Dark septate endophytic fungus strain and application thereof

Abstract

The invention discloses a dark-color isolated endophytic fungus strain and application thereof, the strain is a dark-color isolated endophytic fungus strain YMF1.068, the preservation name is dark-color isolated endophytic fungus (Paraphoma vinacea), the strain is preserved in China General Microbiological Culture Collection Center (CGMCC), the address of the preservation unit is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No.689. The preservation date is May 20, 2024; the preservation number is CGMCC (China General Microbiological Culture Collection Center) The strain can effectively prevent and treat root knot nematode disease, has high lethal activity, enhances plant resistance, is safe to human and livestock, and has no residue. The microbial agent prepared by utilizing the strain shows the control effect of 68% or above when being applied to tomatoes, cucumbers and tobaccos, the effect of the microbial agent is equivalent to that of a chemical pesticide, and the potential and market prospect of the microbial agent as a biological pesticide are shown.

Description

Technical Field

[0001] The invention relates to the technical field of microbial pesticides, and in particular to a dark-colored septate endophytic fungus strain and application thereof. Background Art

[0002] Plant parasitic nematodes cause $157 billion in losses to crops worldwide each year (Abad et al., 2008), and have become the second largest plant disease after fungal diseases; about 50% of the losses caused by plant parasitic nematodes are caused by root-knot nematodes (Kim et al., 2016). Meloidogyne has been reported to have 103 species (Sun et al., 2024). Root-knot nematodes can parasitize almost all flowering plants, including all cultivated crops (Yimer et al., 2023), especially Solanaceae, Cucurbitaceae, Poaceae, Cruciferae, Leguminosae, Apiaceae, Liliaceae and precious Chinese medicinal materials, causing crop yields to decrease by more than 20%, and even to cease production in severe cases. In addition, wounds formed by root-knot nematode infection cause infection by other soil-borne pathogens, forming root-knot nematode complex diseases, further aggravating the damage to plants (Wagner et al., 2022).

[0003] The use of chemical pesticides is the main measure to control root-knot nematodes. At present, the chemical pesticides that can effectively control root-knot nematodes mainly include avermectin, fluopyram, thiathiazolyl, methyl bromide, furadan, aldicarb, dazomethane, methambut, cartap, and chloranthate (Taylor, 2003). Due to the high toxicity of some nematicidal chemical pesticides, which have a negative impact on humans, animals and the ecological environment, under the current policy guidance of reducing pesticides, fertilizers and ecological protection, highly toxic and highly residual nematicides are restricted or prohibited from being used and promoted in actual production, and biological pesticides have ushered in a broad space for development (Hu & Liu, 2024). Nematode biocontrol bacteria kill nematodes by predation, parasitism, and toxin production. They are an important microbial group in nature that controls nematode populations and an important resource for the development of biocontrol agents (Li et al., 2015). Biological control of root-knot nematodes has the characteristics of long-lasting effect and eco-friendliness. There is a broad market prospect for exploring new biocontrol resources and developing efficient biological nematicides.

[0004] Dark septate endophytes (DSE) are the main group of plant endophytes. They are characterized by the formation of dark-colored hyphae with obvious septa after DSE coexists with plant roots, and can form "microsclerotia" structures in plant cells and intercellular spaces. DSE colonizes the epidermis and cortex of healthy plant roots, does no harm to host plants, and can enhance the host plant's resistance to pathogens and tolerance to heavy metal stress (Luo Qixin & Hou Rui, 2024). Studies have shown that DSE has good application value in nematode control; for example, Ashrafi et al. (2018) reported that Polyphilus sieberi can parasitize the eggs of Heterodera avenae. The fungus colonizes on nematode cysts and eggs by forming highly blackened monospore hyphae, and produces blackened hyphae and micronucleus-like structures typical of dark septate endophytes. Despite this, there are few reports on the research and application of DSE in controlling nematode diseases, and a large number of biological control resources are yet to be explored and utilized.

[0005] Currently, there is a lack of dark-septate endophytic fungal strains for use in root-knot nematode control. Summary of the invention

[0006] The invention aims to provide a dark-colored septate endophytic fungus strain and application thereof.

