Mixed type central metabolic network chassis cell with both carbon atom economy and energy generation pathway as well as construction method and application of mixed type central metabolic network chassis cell

Abstract

The invention discloses a hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway as well as a construction method and application of the hybrid central metabolic network chassis cell, and belongs to the technical field of genetic engineering and microorganisms. The Escherichia coli central metabolic network is reconstructed, so that the Escherichia coli central metabolic network has a carbon sequestration module and an energy generation module at the same time. The carbon sequestration module continues to fix CO2 while avoiding CO2 release caused by pyruvic acid decarboxylation, the highest carbon yield can reach 133%, the carbon yield exceeds that of an NOG pathway reported only from the perspective of no CO2 release, and the carbon yield is two times that of a natural glycolysis pathway. And the direct product of the constructed mixed type central metabolic network is acetyl coenzyme A, and the acetyl coenzyme A contains an energy generation module, so that the chassis cell provided by the invention can meet the synthesis requirements of acetyl coenzyme A derivatives with high or low required reducing power, and has universality.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and microbial technology, and in particular to a hybrid central metabolic network chassis cell having both carbon atom economy and energy generation pathway, and a construction method and application thereof. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Carbon atom economy is an important criterion for measuring biomanufacturing. However, the currently widely used chassis microorganisms, including Escherichia coli and yeast, all release CO2 during biosynthesis. Acetyl-coenzyme A (AcCoA) is a core metabolic intermediate in organisms and a key precursor for the synthesis of many chemicals such as terpenes, polyketides, and lipids. Its main synthesis pathway is the decarboxylation reaction of pyruvate. This reaction is accompanied by the release of CO2, so that the highest carbon yield is only 66.7%, which is the main reason for carbon loss during biotransformation. In addition, the generation of energy such as ATP and reducing power NAD(P)H is another important parameter affecting green biomanufacturing. The lack of energy generation pathways will disturb the product synthesis spectrum, resulting in insufficient driving force during carbon atom conversion.

[0004] Carbon atom economy can be improved by reprogramming the central metabolic network of microorganisms. Previously, a study constructed a non-oxidative glycolysis pathway (NOG) (Nature, 502, 693-697, 2013) that bypassed the decarboxylation process of pyruvate and increased the carbon yield to 100%. Later, researchers applied the NOG pathway to the synthesis of acetyl-CoA derivatives. For example, the NOG pathway was integrated into Escherichia coli for the production of acetone, which increased the acetone yield from 0.38 to 0.47 M / M glucose. Therefore, the NOG pathway plays an important role in increasing carbon yield by carbon sequestration. However, the following problems still exist: First, the NOG pathway is constructed only from the perspective of avoiding carbon release. If CO2 is further fixed on this basis, it is expected to further increase the carbon atom economy in the biotransformation process; second, the NOG pathway does not include an energy generation pathway and does not produce reducing power, so it is not suitable for the synthesis of compounds with high reducing power requirements. Therefore, how to construct a hybrid central metabolic network chassis cell that maximizes the carbon atom economy and contains energy generation pathways will be the key to creating a new type of microbial cell factory. Summary of the invention

[0005] In view of this, the present invention provides a hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway, and its construction method and application. Specifically, the present invention reconstructs the central metabolic network of Escherichia coli to create a new artificial tunable hybrid central network apparatus (Athena), thereby obtaining a universal chassis cell that can not only maximize the carbon atom economy, but also include energy generation pathways, so it is suitable for the biosynthesis of compounds with different reducing power requirements.

[0006] In the first aspect, the present invention provides a hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway. The hybrid central metabolic network chassis cell is based on Escherichia coli as a starting strain, and the alcohol dehydrogenase gene adhE, pyruvate formate lyase gene pflB, pyruvate oxidase gene poxB, lactate dehydrogenase gene ldhA, phosphate carrier protein HPr gene ptsH and ptsI, phosphoenolpyruvate carboxylase gene ppc, malate:quinone oxidoreductase gene mqo, malate dehydrogenase genes maeA and maeB, malate synthase A gene aceB, and malate synthase G gene glcB of the Escherichia coli genome are knocked out; at the same time, galactose:H + The transporter gene galP, glucose kinase gene glk, phosphoenolpyruvate carboxykinase gene pck, malate dehydrogenase gene mdh, malate thiokinase Mtk genes sucC-2 and sucD-2, malyl-CoA lyase gene mcl, L-aspartate oxidase gene nadB and ATP-citrate lyase genes aclA and aclB were obtained.

[0007] In a second aspect, the present invention provides a method for constructing the hybrid central metabolic network chassis cell having both carbon atom economy and energy generation pathway, comprising the following steps:

[0008] S1, knock out the alcohol dehydrogenase gene adhE, pyruvate formate lyase gene pflB, pyruvate oxidase gene poxB, and lactate dehydrogenase gene ldhA on the Escherichia coli genome respectively; replace the phosphate carrier protein HPr genes ptsH and ptsI on the genome with galactose:H + transporter gene galP and glucose kinase glk; knock out the phosphoenolpyruvate carboxylase gene ppc, malate:quinone oxidoreductase gene mqo, malate dehydrogenase genes maeA and maeB, malate synthase A gene aceB, and malate synthase G gene glcB on the genome to obtain mutant strain I;

[0009] S2, screening the activities of phosphoenolpyruvate carboxykinase Pck and malate dehydrogenase Mdh in different hosts; inserting the phosphoenolpyruvate carboxykinase gene pck and malate dehydrogenase gene mdh with the highest activity into the genome of mutant strain I obtained in S1 to obtain mutant strain II;

[0010] S3. Knock out the citrate synthase encoding gene gltA and the methyl citrate synthase encoding gene prpC in the genome of Escherichia coli BW25113, and construct a genetic screening system for L-aspartate oxidase NadB; use degenerate primers to mutate NadB, and screen mutants using the constructed NadB genetic screening system; sequence the mutant with the best effect, and insert it into the genome of the obtained mutant strain II to obtain mutant strain III;

[0011] S4. On the basis of mutant strain III, the remaining pathway-related genes are integrated, including malate thiokinase Mtk genes sucC-2 and sucD-2, malyl-CoA lyase gene mcl, and ATP-citrate lyase genes aclA and aclB, to obtain the hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway.

