Application of C1Q and / or subunit thereof as target spot in prevention and treatment of psoriasis

Abstract

The invention discloses application of C1Q and / or a subunit thereof as a target spot in prevention and treatment of psoriasis. The expression of C1QA / B / C genes in mononuclear / macrophages in psoriasis skin lesion is enhanced, the content of C1Q subunit protein in serum of a psoriasis patient is remarkably different before and after treatment, and the expression level of the C1Q subunit protein in the serum of the psoriasis patient is remarkably reduced after treatment; besides, the knockout of the C1Q gene can effectively reduce the expression of psoriasis-related inflammatory factors such as IFN-gamma and TNF in the C1Q gene knockout mononuclear cells, which indicates that the immune response and inflammation level of psoriasis patients can be adjusted by inhibiting the expression or function of C1Q, and an effective prevention and treatment effect on psoriasis can be achieved. Therefore, C1Q can be used as a psoriasis biological treatment target to be applied to preparation of drugs for preventing and treating psoriasis.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine and relates to the application of C1Q and / or its subunits as targets in preventing and treating psoriasis. Background Art

[0002] Biological target therapy for psoriasis is a treatment method that targets certain cytokines or receptors in the body, regulates the immune system, inhibits inflammatory responses, and thus improves skin lesions. The development of biological target therapy for psoriasis has gone through several stages, from the earliest TNF-α class, to IL-17 class, to IL-12 / 23 class and IL-23p19 class, the therapeutic targets have gradually moved closer to the upstream links of the disease, improving the effectiveness of the treatment.

[0003] The existing technologies for biological target treatment of psoriasis mainly include the following:

[0004] TNF-α: including etanercept, infliximab, adalimumab, etc. This type of biological agent neutralizes or blocks the proinflammatory cytokine TNF-α, reduces the infiltration and activation of inflammatory cells, and improves skin and joint lesions. The advantage of this type of biological agent is that it takes effect quickly and is suitable for psoriasis and psoriasis arthritis. It can also be used to treat other inflammatory diseases, such as inflammatory bowel disease and rheumatoid arthritis. The disadvantage of this type of biological agent is that it may increase the risk of infection, tumors, cardiovascular disease, etc., and requires regular monitoring of blood, liver function, tuberculin test and other indicators. There are also certain drug resistance and tolerance issues.

[0005] IL-17 class: including ixekizumab, secukinumab, etc. This type of biological agent targets the proinflammatory cytokine IL-17A, inhibits its binding to the receptor, blocks the inflammatory signaling pathway mediated by it, and improves skin and joint lesions. The advantages of this type of biological agent are high efficacy and rapid onset of action. It is suitable for psoriasis and psoriasis arthritis, and can also be used to treat spinal arthritis. The disadvantage of this type of biological agent is that it may increase the risk of infection, tumors, inflammatory bowel disease, etc., and requires regular monitoring of blood, liver function, tuberculin test and other indicators. There are also certain drug resistance and tolerance issues.

[0006] IL-12 / 23: including ustekinumab. This type of biological agent inhibits the differentiation and activation of Th1 and Th17 cells by targeting the IL-12 / 23p40 subunit, reduces the levels of pro-inflammatory cytokines such as IL-17 and IL-22, and reduces inflammation of the skin and joints. The advantage of this type of biological agent is good efficacy. It is suitable for psoriasis and psoriasis arthritis, and can also be used to treat Crohn's disease. The disadvantage of this type of biological agent is that it may increase the risk of infection, tumors, cardiovascular disease, etc., and requires regular monitoring of blood, liver function, tuberculin test and other indicators. There are also certain drug resistance and tolerance issues.

[0007] IL-23p19: including guselkumab, risankizumab, tildrakizumab, etc. This type of biological agent inhibits the synthesis and release of IL-23 by targeting the IL-23p19 subunit, thereby reducing the differentiation and activation of Th17 cells, reducing the levels of proinflammatory cytokines such as IL-17 and IL-22, and reducing inflammation of the skin and joints. The advantages of this type of biological agent are high efficacy, rapid onset of action, and long dosing interval. It is suitable for psoriasis and arthritis-type psoriasis. The disadvantage of this type of biological agent is that it may increase the risk of infection, tumors, inflammatory bowel disease, etc., and requires regular monitoring of blood, liver function, tuberculin test and other indicators. There are also certain drug resistance and tolerance issues.