[0007] In order to solve the problems of the prior art, the present invention provides the following technical solutions: In a first aspect, the present application provides a dark septate endophytic fungus strain;

[0008] In a second aspect, the present application provides a dark septate endophytic fungal agent prepared from a dark septate endophytic fungal strain;

[0009] In a third aspect, the present application provides a method for preparing a dark-colored septate endophytic fungal agent;

[0010] In a fourth aspect, the present application provides a use of a dark septate endophytic fungus strain or a dark septate endophytic fungus agent in the preparation of a preparation for preventing and controlling root-knot nematode disease.

[0011] The first aspect of the present application provides a dark-septate endophytic fungus strain, which is the dark-septate endophytic fungus strain YMF1.068, and the preservation name is dark-septate endophytic fungus (Paraphoma vinacea), which is deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration CGMCC, and the address of the preservation unit is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the preservation date is May 20, 2024; the preservation number is CGMCC No.41305.

[0012] Furthermore, the ITS gene sequence of the dark-colored septate endophytic fungus strain is the nucleotide sequence shown in SEQ ID No.1.

[0013] The second aspect of the present application provides a dark-septate endophytic fungus agent prepared from a dark-septate endophytic fungus strain.

[0014] Furthermore, the active ingredient is at least one of the following (a), (b), and (c):

[0015] (a) fermentation cultures of dark septate endophytic fungi;

[0016] (b) the resulting dark septate endophytic fungal spore suspension;

[0017] (c) Ultrasonic lysis precipitate of the obtained dark septate endophytic fungal cells.

[0018] The third aspect of the present application provides a method for preparing a dark-colored septate endophytic fungal agent, comprising the following steps:

[0019] (1) Test tube slant seed culture of YMF1.068 strain: The strain was inoculated onto a slant of PDA medium and cultured at 28°C for 5 days to obtain slant seeds;

[0020] (2) Liquid seed culture of YMF1.068 strain: The slant seeds were inoculated into a Erlenmeyer flask filled with PDB medium and cultured in a shaking incubator at 28°C and 150 rpm for 4 days to obtain liquid seeds;

[0021] (3) Large-scale fermentation of YMF1.068 strain: 5% of the liquid seed was inoculated into a fermentation tank filled with PDB medium. The culture conditions in the 1000-L fermentation tank were controlled at: temperature 28°C, stirring speed 120-180 rpm, and fermentation time 72-96 hours;

[0022] (4) Preparation of YMF1.068 inoculant: The microbial cells and their metabolites obtained by fermentation tank culture were mixed with an appropriate amount of diatomaceous earth and then dried or air-dried at below 65°C until the moisture content was less than 5%. After crushing, a dark-colored septate endophytic fungal inoculant was obtained.

[0023] The fourth aspect of the present application provides a use of a dark septate endophytic fungus strain or a dark septate endophytic fungus agent in the preparation of a preparation for preventing and controlling root-knot nematode disease.

[0024] Beneficial effects: The present invention discloses a dark septate endophytic fungus strain Paraphoma vinacea YMF1.068, which can effectively prevent and treat root-knot nematode disease, has high lethal activity, enhances plant resistance, and is safe for humans and animals and has no residue, which means that it has little impact on the environment and human health. The microbial agent prepared by the strain showed a protective effect of more than 68% on tomatoes, cucumbers and tobacco, which is equivalent to the effect of chemical pesticides, showing its potential and market prospects as a biological pesticide.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The present invention screened a DSE strain Paraphoma vinacea YMF1.068, which has a strong lethal activity against the second-instar larvae of root-knot nematodes. The bacterial agent prepared using the YMF1.068 strain has a protective effect of more than 68% against tomato, cucumber and tobacco root-knot nematode diseases, and has important application value. However, the nematicidal activity of this DSE and its application in root-knot nematode diseases have not been reported.

[0027] (2) Safe for humans and animals: Since YMF1.068 is a biological pesticide, it is safe for humans, animals and the environment, so it has a good application prospect, especially under the current policy guidance of reducing pesticides and fertilizers and protecting the ecology. Eco-friendly: As a biological pesticide, YMF1.068 has the characteristics of long-lasting effect and eco-friendly, which helps to reduce the negative impact of chemical pesticides on the environment.

