: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the CD5 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6959-7022, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 5466 or 6895-6958.

57. The method of claim 56, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

58. The method of claim 56 or 57, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244 or a variant thereof.

59. The method of any one of claims 56 to 58, wherein the RNA-guided endonuclease further comprises a HNH domain.

60. The method of any one of claims 56 to 59, wherein the RNA-guided endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431 or a variant thereof.

61. The method of any one of claims 56 to 60, wherein the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:

421.

62. The method of any one of claims 56 to 61, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466.

63. The method of any one of claims 56 to 62, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 6897, 6904, 6906, 6911, 6928, 6930, 6932, 6934, 6938, 6945, 6950, 6952, and 6958.

64. The method of claim 63, wherein the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 7A.

65. The method of any one of claims 56 to 64, wherein the engineered guide RNA is configured to hybridize to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6961, 6968, 6970, 6975, 6992, 6994, 6996, 6998, 7002, 7009, 7014, 7016, and 7022.

66. An isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 6895-6958.

67. The isolated RNA molecule of claim 66, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 7A.

68. A method of disrupting an RNA locus in a cell, the method comprising contacting the cell with: (a) an RNA-guided endonuclease comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244 or a variant thereof; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the RNA locus, wherein the RNA locus does not include bacterial or microbial RNA.

69. The method of claim 68, wherein the guide RNA comprises a sequence having at least 80% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466 or SEQ ID NO: 5539.

70. A method for disrupting a Fas cell surface death receptor (FAS) locus in a cell, the method comprising introducing into the cell: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of a human FAS locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7057-7090, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7023-7056.

71. The method of claim 70, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

72. The method of claim 70 or 71, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or a variant thereof.

73. The method of any one of claims 70 to 72, wherein the RNA-guided endonuclease further comprises a HNH domain.

74. The method of any one of claims 70 to 73, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466.

75. The method of any one of claims 70 to 74, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 7059, 7061, 7069, 7070, 7076, 7080, 7083, 7084, 7085, or 7088 or is configured to hybridize to said sequence.

76. The method of any one of claims 70 to 75, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421 or a variant thereof.

77. The method of any one of claims 70 to 76, wherein the guide RNA comprises a sequence at least 80% identical to any one of SEQ ID NOs: 7025, 7027, 7035, 7036, 7042, 7046, 7049-7051 or 7054.

78. The method of claim 77, wherein the guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 8.

79. An isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 7023-7056.

80. The isolated RNA molecule of claim 79, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 8.

81. A method of disrupting a programmed cell death 1 (PD-1) locus in a cell, the method comprising introducing into the cell: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of a human PD-1 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7129-7166, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7091-7128.

82. The method of claim 81, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

83. The method of claim 81 or 82, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or a variant thereof.

84. The method of any one of claims 81 to 83, wherein the RNA-guided endonuclease further comprises a HNH domain.

85. The method of any one of claims 81 to 84, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466.

86. The method of any one of claims 81 to 85, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 7135, 7137, 7146, 7149, 7152, 7156, 7160, 7161, 7164, 7165, or 7166 or is configured to hybridize to said sequence.

87. The method of any one of claims 81 to 86, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421 or a variant thereof.

88. The method of any one of claims 81 to 87, wherein the guide RNA comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 7097, 7099, 7108, 7111, 7114, 7118, 7122, 7123, 7126, 7127, or 7128.

89. The method of claim 88, wherein the guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 9.

90. An isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7091-7128.

91. The isolated RNA molecule of claim 79, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 9.

92. A method for disrupting the human Rosa26 (hRosa26) locus in a cell, the method comprising introducing into the cell: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the hRosa26 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7199-7230, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7167-7198.

93. The method of claim 92, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

94. The method of claim 92 or 93, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or a variant thereof.

95. The method of any one of claims 92 to 94, wherein the RNA-guided endonuclease further comprises a HNH domain.

96. The method of any one of claims 92 to 95, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466.

97. The method of any one of claims 92 to 96, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 7205-7206, 7215, 7220, 7223, or 7225 or is configured to hybridize to said sequence.

98. The method of any one of claims 92 to 97, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421 or a variant thereof.

99. The method of any one of claims 92 to 98, wherein the guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 7173, 7174, 7183, 7188, 7191 or 7193.