[0012] In a third aspect, the present invention provides the use of the above-mentioned hybrid central metabolic network chassis cell or the hybrid central metabolic network chassis cell constructed by the above-mentioned construction method in fixing carbon dioxide and synthesizing acetyl-CoA derivatives.

[0013] Compared with the prior art, the present invention has achieved the following beneficial effects:

[0014] The hybrid central metabolic network chassis cell provided by the present invention has both a carbon sequestration module and an energy generation module. The carbon sequestration module of the present invention continues to fix CO2 while avoiding the release of CO2 by decarboxylation of pyruvate, and the carbon yield can reach up to 133%, which exceeds the NOG pathway reported only from the perspective of not releasing CO2, and is twice the carbon yield of the natural glycolysis pathway. On the other hand, since there is no energy generation pathway in previous related studies, it is only applicable to the synthesis of acetyl-CoA derivatives that do not require reducing power or have low reducing power requirements, and does not have universality; and the direct product of the Athena metabolic network of the hybrid central metabolic network chassis cell constructed by the present invention is acetyl-CoA. In addition, Athena still contains an energy generation module, so for acetyl-CoA derivatives with high or low reducing power, the chassis cell provided by the present invention can meet its synthesis requirements, and has universality, so it has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The drawings constituting part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their description are used to explain the present invention and do not constitute an improper limitation of the present invention. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative work.

[0016] Figure 1 This is a schematic diagram of the Escherichia coli Athena pathway of Example 1 of the present invention;

[0017] Figure 2 The purification (A, B) and activity detection (C, D) of phosphoenolpyruvate carboxykinase (Pck) and L-malate dehydrogenase (Mdh) of Example 1 of the present invention;

[0018] Figure 3 The present invention is based on the construction (A) and verification (BD) of the glutamate deficiency genetic screening system of Example 1;

[0019] Figure 4 The shake flask screening of the NadB single-site mutation (A) and the combined mutation (B) of Example 1 of the present invention;

[0020] Figure 5 The PpNadB site mutation shake flask rescreening of Example 1 of the present invention;

[0021] Figure 6 The Athena pathway of Example 1 of the present invention is constructed;

[0022] Figure 7 Verify whether Athena is running for the acetyl-CoA (A, B) and L-aspartate auxotrophs (C, D) of Example 2 of the present invention;

[0023] Figure 8 This is the identification and optimization of the key genes of the Athena pathway of Example 3 of the present invention. DETAILED DESCRIPTION

[0024] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0025] The "Athena" mentioned below in the present invention is an abbreviation of an artificial tunable hybrid central network apparatus, which is a new central metabolic network designed and constructed by the present invention with high carbon atom economy and energy production process.

[0026] As introduced in the background technology, although research on improving the carbon atom economy of microorganisms has been reported in the prior art, the relevant pathways or strategies are only constructed from the perspective of not releasing CO2, and no reducing power is generated in the pathway. Therefore, the microbial synthesis of acetyl-CoA derivatives with higher reducing power is not taken into account and is not universal.

[0027] Therefore, the present invention provides a hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway. The hybrid central metabolic network chassis cell is based on Escherichia coli as a starting strain, and the alcohol dehydrogenase gene adhE, pyruvate formate lyase gene pflB, pyruvate oxidase gene poxB, lactate dehydrogenase gene ldhA, phosphate carrier protein HPr gene ptsH and ptsI, phosphoenolpyruvate carboxylase gene ppc, malate:quinone oxidoreductase gene mqo, malate dehydrogenase genes maeA and maeB, malate synthase A gene aceB, and malate synthase G gene glcB of the Escherichia coli genome are knocked out; at the same time, galactose:H + The transporter gene galP, glucose kinase gene glk, phosphoenolpyruvate carboxykinase pck, malate dehydrogenase gene mdh, malate thiokinase Mtk genes sucC-2 and sucD-2, malyl-CoA lyase gene mcl, L-aspartate oxidase gene nadB and ATP-citrate lyase genes aclA and aclB were obtained.

[0028] The metabolic network of the hybrid central metabolic network chassis cell of the present invention can be divided into a carbon sequestration module and an energy generation module, the former is used to improve the carbon yield, and the latter is used for the generation of ATP and NADH. In terms of improving the economy of carbon atoms, the carbon sequestration module in the path of the present invention fixes 2 molecules of CO2 while not releasing CO2, breaking through the limitation of the angle that the NOG pathway only does not release CO2, and the carbon yield can reach up to 133%, which is twice that of the natural glycolysis pathway. On the other hand, the direct product of the chassis cell provided by the present invention is acetyl-CoA, and since the metabolic network contains an energy generation pathway, the hybrid central metabolic network chassis cell provided by the present invention can be used for the synthesis of acetyl-CoA derivatives with low reducing power required, and can be used for the synthesis of acetyl-CoA derivatives with high reducing power required. The present invention solves the related problems that the previous related pathways only partially improve the economy of carbon atoms and do not produce reducing power, and cannot adapt to the synthesis of compounds with high reducing power requirements.