[0028] (3) New biocontrol resources: The present invention provides a new biocontrol resource that helps reduce dependence on chemical pesticides and provides new possibilities for the development of highly effective bionegicide. Enhance plant resistance: Dark septate endophytes (DSE) colonize the epidermis and cortex of healthy plant roots, do no harm to host plants, and can enhance host plants' resistance to pathogens and tolerance to heavy metal stress. Broad market prospects: Exploring new biocontrol resources and developing highly effective bionegicide has broad market prospects, which will help promote sustainable agricultural development and ecological protection. DETAILED DESCRIPTION

[0029] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0030] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0031] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple, respectively.

[0032] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0033] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0034] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass described in the embodiment description of the present application can be a mass unit known in the chemical industry such as μg, mg, g, kg, etc.

[0035] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0036] The first aspect of the embodiments of the present application provides a dark-septate endophytic fungus strain, which is the dark-septate endophytic fungus strain YMF1.068, the preservation name is dark-septate endophytic fungus (Paraphoma vinacea), and it is deposited in the General Microbiological Center of the China Microbiological Culture Collection Committee CGMCC, the address of the depository unit is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, the preservation date is May 20, 2024; the preservation number is CGMCC No.41305.

[0037] In some embodiments, the ITS gene sequence of the dark septate endophytic fungus strain is the nucleotide sequence shown in SEQ ID No.1.

[0038] A second aspect of an embodiment of the present application provides a dark-septate endophytic fungus agent prepared from a dark-septate endophytic fungus strain.

[0039] In some embodiments, the active ingredient is at least one of the following (a), (b), and (c):

[0040] (a) fermentation cultures of dark septate endophytic fungi;

[0041] (b) the resulting dark septate endophytic fungal spore suspension;

[0042] (c) Ultrasonic lysis precipitate of the obtained dark septate endophytic fungal cells.

[0043] The third aspect of the present application provides a method for preparing a dark-colored septate endophytic fungal agent, comprising the following steps:

[0044] (1) Test tube slant seed culture of YMF1.068 strain: The strain was inoculated onto a slant of PDA medium and cultured at 28°C for 5 days to obtain slant seeds;

[0045] (2) Liquid seed culture of YMF1.068 strain: The slant seeds were inoculated into a Erlenmeyer flask filled with PDB medium and cultured in a shaking incubator at 28°C and 150 rpm for 4 days to obtain liquid seeds;

[0046] (3) Large-scale fermentation of YMF1.068 strain: 5% of the liquid seed was inoculated into a fermentation tank filled with PDB medium. The culture conditions in the 1000-L fermentation tank were controlled at: temperature 28°C, stirring speed 120-180 rpm, and fermentation time 72-96 hours;

[0047] (4) Preparation of YMF1.068 inoculant: The microbial cells and their metabolites obtained by fermentation tank culture were mixed with an appropriate amount of diatomaceous earth and then dried or air-dried at below 65°C until the moisture content was less than 5%. After crushing, a dark-colored septate endophytic fungal inoculant was obtained.

[0048] The fourth aspect of the embodiments of the present application provides a dark septate endophytic fungus strain or a dark septate endophytic fungus agent for preparing a preparation for preventing and controlling root-knot nematode disease.

[0049] The present invention is further described in detail below in conjunction with the examples. The microbial agents in the examples are prepared according to conventional microbial fermentation methods and conventional microbial agent preparation methods.

[0050] Example 1

[0051] 1. Cultivation of YMF1.068 strain and preparation of bacterial agent in the present invention

[0052] Test tube slant seed culture of YMF1.068 strain: The strain was inoculated onto a slant of PDA medium and cultured at 28°C for 5 days to obtain slant seeds.

[0053] Liquid seed culture of YMF1.068 strain: inoculate the slant seeds into a Erlenmeyer flask filled with PDB medium and culture in a shaking incubator at 28°C and 150 rpm for 4 days to obtain liquid seeds.

[0054] Large-scale culture of YMF1.068 strain in a fermenter: The liquid seeds were inoculated into a fermenter filled with PDB medium at a ratio of 5% (V / V). The culture conditions in the 1000-liter fermenter were controlled at: temperature 28°C, stirring speed 120-180rpm, and fermentation time 72-96 hours.

[0055] The YMF1.068 strain was cultured on PDA medium at 28°C for 5 days. The colony diameter was 6.7 cm. The surface of the colony was grayish white, fluffy, with neat edges, and the back of the colony was dark brown. The matrix hyphae were brown, and the aerial hyphae were white. The hyphae were septate and could form "microsclerotia" structures in the plant root cells and intercellular spaces. PDA medium was used for solid culture, and PDB medium was used for liquid culture. The YMF1.068 strain was amplified by PCR using ITS universal primers. The sequence number of the ITS sequence obtained in the GeneBank public database is PQ459953, which is the main molecular feature basis for identifying the strain.