100. The method of claim 99, wherein the guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 10.

101. An isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 7167-7198.

102. The isolated RNA molecule of claim 101, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 10.

103. A method of disrupting a T cell receptor alpha constant (TRAC) locus in a cell, the method comprising introducing into the cell: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7235-7238, 7248-7256, 7270, or 7278-7284, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 7231-7234, 7239-7247, 7269 or 7271-7277.

104. The method of claim 103, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

105. The method of any one of claims 103 to 104, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 1512, 1756, 11711-11713 or a variant thereof.

106. The method of any one of claims 103 to 105, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5473, 5475, 11145, 11714, or 11715.

107. The method of any one of claims 103 to 106, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 7235-7238, 7248-7256, 7270, or 7278-7284 or is configured to hybridize to said sequence.

108. The method of any one of claims 103 to 107, wherein the guide RNA comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 7231-7234, 7239-7244, 7269, or 7271-7277.

109. The method of claim 108, wherein the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 11.

110. An isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 7231-7234, 7239-7247, 7269 or 7271-7277.

111. The isolated RNA molecule of claim 110, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 11.

112. A method of disrupting an adeno-associated virus integration site 1 (AAVS1) locus in a cell, the method comprising introducing into the cell: (a) 2 class II type Cas endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the AAVS1 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7261-7264 or 7267-7268, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 7257-7260 or 7265-7266.

113. The method of claim 112, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

114. The method of any one of claims 112 to 113, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 1756 or 11711 or a variant thereof.

115. The method of any one of claims 112 to 114, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5475 or 11715.

116. The method of any one of claims 112 to 115, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 7261-7263 or 7267-7268 or is configured to hybridize to said sequence.

117. The method of any one of claims 112 to 116, wherein the guide RNA comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 7257-7260 or 7265-7266.

118. The method of claim 117, wherein the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 12.

119. An isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 7257-7260 or 7265-7266.

120. The isolated RNA molecule of claim 119, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 12.

121. A method for disrupting a hydroxy acid oxidase 1 (HAO-1) locus in a cell, the method comprising introducing into the cell: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the HAO-1 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 11773-11793, or is configured to hybridize to the complementary sequence.

122. The method of claim 121, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

123. The method of claim 121 or 122, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or a variant thereof.

124. The method of any one of claims 121 to 123, wherein the RNA-guided endonuclease further comprises a HNH domain.

125. The method of any one of claims 121 to 124, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466.

126. The method of any one of claims 121 to 125, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 11773, 11780, 11786, or 11787 or is configured to hybridize to said sequence.

127. The method of any one of claims 121 to 126, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421 or a variant thereof.

128. An isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11773-11793; and A scaffold sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:5466.

129. A method for disrupting a human G protein coupled receptor 146 (GPR146) locus in a cell, the method comprising introducing into the cell: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the GPR146 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11406-11437, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 11374-11405.

130. The method of claim 129, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

131. The method of claim 129 or 130, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or a variant thereof.

132. The method of any one of claims 129 to 131, wherein the RNA-guided endonuclease further comprises a HNH domain.

133. The method of any one of claims 129 to 132, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466.

134. The method of any one of claims 129 to 133, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of SEQ ID NO: 11425 or is configured to hybridize to said sequence.

135. The method of any one of claims 129 to 134, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421 or a variant thereof.

136. The method of any one of claims 129 to 135, wherein the guide RNA comprises a sequence at least 80% identical to SEQ ID NO: 11393.

137. The method of claims 129 to 136, wherein the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 15.

138. An isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 11374-11405.

139. The isolated RNA molecule of claim 138, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 15.

140. A method for disrupting a mouse G protein coupled receptor 146 (GPR146) locus in a cell, the method comprising introducing into the cell: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the GPR146 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11473-11507, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 11438-11472.

141. The method of claim 140, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

142. The method of claim 140 or 141, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or a variant thereof.

143. The method of any one of claims 140 to 142, wherein the RNA-guided endonuclease further comprises a HNH domain.

144. The method of any one of claims 140 to 143, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466.

145. The method of any one of claims 140 to 144, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 11482, 11488, or 11490 or is configured to hybridize to said sequence.

146. The method of any one of claims 140 to 145, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 421 or a variant thereof.

147. The method of any one of claims 140 to 146, wherein the guide RNA comprises a sequence that is at least 80% identical to SEQ ID NO: 11447, 11453 or 11455.

148. The method of claims 140 to 147, wherein the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 16.

149. An isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 11438-11472.

150. The isolated RNA molecule of claim 149, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 16.

151. A method of disrupting a T cell receptor alpha constant (TRAC) locus in a cell, the method comprising introducing into the cell: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11516-11517, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 11514-11515.