[0029] In the present invention, the Escherichia coli may specifically be Escherichia coli BW25113. In addition, it should be noted that, based on the inventive concept of the present application, without paying creative labor, conventional replacement with other strains, or replacement of the relevant genes of the above pathway of the present invention with other genes with similar functions, but still the pathway of the present invention, etc., also fall within the scope of protection of the present invention.

[0030] In the present invention, the GenBank accession of the alcohol dehydrogenase gene adhE is AIN31697.1; the GenBank accession of the pyruvate formate lyase gene pflB is AIN31371.1; the GenBank accession of the pyruvate oxidase gene poxB is AIN31340.1; the GenBank accession of the lactate dehydrogenase gene ldhA is AIN31834.1; the GenBank accession of the phosphate carrier protein HPr gene ptsH is 682119888, and the GenBank accession of ptsI is 682119889; the GenBank accession of the phosphoenolpyruvate carboxylase gene ppc is 682121328; the GenBank accession of the malate:quinone oxidoreductase gene mqo is 682119695; the GenBank accession of the malate dehydrogenase gene maeA is AIN31834.1. The GenBank accession number of the malate synthase A gene aceB is 682121374; the GenBank accession number of the malate synthase G gene glcB is 682120406; the galactose:H +The GenBank accession of the transporter gene galP is 682120377; the GenBank accession of the glucose kinase gene glk is 682119868; the GenBank accession of the phosphoenolpyruvate carboxykinase gene pck is ABR73601.1; the GenBank accession of the malate dehydrogenase gene mdh is 150840995; the GenBank accession of the malate thiokinase Mtk gene sucC-2 is 53757685, and the GenBank accession of sucD-2 is 53757684; the GenBank accession of the malyl-CoA lyase gene mcl is ABA77918.1; the GenBank accession of the L-aspartate oxidase gene nadB is WP_010952532.1; the GenBank accession of the ATP-citrate lyase gene aclA is The GenBank accession is 21647055 and the GenBank accession of aclB is 21647054.

[0031] In the present invention, the hybrid central metabolic network chassis cell also includes overexpression of Escherichia coli BW25113-derived fumarase A gene fumA, fumarase C gene fumC and isocitrate lyase gene aceA in a plasmid; the GenBank accession of the fumarase A gene fumA is 682119124; the GenBank accession of the fumarase C gene fumC is 682119123; the GenBank accession of the isocitrate lyase gene aceA is 682121375. The present invention found that pck, fumA, fumC and aceA are key genes of the pathway, and overexpression of these four genes in the plasmid can significantly improve the performance of the Athena pathway and promote the growth of the strain.

[0032] The present invention also provides a method for constructing the hybrid central metabolic network chassis cell having both carbon atom economy and energy generation pathway, comprising the following steps:

[0033] S1, knock out the alcohol dehydrogenase gene adhE, pyruvate formate lyase gene pflB, pyruvate oxidase gene poxB, and lactate dehydrogenase gene ldhA on the Escherichia coli genome respectively; replace the phosphate carrier protein HPr genes ptsH and ptsI on the genome with galactose:H +transporter gene galP and glucose kinase glk; knock out the phosphoenolpyruvate carboxylase gene ppc, malate:quinone oxidoreductase gene mqo, malate dehydrogenase genes maeA and maeB, malate synthase A gene aceB, and malate synthase G gene glcB on the genome to obtain mutant strain I;

[0034] S2, screening the activities of phosphoenolpyruvate carboxykinase Pck and malate dehydrogenase Mdh in different hosts; inserting the phosphoenolpyruvate carboxykinase gene pck and malate dehydrogenase gene mdh with the highest activity into the genome of mutant strain I obtained in S1 to obtain mutant strain II;

[0035] S3. Knock out the citrate synthase encoding gene gltA and the methyl citrate synthase encoding gene prpC in the genome of Escherichia coli BW25113, and construct a genetic screening system for L-aspartate oxidase NadB; use degenerate primers to mutate NadB, and screen mutants using the constructed NadB genetic screening system; sequence the mutant with the best effect, and insert it into the genome of the obtained mutant strain II to obtain mutant strain III;

[0036] S4. On the basis of mutant strain III, the remaining pathway-related genes are integrated, including malate thiokinase Mtk genes sucC-2 and sucD-2, malyl-CoA lyase gene mcl, and ATP-citrate lyase genes aclA and aclB, to obtain the hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway.

[0037] The present invention blocks the formation of heterocarbon byproducts by knocking out byproduct synthesis genes (adhE, pflB, poxB and ldhA); replaces key genes ptsH and ptsI in the PTS (phosphotransferase system) pathway with galP and glk to solve the problem of PEP (phosphoenolpyruvate) molecule consumption; knocks out reverse reaction synthesis pathway genes (ppc, mqo, maeA and maeB), and simultaneously solves the invalid cycle between malate and glyoxylate (aceB and glcB knockout); integrates genes of the synthesis pathway (pck, mdh, sucC-2, sucD-2, mcl, nadB mutants, aclA and aclB) to obtain the hybrid central metabolic network chassis cell with carbon atom economy and energy generation according to the present invention.