[0056] The ITS nucleotide sequence of Paraphoma vinacea YMF1.068 is:

[0057] ATCTCGCCTCTCCGTTCTGCCTGTATTCTACCCTTGTTTGTCATATACTATTATTTCCTCGGCAGGCTTGCCTGCCGAGTGAAACCATTTATAACCTTTTTAATTTTCAATCAGCGTCTGAAAAAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTT TGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCCGCGGGACTCGCCTTAAAGTAATTGGCAGCCAGTGTTTGGTTTTGAAGCGCAGCACAAGTCGCGATTCAAGGCTACACGCCCGCTTCCACAAGCCTTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

[0058] Preparation of YMF1.068 inoculant: The microbial cells and their metabolites obtained by fermentation tank culture are mixed with an appropriate amount of diatomaceous earth, dried or air-dried at below 65°C until the moisture content is less than 5%, and then crushed. The viable bacterial count of YMF1.068 strain in the inoculant must be 1×10 8 CFU / g and above.

[0059] Test Example 1

[0060] Lethal activity of YMF1.068 culture against second instar larvae (J2) of root-knot nematodes

[0061] 1) Preparation of J2

[0062] The tomato roots infected by southern root-knot nematodes were washed with sterile water, and the root-knot nematode oocysts were picked from the nodules with a dissecting needle and placed in a 5 ml centrifuge tube. The oocysts were lysed with 0.1% NaClO solution for 5 min, and the NaClO solution was removed by centrifugation and washed with sterile water for 3 times. The obtained eggs were placed in sterile water, incubated at 25°C for 4-6 days, and then collected by centrifugation to obtain J2.

[0063] 2) Preparation of YMF1.068 strain culture

[0064] The liquid seeds were inoculated into a Erlenmeyer flask filled with PDB medium at a ratio of 5% (V / V), and cultured in a shaking incubator at 28° C. and 150 rpm for 4 days.

[0065] 3) Activity assay

[0066] Add 1.9 ml of the above culture to a sterile culture dish with a diameter of 3.5 cm, then add 0.1 ml of nematode suspension containing more than 200 J2, mix well and let stand at room temperature; use an equal volume of PDB medium as a control for the YMF1.068 strain culture, and repeat three times for each treatment. Count the number of dead J2 under a dissecting microscope at 24h, 48h and 96h, and calculate the J2 mortality rate and corrected mortality rate according to the following formula.

[0067] Mortality rate (%) = number of live J2 / total number of J2 counted × 100

[0068] Corrected mortality rate (%) = (treatment group mortality rate - control group mortality rate) / (1 - control group mortality rate) × 100

[0069] The results showed that the YMF1.068 strain culture exhibited extremely strong lethal activity against the root-knot nematode J2, with the corrected mortality rates against J2 being 84.67%, 93.75% and 95.62% at 24h, 48h and 96h, respectively.

[0070] Test Example 2

[0071] Field efficacy of YMF1.068 fungicide against tomato root-knot nematode disease

[0072] Test location: Greenhouse of the Tropical Region Institute of Yunnan Academy of Agricultural Sciences, Yuanmou County, Yunnan Province.

[0073] Test crops: Tomato (variety: Fendu-80).

[0074] Test agent: YMF1.068 bacterial agent, with a viable count of 2×10 9 Pieces / gram, prepared according to the above method of the present invention; 5% avermectin emulsifiable concentrate (Hebei Weiyuan Biochemical Co., Ltd.).

[0075] Experimental method: There are three treatments as follows, each with 3 replicates and 120 tomato plants in each replicate.

[0076] Treatment 1: The dosage of YMF1.068 is 2.5 kg / mu. When transplanting, take 1 kg of the agent and dissolve it in about 100 kg of water, mix it well and soak the roots of the tomato seedlings in the medicine for about 10 minutes, then transplant; 20 days after transplanting, take 1.5 kg of the agent and dissolve it in 500 kg of water, stir it well and irrigate the roots of each plant with 200 ml.

[0077] Treatment 2: 5% avermectin EC, diluted 1000 times and irrigated the roots, 200 ml / plant.