[0008] Different patients may have very different responses and tolerances to biologics. Some patients may be insensitive or intolerant to certain biologics, resulting in poor treatment effects or adverse reactions. Therefore, the selection of biologics should be individually evaluated and adjusted based on the patient's condition, constitution, immune status, genotype, drug metabolism and other factors.

[0009] In addition, long-term or repeated use of biologics may lead to the production of anti-drug antibodies (ADA) in patients, which can neutralize or remove biologics, reduce their concentration and activity in the blood, and thus weaken or eliminate their therapeutic effects. The occurrence of drug resistance is related to factors such as the type, dose, dosing interval, and combined use of biologics. It is generally believed that humanized or fully humanized biologics are less likely to produce drug resistance than mouse-derived or chimeric biologics.

[0010] In conclusion, biological target therapy for psoriasis is an effective treatment, but it also has some defects, shortcomings and deficiencies. The development of new biological targets for psoriasis treatment will help overcome the limitations and deficiencies of existing treatments, reduce the risks and burden of treatment, increase the options and flexibility of treatment, and improve the continuity and stability of treatment.

[0011] C1Q is composed of three subunits (C1QA, C1QB, and C1QC), each with 6 monomers, forming a flower-like structure. The molecular weight of C1Q is approximately 410 kDa, of which C1QA, C1QB, and C1QC have molecular weights of 25 kDa, 23 kDa, and 23 kDa, respectively. C1Q is a complex glycoprotein composed of 18 polypeptide chains, with a C-terminal globular head region that can recognize various molecular structures and an N-terminal collagen-like tail that can mediate immune effector mechanisms. C1Q was originally discovered as part of C1, the initial component of the classical complement pathway, but recent studies have shown that C1Q can regulate a variety of cellular processes regardless of complement activation. C1Q can mediate a variety of immunomodulatory functions, such as enhancing phagocytosis, regulating cytokine production by antigen-presenting cells, and altering the maturation of T lymphocytes. Summary of the invention

[0012] The purpose of the present invention is to provide a new biological therapeutic target for psoriasis, specifically, to provide the use of C1Q and / or its subunits as targets in the prevention and treatment of psoriasis.

[0013] In the multi-omics study of biological samples of psoriasis patients, the present invention found that C1Q plays an important role in the pathogenesis of psoriasis, the number of macrophages in psoriasis lesions increases, the C1QA / B / C gene expression in monocytes / macrophages is enhanced, and there is a significant difference in the content of C1Q subunit protein in the serum of psoriasis patients before and after treatment. After treatment, the expression level of C1Q subunit protein in the serum of psoriasis patients decreases significantly. The above results indicate that C1Q protein and / or its subunits play an important role in the pathogenesis of psoriasis and are potential biological therapeutic targets for the treatment of psoriasis.

[0014] Furthermore, the present invention uses CRISPR / Cas9 gene editing technology to knock out the C1Q gene of monocytes, the precursors of human macrophages, and proves that the knockout of the C1Q gene can effectively reduce the expression of psoriasis-related inflammatory factors such as IFN-gamma and TNF in monocytes with C1Q gene knockout, indicating that by inhibiting the expression or function of C1Q protein, the immune response and inflammation level of psoriasis patients can be regulated, and psoriasis can be effectively prevented and treated. Therefore, C1Q can be used as a biological treatment target for psoriasis in the preparation of drugs for the prevention and treatment of psoriasis.

[0015] According to one aspect of the present invention, there is provided use of a product for inhibiting the expression of C1Q and / or its subunits in the preparation of a medicament for preventing and treating psoriasis.

[0016] In some embodiments, the C1Q subunit may be selected from at least one of C1QA, C1QB, and C1QC.