[0038] In step S1 of the present invention, the Escherichia coli can be specifically Escherichia coli BW25113; the knockout and replacement can be performed using any known gene editing technology, especially gene knockout technology, and can be performed according to standard operating methods. In a specific embodiment of the present invention, the knockout can use CRISPR / Cas9 technology. Therefore, specifically, the method of step S1 includes: designing an sgRNA sequence targeting the target gene, and using CRISPR / Cas9 to knock out the alcohol dehydrogenase gene adhE, pyruvate formate lyase gene pflB, pyruvate oxidase gene poxB, and lactate dehydrogenase gene ldhA on the genome of the starting strain Escherichia coli BW25113 respectively; replacing the phosphate carrier protein HPr genes ptsH and ptsI on the genome with galactose:H + transporter gene galP and glucose kinase glk; knock out the phosphoenolpyruvate carboxylase gene ppc, malate:quinone oxidoreductase gene mqo, malate dehydrogenase genes maeA and maeB, malate synthase A gene aceB, and malate synthase G gene glcB on the genome to obtain a mutant strain I, which was named Q4267 (E. coli

[0039] BW25113△adhE△pflB△poxB△ldhA△ptsHI::galP-glk△ppc△mqo△maeAB△ace B△glcB).

[0040] In step S2 of the present invention, the host source of the phosphoenolpyruvate carboxykinase pck includes Actinobacillus succinogenes, Bacillus subtilis, Lactiplantibacillus plantarum or Mannheimia succiniciproducens; the host source of the malate dehydrogenase mdh includes Bacillussubtilis, Actinobacillus succinogenes, Lactiplantibacillus plantarum or Corynebacterium glutamicum. Further, the host is preferably Actinobacillus succinogenes; specifically, the method of step S2 includes: using CRISPR / Cas9 to insert the phosphoenolpyruvate carboxykinase gene pck and the malate dehydrogenase gene mdh with the highest enzyme activity from Actinobacillus succinogenes into the genome of the mutant strain I, replacing the background pck and mdh genes of Escherichia coli, and the promoter can be P j23119 , mutant strain II was obtained.

[0041] In step S3 of the present invention, the sgRNA sequence targeting the target gene is designed, and the citrate synthase encoding gene gltA and the methyl citrate synthase encoding gene prpC on the genome of the starting strain Escherichia coli BW25113 are knocked out respectively by CRISPR / Cas9. The mutation method can adopt any known existing saturation or semi-saturation mutation. In a specific embodiment of the present invention, the mutation can adopt a degenerate primer-mediated saturation technique. Therefore, specifically, the method of step S3 includes: using NDT-VMA-ATG-TGG degenerate primers to amplify the NadB template fragment, and the mutation sites include 16 amino acid sites at a distance of 5 angstroms around the substrate and NadB substrate binding and active sites (Q50, G51, G52, E121, H244, L257, L258, T259, E260, A261, R290, H351, L386, S389, S391 and L392). The amplified product was digested with Dpn I enzyme, transformed into competent cells, and spread on the screening solid culture medium culture dish. When a single colony grows, the single colony is inoculated into a 96-well plate liquid screening medium and cultured with shaking at 37°C and 180rpm. After one day of culture, the growth of the strain was detected at 600nm using an ELISA reader (Spark, Tecan). The strains with better growth were sent to a sequencing company for sequencing to determine the sequence of the mutation site, and a shake flask of 50mL liquid culture medium was screened at the same time. The best mutant gene was inserted into the genome of the resulting mutant strain II using CRISPR / Cas9, and the promoter could be P j23119 , mutant strain III was obtained.

[0042] In another specific embodiment of the present invention, the screening solid culture medium formula is: 13-15g / L K2HPO4·3H2O, 5-6g / L KH2PO4, 0.8-1.2g / L NaCl, 0.8-1.2g / L NH4Cl, 0.4-0.6g / L MgSO4·7H2O, 1.5-2.5wt% glucose, 8-12mM glyoxylic acid, sodium aspartate and sodium fumarate, 1-2wt% agar powder; further preferably: 14g / L K2HPO4·3H2O, 5.2g / L KH2PO4, 1g / L NaCl, 1g / L NH4Cl, 0.5g / L MgSO4·7H2O, 2wt% glucose, 10mM glyoxylic acid, sodium aspartate and sodium fumarate, respectively, and 1.5wt% agar powder. When a single colony grows, the single colony is inoculated into a 96-well plate and cultured under shaking conditions of 37°C and 180rpm. The liquid screening medium formula is: 13-15g / L K2HPO4·3H2O, 5-6g / L KH2PO4, 0.8-1.2g / L NaCl, 0.8-1.2g / L NH4Cl, 0.4-0.6g / L MgSO4·7H2O, 1.5-2.5wt% glucose, 8-12mM glyoxylic acid and sodium aspartate; more preferably: 14g / LK2HPO4·3H2O, 5.2g / L KH2PO4, 1g / L NaCl, 1g / L NH4Cl, 0.5g / L MgSO4·7H2O, 2% glucose, 10mM glyoxylic acid and sodium aspartate, respectively.

[0043] In step S4 of the present invention, CRISPR / Cas9 is used to integrate the malate thiokinase Mtk genes sucC-2 and sucD-2, the malyl-CoA lyase gene mcl, and the ATP-citrate lyase genes aclA and aclB into the genome, thereby obtaining the hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway.

[0044] The present invention also provides the use of the hybrid central metabolic network chassis cell or the hybrid central metabolic network chassis cell constructed by the above construction method in fixing carbon dioxide and synthesizing acetyl-CoA derivatives. The hybrid central metabolic network chassis cell of the present invention can be used for the synthesis of acetyl-CoA derivatives with low reducing power, such as polyhydroxybutyrate, and can also be used for the synthesis of acetyl-CoA derivatives with high reducing power, such as isoprene.