[0078] Treatment 3: blank control without any nematicide application.

[0079] Survey and statistical methods: 180 days after transplanting, investigate the root nodule disease index of the plants (0: no nodules; 1: 1-20% of the roots have nodules; 2: 21-40% of the roots have nodules; 3: 41-60% of the roots have nodules; 4: 61-80% of the roots have nodules; 5: 81-100% of the roots have nodules), and calculate the disease index and prevention effect according to the following formula:

[0080] Disease index (%) = [(n1×1+n2×2+n3×3+n4×4+n5×5) / (S×5)]×100, n1-n5 represent the total number of plants corresponding to root nodule index level 1-5, and S represents the total number of plants surveyed.

[0081] Preventive effect (%) = 100 × (1-x / y), x and y represent the disease index of the treatment and blank control, respectively.

[0082] Test results: Table 1 shows that the control effect of applying 2.5 kg of YMF1.068 per mu on tomato root-knot nematodes is as high as 68.72%, although it is significantly lower than the control effect of applying 5% avermectin emulsifiable concentrate (75.85%), but YMF1.068 is a biological pesticide, safe for humans, animals and the environment, and thus has a good application prospect. The control effect of YMF1.068 on tomato root-knot nematodes is shown in Table 1:

[0083] Table 1

[0084]

[0085] Test Example 3

[0086] Field efficacy of YMF1.068 microbial agent against cucumber root-knot nematode disease

[0087] Experimental location: Vegetable greenhouse in Huanian Town, Yuxi City, Yunnan Province.

[0088] Experimental crops: cucumber (variety: Zhongnong 203).

[0089] Test agent: YMF1.068 bacterial agent, with a viable count of 2×10 9 pieces / gram, prepared according to the above method of the present invention;, prepared according to the above method of the present invention; 5% avermectin emulsifiable concentrate (Hebei Weiyuan Biochemical Co., Ltd.).

[0090] Experimental method: There are three treatments as follows, each with 3 replicates and 120 cucumber plants in each replicate.

[0091] Treatment 1: The dosage of YMF1.068 is 2.5 kg / mu. When transplanting, take 1 kg of the agent and dissolve it in about 100 kg of water, mix it well and soak the roots of the cucumber seedlings in the solution for about 10 minutes before transplanting; 20 days after transplanting, take 1.5 kg of the agent and dissolve it in 500 kg of water, stir it well and irrigate the roots of each plant with 200 ml.

[0092] Treatment 2: 5% avermectin EC, diluted 1000 times and irrigated the roots, 200 ml / plant.

[0093] Treatment 3: blank control without any nematicide application.

[0094] Survey and statistical methods: 180 days after transplanting, investigate the root nodule disease index of the plants (0: no nodules; 1: 1-20% of the roots have nodules; 2: 21-40% of the roots have nodules; 3: 41-60% of the roots have nodules; 4: 61-80% of the roots have nodules; 5: 81-100% of the roots have nodules), and calculate the disease index and prevention effect according to the following formula:

[0095] Disease index (%) = [(n1×1+n2×2+n3×3+n4×4+n5×5) / (S×5)]×100, n1-n5 represent the total number of plants corresponding to root nodule index level 1-5, and S represents the total number of plants surveyed.

[0096] Preventive effect (%) = 100 × (1-x / y), x and y represent the disease index of the treatment and blank control, respectively.

[0097] Test results: Table 2 shows that the control effect of applying 2.5 kg of YMF1.068 per mu on cucumber root-knot nematodes is as high as 73.2%, which is equivalent to the control effect of applying 5% avermectin emulsifiable concentrate (72.4%). The control effect of YMF1.068 on cucumber root-knot nematodes is shown in Table 2:

[0098] Table 2

[0099]

[0100] Test Example 4

[0101] Effect of YMF1.068 fungal agent on controlling tobacco root-knot nematodes

[0102] Experimental location: Eshan County, Yuxi City, Yunnan Province.

[0103] Experimental crops: tobacco (variety: K326).

[0104] Test agent: YMF1.068 bacterial agent, with a viable count of 2×10 9pieces / gram, prepared according to the above method of the present invention;, prepared according to the above method of the present invention; 5% avermectin emulsifiable concentrate (Hebei Weiyuan Biochemical Co., Ltd.).