[0017] In some embodiments, the product that inhibits the expression of C1Q and / or its subunits comprises a product that inhibits the expression, transcription or translation of C1Q and / or its subunits at the gene level and / or protein level. Specifically, the product that inhibits the expression of C1Q and / or its subunits can be selected from at least one of (1) to (4):

[0018] (1) Antibodies against C1Q and / or its subunits;

[0019] (2) siRNA, dsRNA, miRNA or shRNA of C1Q and / or its subunits;

[0020] (3) compounds that inhibit the expression of C1Q and / or its subunits;

[0021] (4) Traditional Chinese medicine, Chinese herbal medicine or Chinese herbal medicine extract that inhibits the expression of C1Q and / or its subunits.

[0022] C1Q can promote the development of psoriasis through monocyte / macrophage-mediated inflammatory response. Therefore, it can be used as a new biological therapeutic target for psoriasis to prepare drugs for the prevention and treatment of psoriasis. These drugs can inhibit the activation and secretion of macrophages, thereby reducing skin inflammation and hyperkeratosis and improving the clinical symptoms of psoriasis.

[0023] In addition, biological therapeutic target drugs for psoriasis based on C1Q and / or its subunits are psoriasis drugs targeting the monocyte / macrophage system, and have the following advantages: (1) The monocyte / macrophage system plays an important role in the pathogenesis of psoriasis. They can secrete a variety of proinflammatory cytokines and activate T cells by presenting antigens; (2) Targeted therapy for the monocyte / macrophage system can inhibit the activation and secretion of T cells, thereby reducing skin inflammation and hyperkeratosis and improving the clinical symptoms of psoriasis; (3) Targeted therapy for the monocyte / macrophage system can act on multiple cytokines and signaling pathways at the same time, have a broader anti-inflammatory effect, and can also be used in combination with other biological agents to improve efficacy; (4) Targeted therapy for the monocyte / macrophage system has good safety and tolerability, and does not increase the risk of infection, tumors or other serious adverse events. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a UMAP visualization of monocytes and macrophages in skin samples from psoriasis lesional and non-lesional areas, where the cell labels are cell annotations based on the MoMac-VERSE system;

[0025] Figure 2 It is the number of different cell types in the skin samples of psoriasis lesional area and non-lesional area, L is lesional area, and NL is non-lesional area;

[0026] Figure 3 The expression of C1QA / B / C genes in different cell types in skin samples from psoriasis lesional and non-lesional areas;

[0027] Figure 4 is the difference in expression of C1Q subunit in psoriasis serum samples before and after treatment, * is P<0.05; Figure 4 A is the difference in C1QA protein in psoriasis serum samples detected by mass spectrometry before and after treatment in patients (including the topical sequential treatment group and the topical sequential combined with traditional Chinese medicine treatment group). Figure 4 B is the difference in C1QC protein in psoriasis serum samples detected by chip before and after treatment in patients (local sequential combined with traditional Chinese medicine treatment group). Figure 4 C is the difference in C1QC protein in psoriasis serum samples detected by chip before and after treatment in patients (local sequential treatment group);

[0028] Figure 5 By ClonePlus TM The sequencing results of C1Q gene knockout monocytes were obtained by separating and culturing single cells for monoclonal isolation using the technology;

[0029] Figure 6 This is the expansion and culture effect of C1Q gene knockout monocytes (100 times microscope);

[0030] Figure 7 This is the expression of inflammatory factors IFN-gamma and TNF in monocytes with C1Q gene knockout. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below in conjunction with the embodiments. The examples are only for explanation and are not intended to limit the present invention in any way. Unless otherwise specified, the raw materials and reagents used in the examples are conventional products that can be obtained commercially; the experimental methods in the examples where specific conditions are not specified are usually carried out according to conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0032] Example 1 C1Q and its subunits are highly expressed in immune cells of psoriasis lesional tissues