[0045] The technical solution of the present invention is further described below in conjunction with specific embodiments.

[0046] Unless otherwise specified, the materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels.

[0047] The enzyme reagents used were purchased from Nanjing Novozymes, Beijing TaKaRa and Shanghai Bioengineering Co., Ltd. The kits used to extract plasmids and recover DNA fragments were purchased from OMEGA, USA. The corresponding operation steps were carried out according to the product instructions; all culture media were prepared with deionized water unless otherwise specified.

[0048] In the following examples, ptsHI is an abbreviation of ptsH and ptsI, maeAB is an abbreviation of maeA and maeB, sucCD-2 is an abbreviation of sucC-2 and sucD-2, fumAC is an abbreviation of fumA and fumC, and acl includes aclA and aclB.

[0049] Example 1: Design and construction of an Escherichia coli tunable hybrid central network (Athena)

[0050] 1. Athena design and chemometric analysis

[0051] High carbon atom economy is an important feature of chassis cells and an important criterion for measuring biomanufacturing processes. Improving the CO2 fixation efficiency of microbial cells and reducing CO2 emissions can effectively improve carbon atom economy. In addition, the generation of energy such as ATP and reducing power NAD(P)H is another important parameter affecting carbon atom economy. The lack of energy generation pathways will disturb the product synthesis spectrum, resulting in insufficient driving force during carbon atom conversion. Therefore, this embodiment designs and constructs a new central metabolic network Athena with high carbon atom economy and energy production process, such as Figure 1 shown.

[0052] First, the enzymes in the pathway were identified. The enzymes in Athena include pyruvate kinase Pyk and pyruvate dehydrogenase AceE, which are present in the background metabolic network of E. coli. In addition, Athena also includes phosphoenolpyruvate carboxykinase Pck, malate dehydrogenase Mdh, fumarase FumA and FumC, malate thiokinase Mtk, fumarate reductase Frd, malyl-CoA lyase Mcl, isocitrate lyase AceA, aconitase Acn, and ATP-citrate lyase Acl. Through database mining, it was determined that the products encoded by sucC-2 and sucD-2, mcl, and aclA and aclB genes from Methylococcus capsulatus, Rhodobacter sphaeroides, and Chlorobium tepidum have Mtk, Mcl, and Acl activities in E. coli, respectively.

[0053] Three fumarases are encoded in E. coli, at least one of which has enzymatic activity under aerobic conditions. Fumarate reductase (FrdABCD) catalyzes fumarate to produce succinate and is usually expressed only under anaerobic conditions. Although it has been reported that unregulated fumarate reductase mutants were found when a succinate dehydrogenase-deficient strain was aerobic cultured, the enzyme is located in the cell membrane and consumes reducing power. Through database mining, an alternative enzyme for this pathway, L-aspartate oxidase NadB, was found. The enzyme uses aspartate to provide electrons and can use oxygen or fumarate as an electron acceptor. It can catalyze oxygen and aspartate to produce iminoaspartate and hydrogen peroxide, and can also catalyze fumarate and aspartate to produce iminoaspartate and succinate. Studies have shown that fumarate is actually a more effective electron acceptor, and its enzyme conversion rate is twice that of oxygen as an electron acceptor. Therefore, fumarate is the natural substrate of NadB and is kinetically superior to oxygen. Therefore, NadB can be used as an enzyme to replace FrdABCD and has the potential to be further applied in Athena network. The specific comparison between the two is shown in Table 1.

[0054] Table 1 Biochemical characteristics of FrdABCD and NadB

[0055]

[0056] After determining the enzymes of the Athena network, a comprehensive analysis of the network is performed. First, one molecule of glucose generates two molecules of PEP through the upstream pathway of glycolysis, and the equation is (i). The two molecules of PEP generated subsequently serve as key metabolic branch points: one path continues to the downstream pathway of glycolysis under the catalysis of Pyk enzyme, and the other passes through the artificial synthesis pathway through the action of Pck. Assuming that there are x molecules of PEP that pass through the artificial synthesis pathway through the catalysis of Pck at the beginning, the equation passing through this path module is (ii). The remaining (2-x) molecules of PEP pass through the downstream pathway of glycolysis, and the equation is (iii). Combining equations (i), (ii) and (iii), the Athena network equation constructed in this embodiment is (iv) = (i) + (ii) + (iii), where x∈[0,2]. If x is larger, Y AcCoA / glu The larger the Y CO2 / glu , Y NAD(P)H / glu , Y ATP / glu The smaller the value, the more carbon metabolic flow through the artificial synthetic pathway constructed by PEP catalyzed by Pck, the higher the AcCoA yield, the lower the CO2 yield, and the lower the NAD(P)H and ATP yields, indicating that the constructed artificial pathway is a high carbon yield and energy consumption process, which is a "carbon sequestration" module. AcCoA / glu The smaller the Y CO2 / glu , Y NAD(P)H / glu , Y ATP / glu The larger the value, that is, the more carbon metabolic flow of PEP through Pyk, the lower the AcCoA yield, the higher the CO2 yield, and the higher the NAD(P)H and ATP yields, indicating that the downstream pathway of natural glycolysis catalyzed by Pyk of PEP is a process of carbon loss and energy generation, which is an "energy generation" module.