[0105] Experimental method: There are three treatments as follows, each with 3 replicates and 120 tobacco plants in each replicate.

[0106] Treatment 1: The dosage of YMF1.068 is 2.5 kg / mu. When transplanting, take 1 kg of the agent and dissolve it in about 100 kg of water, mix it well and soak the roots of the tobacco seedlings in the solution for about 10 minutes before transplanting; 20 days after transplanting, take 1.5 kg of the agent and dissolve it in 500 kg of water, stir it well and irrigate the roots of each plant with 200 ml.

[0107] Treatment 2: 5% avermectin EC, diluted 1000 times and irrigated the roots, 200 ml / plant.

[0108] Treatment 3: blank control without any nematicide application.

[0109] Survey and statistical methods: 180 days after transplanting, investigate the root nodule disease index of the plants (0: no nodules; 1: 1-20% of the roots have nodules; 2: 21-40% of the roots have nodules; 3: 41-60% of the roots have nodules; 4: 61-80% of the roots have nodules; 5: 81-100% of the roots have nodules), and calculate the disease index and prevention effect according to the following formula:

[0110] Disease index (%) = [(n1×1+n2×2+n3×3+n4×4+n5×5) / (S×5)]×100, n1-n5 represent the total number of plants corresponding to root nodule index level 1-5, and S represents the total number of plants surveyed.

[0111] Preventive effect (%) = 100 × (1-x / y), x and y represent the disease index of the treatment and blank control, respectively.

[0112] Test results: Table 3 shows that the control effect of applying 2.5 kg of YMF1.068 per mu on tobacco root-knot nematodes is as high as 70.52%, which is equivalent to the control effect of applying 5% avermectin emulsifiable concentrate (71.55%). The control effect of YMF1.068 on tobacco root-knot nematodes is shown in Table 3:

[0113] Table 3

[0114]

[0115] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and the scope of protection of the present invention is defined by the attached claims, description and their equivalents.

Claims

1. A dark septate endophytic fungus strain characterized by: This strain is the dark septate endophytic fungus strain YMF1.068, the preservation name is dark septate endophytic fungus (Paraphoma vinacea), and it is preserved in the General Microbiology Center CGMCC of the China Microbiological Culture Collection Administration. The address of the preservation unit is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. The preservation date is May 20, 2024; the preservation number is CGMCC No.41305.

2. The dark septate endophytic fungus strain according to claim 1, characterized in that: The ITS gene sequence of the dark septate endophytic fungus strain is the nucleotide sequence shown in SEQ ID No.

1.

3. A dark-septate endophytic fungus agent prepared from the dark-septate endophytic fungus strain according to claim 1.

4. The dark septate endophytic fungal agent according to claim 3, wherein the active ingredient is at least one of the following (a), (b), and (c): (a) a fermentation culture of the dark septate endophytic fungus according to claim 1; (b) a spore suspension of a dark septate endophytic fungus obtained according to claim 1; (c) Ultrasonic lysis precipitation of dark-colored septate endophytic fungal cells obtained according to claim 1.

5. The method for preparing the dark septate endophytic fungal agent according to claim 1, characterized in that The steps include: (1) Test tube slant seed culture of YMF1.068 strain: The strain described in claim 1 was inoculated onto a slant of PDA culture medium and cultured at 28° C. for 5 days to obtain slant seeds; (2) Liquid seed culture of YMF1.068 strain: The slant seeds were inoculated into a Erlenmeyer flask filled with PDB medium and cultured in a shaking incubator at 28°C and 150 rpm for 4 days to obtain liquid seeds; (3) Large-scale fermentation of YMF1.068 strain: 5% of the liquid seed was inoculated into a fermentation tank filled with PDB medium. The culture conditions in the 1000-L fermentation tank were controlled at: temperature 28°C, stirring speed 120-180 rpm, and fermentation time 72-96 hours; (4) Preparation of YMF1.068 inoculant: The microbial cells and their metabolites obtained by fermentation tank culture were mixed with an appropriate amount of diatomaceous earth and then dried or air-dried at below 65°C until the moisture content was less than 5%. After crushing, a dark-colored septate endophytic fungal inoculant was obtained.

6. Use of the dark septate endophytic fungus strain according to claim 1 or the dark septate endophytic fungus agent according to claim 3 in the preparation of a preparation for preventing and controlling root-knot nematode disease.

Images