[0033] 1. Experimental methods and process

[0034] (1) Sample collection and processing

[0035] After obtaining the approval of the ethics committee, the present invention collects skin biopsy samples from the lesion area and non-lesion area of ​​the leg of psoriasis patients. The non-lesion area is selected at least 2 cm away from the lesion area. After collecting fresh skin samples, the hair and subcutaneous fat tissue are removed, and the skin samples are cut into skin fragments, and then incubated at 37°C for 2 hours in 5mL RPMI containing 0.25mg / mL ribase and 1mg / mL DNase. In the last 15 minutes of the incubation period, 1mL of PBS containing 0.25% Trypsin-1 and 0.53mM EDTA is added to the suspension. 5mL of 5% FACS buffer pre-cooled at 4°C is added to terminate the digestion. The cells are repeatedly blown with a 10mL syringe to dissociate the cells, and a cell suspension is obtained after final dissociation, and then the CD45 positive cells are filtered, counted and sorted.

[0036] (2) Sorting CD45 positive cells

[0037] Every 10 7 The skin cell suspension was resuspended in 100 μL of flow buffer and then transferred to a polypropylene FACS tube (BD Falcon, 352063). 7 Each cell was stained with 5 μL CD45APC-H7 antibody (clone 2D1) and incubated at 4°C in the dark for 30 minutes. After staining, the cells were diluted and washed with running buffer and centrifuged at 500×g for 5 minutes. The cells were resuspended in 20×10 6 The cells were added to 1 mL of sorting buffer containing 3 μM DAPI, filtered through a 100 μm cell strainer, and then sorted using a BD FACSAriaⅡ sorter with a 100 μm fluid nozzle.

[0038] (3) CD45-positive cells were analyzed by single-cell RNA sequencing (scRNA-seq).

[0039] Single-cell libraries were generated using the Chromium controller and the Single Cell 5' Library with Gel Beads Kit (10× Genomics, 1000006). Cell suspensions were loaded onto the Chromium Single Cell Controller (10× Genomics) and single-cell gel beads were generated in emulsion following the manufacturer's protocol. Up to 10,000 cells were loaded per channel, and the estimated number of recovered target cells was approximately 6,000. Captured cells were lysed and the released RNA was barcoded in individual GEMs by reverse transcription.

[0040] Reverse transcription was performed on a S1000TM Touch Thermal Cycler (Bio Rad) at 53°C for 45 min, then 85°C for 5 min, and incubation at 4°C. cDNA was generated and amplified, and quality assessed using an Agilent 4200. Sequencing-ready libraries were sequenced using the Illumina Novaseq 6000 platform and a 150-bp paired-end (PE150) configuration, with a sequencing depth of at least 100,000 reads per cell.

[0041] The scRNA-seq data were preprocessed using Cell Ranger (v5.0.1). All transcriptome samples were aligned with the human reference genome assembly refdata-gex-GRCh38-2020-A. The expression data were loaded into R (v4.0.3) and further analyzed using the Seurat package (v4.3.0). Cells with fewer than 200 genes, or a mitochondrial gene ratio of more than 5% in PBMCs data, or more than 20% in tissue data were considered abnormal cells and filtered out. Gene counts were log-transformed and scaled. PCA was used for dimensionality reduction. The Leiden algorithm was used for cluster analysis of skin cells. Cell annotation was based on the MoMac-VERSE system ( Figure 1 ).

[0042] 2. Experimental results

[0043] After the above experimental steps and data processing, the results are as follows Figure 2 shown. Figure 2 The results showed that there was a type of C1QA / B / C strongly expressed in the immune cells of psoriasis lesions annotated by MoMac-VERSE. hi Macrophages (C1QMacrophage-16) were expressed in the non-lesional skin samples.

[0044] In addition, the expression of C1QA / B / C genes in various myeloid cell subsets was detected by single-cell transcriptome sequencing. Figure 3 All of these genes were upregulated in monocyte-derived macrophages in psoriatic lesions, consistent with the cell annotation results above: All C1Q hi All macrophages are derived from monocytes in psoriatic lesions.

[0045] Example 2 There is a significant difference in the levels of C1Q and / or its subunits in the serum of psoriasis patients before and after treatment

[0046] 1. Experimental methods and process

[0047] In a clinical trial on psoriasis (ChiCTR-TRC-13003233), eligible patients with psoriasis received topical sequential treatment or topical sequential combined with Chinese medicine treatment.