[0057] C6H 12 O6→ 2 PEP + 2 NAD(P)H (i)

[0058] x PEP + x HCO3 - + 2x NAD(P)H + x ATP → 2x AcCoA (ii)

[0059] (2-x) PEP → (2-x) AcCoA+ (2-x) CO2 + (2-x) NAD(P)H + (2-x) ATP (iii)

[0060] C6H 12 O6→(2+x)AcCoA+(2-2x)CO2+(4-3x)NAD(P)H+(2-2x)ATP x∈[0,2](iv)

[0061] The above analysis shows that the carbon yield and energy status vary with the metabolic flow of the PEP metabolic node to the two modules. Specifically, when x takes values ​​of 0, 0.5, 1, and 2, the generation or consumption of AcCoA, CO2, NAD(P)H, and ATP are shown in Table 2. With the different values ​​of x, that is, the carbon flow of PEP molecules entering the carbon sequestration module, the carbon yield varies from 66.7% to 133%.

[0062] Table 2 Athena stoichiometric analysis

[0063]

[0064] Note: “-” indicates consumption, and “+” indicates generation.

[0065] Compared with previously reported pathways, the network showed better potential: when achieving the same carbon yield, Athena generated more energy, and the highest carbon yield of Athena reached 133%, which is twice that of the natural glycolysis pathway.

[0066] 2. Screening of the starting enzyme of the carbon sequestration module of Escherichia coli Athena

[0067] The starting enzymes of the carbon sequestration module are phosphoenolpyruvate carboxykinase Pck and malate dehydrogenase Mdh. In order to obtain highly active Pck and Mdh, the pck genes from Actinobacillus succinogenes, Bacillus subtilis, Lactiplantibacillus plantarum, and Mannheimia succiniciproducens were synthesized; the mdh genes from Bacillus subtilis, Actinobacillus succinogenes, Lactiplantibacillus plantarum, and Corynebacterium glutamicum were synthesized. The enzyme activities of the above gene-encoded enzymes together with Pck and Mdh from the background of E. coli were tested. The details are as follows.

[0068] Use pET28a plasmid to overexpress related genes and transform it into E. coli BL21 (DE3). After a single clone grows out, inoculate the single clone into 4 mL LB medium (5 g / L yeast extract, 10 g / L tryptone, 10 g / L NaCl) and culture overnight at 37°C, 220 rpm. Transfer to a shake flask containing 50 mL LB medium at a transfer volume of 1% and add the corresponding antibiotics. When the bacterial solution OD 600When reaching 0.6-0.8, add IPTG induction culture with a final concentration of 0.1mM for 10h. Repeatedly wash three times with phosphate buffer (PBS, 0.01M, pH 7.2-7.4), and use a high-pressure cell crusher (Constant Systems LTD, UK) to crush the bacterial cells. Use Ni-NTA His-Bind Column (Novagen) to purify the recombinant protein labeled with His6. Use Bradford protein detection kit (Beyotime, Beijing) to quantify the protein concentration, separate on 12% SDS-PAGE gel, and stain by Coomassie. Phosphoenolpyruvate carboxykinase activity detection is carried out as follows. The reaction system includes 100mM Tris-HCl buffer (pH 8.0), 5mM purified phosphoenolpyruvate carboxykinase, 0.01M MgCl2, 2mM NADH, 5mM ADP and 5U L-malate dehydrogenase, and the reaction system is 200μL in total. Use a microplate reader (Spark, Tecan) to detect the absorbance at 340nm. Calculate the reduction in NADH in the reaction system and convert it into enzyme activity. The L-malate dehydrogenase activity assay was performed as follows. The reaction system included 50mM Tris-HCl buffer (pH7.5), 4mM oxaloacetate and 2mM NADH, and the reaction system was 200μL. Use a microplate reader (Spark, Tecan) to detect the absorbance at 340nm. Calculate the reduction in NADH in the reaction system and convert it into enzyme activity.

[0069] Test results such as Figure 2 As shown, all proteins were successfully purified and of the same size. The enzyme from A. succinogenes has higher activity; Pck from E. coli background has higher activity, but Mdh activity is relatively low; Pck activity in B. subtilis is lower, but Mdh activity is relatively high. In summary, Pck and Mdh from A. succinogenes were selected as the starting enzymes for the carbon sequestration module.

[0070] 3. Mutation screening of pathway enzyme NadB

[0071] The above table compares the characteristics of FrdABCD and NadB in catalyzing the conversion of fumarate to succinate. NadB has more advantages than FrdABCD and has the potential to replace FrdABCD as a pathway enzyme in the carbon sequestration module to catalyze the conversion of fumarate to succinate. In order to make NadB more effective in catalyzing the conversion of fumarate to succinate, a NadB genetic screening system was first constructed ( Figure 3A), the citrate synthase encoding gene gltA and the propionate-inducible methylcitrate synthase encoding gene prpC with a small amount of citrate synthase activity were knocked out. After the knockout, oxaloacetate and AcCoA cannot synthesize citrate, and then the downstream essential amino acid glutamate cannot be synthesized, resulting in the inability of the strain to grow. If the constructed carbon sequestration module step works, that is, succinic acid is catalyzed by NadB to form succinic acid, and then succinic acid reacts with glyoxylic acid to form isocitrate through the catalysis of isocitrate enzyme AceA, which can further catalyze the formation of glutamate, thereby promoting the growth of the strain.