152. The method of claim 151, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

153. The method of any one of claims 151 to 152, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 11153.

154. The method of any one of claims 151 to 153, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 11516 or is configured to hybridize to said sequence.

155. The method of any one of claims 151 to 154, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 11716 or a variant thereof.

156. The method of any one of claims 151 to 155, wherein the guide RNA comprises a sequence that is at least 80% identical to SEQ ID NO: 11514.

157. The method of claim 156, wherein the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 17.

158. An isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 11514-11515.

159. The isolated RNA molecule of claim 158, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 17.

160. A method of disrupting an adeno-associated virus integration site 1 (AAVS1) locus in a cell, the method comprising introducing into the cell: (a) RNA-guided endonucleases; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the AAVS1 locus, wherein the engineered guide RNA comprises a sequence of at least 18-22 consecutive nucleotides that is complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11511-11513, or is configured to hybridize to the complementary sequence; or wherein the engineered guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 11508-11510.

161. The method of claim 160, wherein the RNA-guided endonuclease is a Class 2, Type II Cas endonuclease.

162. The method of any one of claims 160 to 161, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 11717.

163. The method of any one of claims 160 to 162, wherein the engineered guide RNA comprises a sequence having at least 80% identity to at least 18 consecutive nucleotides of SEQ ID NO: 11511 or is configured to hybridize to said sequence.

164. The method of any one of claims 160 to 163, wherein the RNA-guided endonuclease comprises a sequence at least 75%, 80% or 90% identical to SEQ ID NO: 914 or a variant thereof.

165. The method of any one of claims 160 to 164, wherein the guide RNA comprises a sequence that is at least 80% identical to SEQ ID NO: 11508.

166. The method of claim 165, wherein the engineered guide RNA further comprises a nucleotide modification pattern as described in any of the guide RNAs described in Table 17.

167. An isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 11508-11510.

168. The isolated RNA molecule of claim 167, further comprising a nucleotide modification pattern as described in any of the guide RNAs described in Table 17.

169. An engineered nuclease system comprising: (a) an endonuclease having at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the PI domain of any of the Cas effector protein sequences described herein, or a variant thereof; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid sequence, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any of the sgRNA sequences described herein.

170. The engineered nuclease system of claim 169, further comprising a RuvCIII domain or HNH domain having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a RuvCIII domain or HNH domain of any of the Cas effector nucleases described herein.

171. The engineered nuclease system of claim 169 or 170, wherein the endonuclease is configured to be selective for any of the PAM sequences described herein.

172. The engineered nuclease system of any one of claims 169 to 171, wherein the endonuclease further comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any of the Cas effector sequences described herein.

173. Use of the method of any one of claims 1 to 6 for disrupting the B2M locus in a cell.

174. Use of a method according to any one of claims 7 to 12, 103 to 109 or 151 to 157 or a RNA according to any one of claims 110 to 111 or 158 to 159 for disrupting a TRAC locus in a cell.

175. Use of the method of any one of claims 13 to 18 for disrupting the HPRT locus in a cell.

176. Use of the method of any one of claims 19 to 24 for disrupting the TRBC1 / 2 locus in a cell.

177. Use of a method according to any one of claims 25 to 29 or 121 to 127 or a RNA according to any one of claims 128 to 129 for disrupting the HAO-1 locus in a cell.

178. A method according to any one of claims 45 to 53 or use of the RNA according to any one of claims 54 to 55 for disrupting the CD2 locus in a cell.

179. A method according to any one of claims 56 to 65 or use of the RNA according to any one of claims 66 to 67 for disrupting the CD5 locus in a cell.

180. Use of a method according to any one of claims 70 to 78 or a RNA according to any one of claims 79 to 80 for disrupting a FAS locus in a cell.

181. A method according to any one of claims 81 to 89 or use of the RNA according to any one of claims 90 to 91 for disrupting the PD-1 locus in a cell.

182. Use of the method of any one of claims 92 to 100 or the RNA of any one of claims 101 to 102 for disrupting the hRosa26 locus in a cell.

183. Use of a method according to any one of claims 112 to 118 or 160 to 166 or an RNA according to any one of claims 119 to 120 or 167 to 168 for disrupting the AAVS1 locus in a cell.

184. A method according to any one of claims 129 to 137 or 140 to 148 or use of the RNA according to any one of claims 138 to 139 or 149 to 150 for disrupting the GPR146 locus in a cell.

Images