[0048] The medication regimen of the local sequential treatment group: use calcipotriol-betamethasone ointment once a day for the first 4 weeks (the dosage is determined according to the skin lesions, and the total amount used per week is not more than 100 grams), and then use calcipotriol ointment once a day for the next 8 weeks (the dosage is determined according to the skin lesions, and the total amount used per week is not more than 100 grams), for a total of 12 weeks.

[0049] The medication regimen for the topical sequential combined with traditional Chinese medicine treatment group: Calcipotriol betamethasone ointment was used once a day for the first 4 weeks (the dosage was determined according to the skin lesions, and the total amount used per week was no more than 100 grams), and then calcipotriol ointment was used once a day for the next 8 weeks (the dosage was determined according to the skin lesions, and the total amount used per week was no more than 100 grams). During this period, the traditional Chinese medicine compound Yinxieling Optimized Formula (PSORI-CM02) was taken twice a day for a total of 12 weeks.

[0050] According to the treatment plan, the patient diary is used to remind the patient to take the medicine and record it. The specific amount of ointment distributed depends on the area of ​​the rash, and each fingertip ointment is distributed to 2 palm areas. Then, serum samples are collected before and within one week after treatment. All samples use the same standard operating procedures. After the patient's blood is drawn, the serum is separated by low-speed centrifugation as soon as possible. All serum samples are divided into small portions after processing and stored in a refrigerator at minus 80 degrees Celsius.

[0051] (1) Measurement of psoriasis serum proteome using antibody microarray

[0052] All serum proteins were labeled with biotin. Briefly, 10 μL serum was diluted with 90 μL PBS (pH 7.4), and then 1 μL NHS-PEG4-biotin (20 g / L DMSO) (Thermo Fisher Scientific, MA, USA) was added. After incubation for 1 hour at room temperature, the excess biotin molecules were removed by centrifugation at 1000 g for 2 minutes using a Bio-Spin column. The collected biotinylated proteins were dissolved in 500 μL PBST (PBS containing 0.05% Tween 20, w / v) containing 5% milk (w / v) and stored at 4°C.

[0053] The antibody microarrays were loaded into incubation plates (PEPperPRINT, Heidelberg, Germany) and blocked with 500 μL of PBST containing 5% milk (w / v) for 1 h at room temperature. After removing the milk, the arrays were incubated with pre-labeled serum proteins for 1 h at room temperature. The sections were washed three times with PBST for 10 min each. For detection, the arrays were incubated with 2 μg / mL streptavidin-PE at room temperature in the dark for 1 h and then rinsed three times with PBST. The slides were washed with ddH 2 O rinse three times, 5 minutes each time. After drying, the slides were scanned using a GenePix 4000A microarray scanner (Molecular Devices, CA, USA). GenePixPro image analysis software (Molecular Devices, CA, USA) was used to analyze the fluorescence images and extract the signal intensity.

[0054] (2) Mass spectrometry DIA-MS technology was used to measure the psoriasis serum proteome.

[0055] 2 μL of serum sample was diluted with lysis buffer containing 6 M urea (Sigma, USA). Then, the serum sample was reduced with 10 mM dithiothreitol (DTT) at 37°C for 60 minutes and then alkylated with 500 mM iodoacetamide (IAA) at room temperature in the dark for 45 minutes. The proteins were digested with trypsin at 37°C for 16 hours. The peptides after trypsin digestion were acidified with 1% trifluoroacetic acid and desalted using a C18 desalting column according to the manufacturer's method. The desalted peptides were dried under vacuum and dissolved in 20 μL of buffer containing 0.1% formic acid and 2% acetonitrile. The concentration of the peptides was measured by Nanoscan (nalytik Jena AG, Jena, Germany). An analytical column (150 μm × 250 mm, 2 μm C18 particles) were subjected to a 30-minute liquid phase gradient separation of 1.5 μg of peptides and then injected into a QE-HF mass spectrometer (Q Exactive HF Hybrid Quadrupole OrbitrapTM, Thermo Fisher). The DIA acquisition protocol included 45 fixed windows from 350 to 1500 m / z. The resolution distributions for MS1 and MS2 were 60,000 and 30,000, respectively. Spectronaut Pulsar X 12.0 (Biognosys, Schlieren, Switzerland) was used for identification and quantification. Finally, the FDR of peptides and the FDR of proteins were set to 1% (FDR).