[0072] To verify whether the constructed genetic screening system can be used for mutation screening of NadB, the strains with knockout of gltA and prpC were spread on the screening solid culture medium plate, and almost no single colony grew in the plate ( Figure 3 B). When the E. coli nadB gene EcnadB was overexpressed in the gltA and prpC knockout strain, single colonies grew on solid culture plates, but the colonies were small ( Figure 3 This indicates that NadB has the potential to replace FrdABCD, but the catalytic performance of NadB towards fumarate needs to be further improved. When glutamate was added to the strains with knockout gltA and prpC and overexpression of nadB, the colony size was significantly increased ( Figure 3 D), which shows that glutamate can improve the growth of the defective strain, that is, the growth of the strain can be promoted by the glutamate produced by the carbon sequestration module step. In summary, the constructed genetic screening system can screen NadB mutants in a growth-coupled manner. Screening solid culture medium formula: 14g / L K2HPO4·3H2O, 5.2g / L KH2PO4, 1g / L NaCl, 1g / L NH4Cl, 0.5g / L MgSO4·7H2O, 2wt% glucose, 10mM glyoxylic acid, sodium aspartate and sodium fumarate respectively, 1.5wt% agar powder.

[0073] After the genetic screening system for glutamate deficiency was established, NadB was mutated as follows. The NadB template fragment was amplified using the degenerate primers NDT-VMA-ATG-TGG. The mutation sites included the amino acid sites within 5 angstroms around the substrate and the previously reported NadB substrate binding and active sites, totaling 16 (Q50, G51, G52, E121, H244, L257, L258, T259, E260, A261, R290, H351, L386, S389, S391 and L392). The amplified product was digested with Dpn I enzyme, transformed into Q4274 competent cells, and spread on the screening solid culture medium culture dish. When a single colony grew out, the single colony was inoculated into a 96-well plate liquid screening medium and cultured at 37°C and 180rpm. After one day of cultivation, the growth of the strain was detected at 600nm using an ELISA reader (Spark, Tecan), and the control strain was a strain containing the original EcnadB. Each test included 6 control strains, and the ELISA reader scanned 3 times to eliminate the influence of machine errors. The strains with better growth were sent to the sequencing company for sequencing to determine the sequence of the mutation site, and at the same time, a 50mL liquid screening medium was shaken for rescreening. Liquid screening medium formula: 14g / L K2HPO4·3H2O, 5.2g / L KH2PO4, 1g / L NaCl, 1g / L NH4Cl, 0.5g / L MgSO4·7H2O, 2% glucose, 10mM glyoxylic acid and sodium aspartate, respectively.

[0074] After preliminary screening of saturation mutations at the above 16 sites, it was found that single-site mutations at G51, L257, L258, and S391 of EcNadB had the best effects ( Figure 4 A in the figure). Then, EcNadB was subjected to combined saturation mutation of the above sites. At the same time, nadB genes from seven other different host sources were synthesized, including Piromyces finnis, Pseudomonasputida KT2440, Sulfolobus tokodaii, Thermococcus litoralis DSM 5473, Chlorobiumtepidum, Synechocystis sp.PCC 6803, and Methylococcus capsulatus. The effects of combined saturation mutation of EcNadB and nadB genes from other natural microorganisms were evaluated. The results are shown in the figure. Figure 4As shown in A in the figure. For EcNadB, the combined mutation of L257 and L258 has a better effect. For NadB from other hosts, PpNadB from Pseudomonasputida KT2440 has a better effect. However, when the nadB gene is overexpressed alone, the overall promotion effect is not obvious. We selected EcNadB (L257C, L258I), EcNadB (L258I, L257C, S391A) and EcNadB (L258I, G51E, L257C, S391A), which have relatively good mutation combinations when the nadB gene is overexpressed alone, as well as nadB from other different hosts, and overexpressed them together with the aceA gene. The results are as shown below. Figure 4 As shown in B, the effects of EcNadB (L257C, L258I) and PpNadB were still good, and their OD values ​​were 1.31 times and 1.54 times that of the control EcNadB, respectively.

[0075] Since EcNadB and PpNadB have certain similarities, it is speculated that mutations at sites 257 and 258 of PpNadB may also have a good promoting effect. Therefore, a second round of saturation mutations at sites 257 and 258 of PpNadB was performed using the degenerate primers NDT-VMA-ATG-TGG. The results of the rescreening test are as follows Figure 5 . Compared with EcNadB (L257C, L258I), the mutation of PpNadB (L257C) did not significantly change the growth promotion compared with PpNadB. The combined mutation of PpNadB (L257C, I258C) had the best effect. This shows that for PpNadB, only when the L257 and L258 sites are mutated at the same time will it have a promoting effect on growth. The growth OD of the PpNadB (L257C, I258C) strain is 1.56 times that of EcNadB. When aceA is overexpressed at the same time, the OD of the former strain is 2.02 times that of the latter.

[0076] 4. Construction of the Athena pathway

[0077] Athena consists of a carbon sequestration module and an energy generation module. The energy generation module is completed by two background enzymes, namely pyruvate kinase Pyk and pyruvate dehydrogenase AceE. The metabolic pathway is short. Therefore, the core of building Athena is to complete the construction of the carbon sequestration module. The carbon sequestration module completes the basic construction through the following steps ( Figure 6): (1) Knockout the byproduct synthesis genes, including the alcohol dehydrogenase gene adhE, the pyruvate formate lyase gene pflB, the pyruvate oxidase gene poxB and the lactate dehydrogenase gene ldhA, thereby blocking the formation of heterocarbon byproducts; (2) Solve the problem of PEP molecule consumption: replace the key gene ptsHI in the PTS pathway with galP and glk; (3) Knockout the genes of the reverse reaction synthesis pathway, including ppc, mqo and maeAB. At the same time, aceB and glcB were knocked out to eliminate the ineffective cycle between malate and glyoxylate; (4) Integrate the relevant genes of the carbon sequestration module, including pck, mdh, sucCD-2, mcl, PpnadB*(PpnadB(L257C,I258C)) and acl.