[0056] 2. Experimental results

[0057] like Figure 4 As shown, Figure 4 The results show that:

[0058] (1) Mass spectrometry showed significant differences in CIQA protein in psoriasis serum samples before and after treatment in patients (including the topical sequential treatment group and the topical sequential combined with traditional Chinese medicine treatment group). After treatment, C1QA protein decreased significantly ( Figure 4 A).

[0059] (2) The CIQC protein detected by the chip in the psoriasis serum samples showed significant differences in patients in different treatment groups before and after treatment. After treatment, the C1QC protein decreased significantly ( Figure 4 B and Figure 4 C).

[0060] These results suggest that C1Q protein plays an important role in the pathogenesis of psoriasis and is a potential effective target for the treatment of psoriasis. C1Q protein is part of the complement system and is involved in immune responses and inflammatory processes. Psoriasis is a chronic inflammatory skin disease associated with abnormal activation of the immune system. After treatment, the decrease in C1Q protein may reflect an improvement in the balance of the immune system in patients with psoriasis, thereby reducing skin inflammation and lesions. Therefore, C1Q protein can be used as a biomarker for the treatment of psoriasis, or as a potential target for drug intervention to regulate the immune response and inflammation levels in patients with psoriasis by inhibiting the expression or function of C1Q protein.

[0061] Example 3 Knockout of the C1Q gene in monocytes, precursors of macrophages, to verify the use of C1Q as a biological therapeutic target for psoriasis

[0062] Since there are no commercial C1Q inhibitors and antagonists at home and abroad, the present invention chooses to knock out the C1Q gene of monocytes, the precursors of macrophages, to verify the use of C1Q as a biological treatment target for psoriasis.

[0063] By entrusting Suzhou Haixing Biotechnology Co., Ltd. (hereinafter referred to as "Haixing Bio Company"), based on the principle of CRISPR / Cas9 gene editing technology, the C1Q gene of the human macrophage precursor monocyte THP-1 was knocked out by electroporation to construct a monoclonal C1Q gene knocked-out THP-1; at the same time, under the same experimental conditions, a vector without any target gene was transfected into THP-1 to construct control cells. The C1Q gene knocked-out THP-1 and control cells constructed by Haixing Bio were amplified and cultured, and then the cells were taken for RNA-seq to detect the expression of inflammatory factors IFN-gamma and TNF in monocytes with C1Q gene knocked-out.

[0064] The relevant steps are briefly described as follows:

[0065] (1) Based on the gene sequence of human C1QA / B / C gene (Gene Bank ID: NM_015991 / NM_001371184 / NM_001114101), a specific sgRNA that can effectively recognize the full-length C1QA / B / C gene was designed and screened, and its nucleotide sequence is shown below:

[0066] sgRNA1(5'to 3'):GGTATCAGTTGTGTGTCTAG GGG .

[0067] sgRNA2(5'to 3'):ACGATGCGCCCTCTCCCAGG AGG .

[0068] Among them, the line marks the PAM area.

[0069] (2) Synthesize sgRNA, take 1.1 μL of Cas9 nuclease (HyCyte TM Starfish Cas9 nuclease Multi-NLS, S. pyogenes; Catalog No.: GUCN-R003; Product concentration: 20 μM), 1 μL of sgRNA1 (10 pmol / μL), 1 μL of sgRNA2 (10 pmol / μL), and add buffer to 15 μL, mix well and incubate at 26°C for 10 minutes; then mix the mixture with human macrophage precursor monocytes THP-1 for electroporation.

[0070] (3) Based on ClonePlus from Starfish Biotechnology TM The technology uses the limiting dilution method to screen monoclonal cell lines. The edited cell population was re-digested with 0.25% Trypsin, and the cell concentration was adjusted to 5 cells / mL with serum-containing cell culture medium, and plated into a 96-well plate with a volume of 100 μL per well. The 96-well plate was placed in a CO 2 After about 7 days of incubation in an incubator, monoclonal formation can be seen under a 4X microscope. Select the wells with only one monoclonal cell group and remove the rest of the wells with multiple clones or no cells. Continue to culture until a certain number of cell groups are formed, digest the cells, and transfer them to a 24-well plate for expanded culture.

[0071] (4) Monoclonal cells were taken to extract DNA, and primers were designed for PCR identification. Specifically, three sets of primers were designed to perform PCR amplification on the following three regions: sgRNA1 cleavage site (Region 1), sgRNA2 cleavage site (Region 2), and knockout region (Region 3). The specific sequences of the primers are shown in Table 1.

[0072] Table 1 Primer sequences

[0073]

[0074] The PCR amplification products were subjected to gel electrophoresis. The electrophoresis results showed that no bands could be amplified in Region 1 and Region 2, while a band smaller than the wild type was amplified in Region 3. The corresponding PCR amplification products were sequenced and identified.

[0075] The sequencing results were compared with the wild-type sequence. If the comparison results showed a frameshift, it indicated that the cell had been knocked out at the genomic level, and THP-1 with C1Q gene knockout was successfully constructed.

[0076] like Figure 5 As shown, after the sequencing results were compared with Snapgene software, CRISPR / Cas9 gene editing caused frameshifts and ORF changes in the C1Q exon region, confirming that the cell line was a successfully knocked-out monoclonal cell line.

[0077] (5) Under the same experimental conditions, a vector without any target gene was transfected into THP-1 to construct control cells.

[0078] (6) The C1Q gene knockout THP-1 cells and control cells successfully constructed by Haixing Biotechnology Company were cultured and expanded. The results of the culture of the C1Q gene knockout THP-1 cells were as follows: Figure 6 As shown. Figure 6 As shown in the figure of the expansion and culture results of the C1Q gene knocked-out monocytes, it can be seen that the monoclonal cell line with successful knockout was successfully expanded and can be used for subsequent experiments.

[0079] (7) RNA-seq sequencing was performed on C1Q gene knockout THP-1 cells and control cells to confirm the expression differences of psoriasis-related inflammatory factors IFN-gamma and TNF between the two groups of cells. Figure 7 shown.

[0080] Figure 7 The results showed that knocking out the C1Q gene in monocytes, the precursors of human macrophages, could effectively reduce the expression of psoriasis-related inflammatory factors such as IFN-gamma and TNF in the monoclonal cells, indicating that by inhibiting the expression or function of the C1Q gene / protein, the immune response and inflammatory level of psoriasis patients can be regulated, and psoriasis can be effectively prevented and treated. Therefore, C1Q can be used as a biological treatment target for psoriasis to prepare drugs for the prevention and treatment of psoriasis.

[0081] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the creative concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. Use of a product that inhibits the expression of C1Q and / or its subunits in the preparation of a drug for preventing and treating psoriasis.

2. The use according to claim 1, characterized in that: The C1Q subunit is selected from at least one of C1QA, C1QB and C1QC.

3. The use according to claim 1 or 2, characterized in that: The product that inhibits the expression of C1Q and / or its subunits includes products that inhibit the expression, transcription or translation of C1Q and / or its subunits at the gene level and / or protein level.

4. The use according to claim 3, characterized in that: The product that inhibits the expression of C1Q and / or its subunits is an antibody against C1Q and / or its subunits.

5. The use according to claim 3, characterized in that: The product for inhibiting the expression of C1Q and / or its subunits is selected from: siRNA, dsRNA, miRNA or shRNA of C1Q and / or its subunits.

6. The use according to claim 3, characterized in that: The product for inhibiting the expression of C1Q and / or its subunits is a compound that inhibits the expression of C1Q and / or its subunits.

7. The use according to claim 3, characterized in that: The product for inhibiting the expression of C1Q and / or its subunits is selected from: Chinese patent medicine, Chinese herbal medicine or Chinese herbal medicine extract that inhibits the expression of C1Q and / or its subunits.

Images