[0078] Those skilled in the art should understand that the gene editing experiment of E. coli BW25113 is carried out in accordance with standard molecular cloning techniques in each step. The construction of the pTarget-ΔldhA plasmid for knocking out the ldhA gene in E. coli BW25113 is described as follows:

[0079] (1) Plasmid backbone amplification: pTaregt plasmid was used as template, pTaregtF (5'-CCTGTTATCCCTACTCGAG-3') and pTaregtF (5'-ACTAGTATTATACCTAGGACTGAGC-3') were used as primers, and Phanta Flash Master (Nanjing Novogene Biotech Co., Ltd.) was used for amplification, and the DNA was recovered after DpnI digestion.

[0080] (2) sgRNA-scaffold amplification. Using the pTarget plasmid as a template and sgRNA_ldhAF (5'-CCTAGGTATAATACTAGTTCTGATTCAGAGAACAGGGTGTTTTAGAGCTA GAAATAGCA-3') and sgRNA_ldhAR (5'-GTAATAGATCTAAGCTTCTGC-3') as primers, the sgRNA was amplified and purified using PrimeSTAR (Beijing Bio-Rad Biotechnology Co., Ltd.).

[0081] (3) Amplification of the left and right homology arms. Using the E. coli BW25113 genome as a template, PreldhAF (5'-GCATTTTCGCTTTTGTGTCCCC-3') and PrepoxBR

[0082] (5'-GACCATCGCTTACGGTCAATTGTT-3') was used as primer, amplified and purified using Phanta Flash Master.

[0083] The primers (5'-GAAGCTTAGATCTATTACGGGAGCTGTGGCAGCTATTAATTCA-3') and ldhA_HLR (5'-CCAGTATTTCTCAGACTACGCTGCAA-3'), ldhA_HRF (5'-TAGTCTGAGAAATACTGGTTCGCAGCCATTGGCAGTTTTAGC-3') and ldhA_HRR (5'-TCGAGTAGGGATAACAGGCGTGCCGACGTTCAATAACCAG-3') were used for amplification and purification using Phanta Flash Master to obtain the left and right homology arm fragments, respectively.

[0084] (4) Multi-fragment in vitro recombination. According to the instructions of the in vitro multi-fragment recombination kit (Seamless Cloning Kit, Nanjing Novozyme Biotechnology Co., Ltd.), the above four fragments were recombined, and the reaction products were transformed into E. coli DH5α and cultured on spectinomycin plates. The colony was used as a template and pF (5'-ACATGAAGCACTTCACTGAC-3') and pR

[0085] (5'-TTGACAGCTAGCTCAGTCCTAGGTATAATAC-3') was used as primer, and colony PCR verification was performed with Rapid Taq Mix. The positive colonies were sequenced with primers pF and pR to confirm that they were correctly preserved, thus obtaining the plasmid pTarget-ΔldhA for ldhA gene knockout.

[0086] According to a similar method as above, plasmids for knocking out genes such as adhE, pflB, poxB, ldhA, ptsHI, ppc, mqo, maeAB, aceB, and glcB were constructed.

[0087] The sgRNAs selected for gene editing are shown in Table 3.

[0088] Table 3 sgRNA sequences used for gene editing

[0089]

[0090]

[0091] Example 2: Validation of the Escherichia coli tunable hybrid central network (Athena)

[0092] 1. Verification of Acetyl-CoA Nutritional Deficiency

[0093] After completing the basic construction of the carbon sequestration module, the operation of the constructed module is verified. First, aceE is knocked out. Those skilled in the art should understand that the gene editing experiment of Escherichia coli BW25113 is carried out in accordance with standard molecular cloning techniques. The sgRNA sequence used for aceE gene editing is: GCTCAGCGTCAGAAACTGCA.

[0094] The main verification method is as follows: Streak the relevant strains from the -80℃ refrigerator onto LB solid culture dishes and activate them in a 37℃ incubator. After a single colony grows, inoculate it in a 4mL LB test tube and culture it overnight. Wash three times with sterile phosphate buffer (PBS, 0.01M, pH7.2-7.4), and transfer to M9 basic medium for culture. The formula of M9 basic medium is 14g / L K2HPO4·3H2O, 5.2g / L KH2PO4, 1g / L NaCl, 1g / L NH4Cl, 0.5g / L MgSO4·7H2O, 2% glucose. For the control strain, add 0, 12.5 and 25mM potassium acetate solutions respectively. The relevant strains are placed in an automatic growth curve measuring instrument for OD 600 Conduct testing.

[0095] By constructing an acetyl-CoA auxotrophic strain, we verified whether the constructed pathway could bypass the decarboxylation process of pyruvate ( Figure 7 A in Figure 7 As shown in B, after the aceE gene was knocked out, the strain could not grow normally in the basic medium due to the lack of the main source of acetyl-CoA. After adding potassium acetate (KAc) as the source of acetyl-CoA, the recombinant strain showed a growth state. After knocking out aceE and loading the constructed Athena at the same time, the strain still showed a growth state without exogenous addition of KAc, which shows that the constructed recombinant strain can bypass the decarboxylation process of pyruvate, which relies on the carbon sequestration module as the source of acetyl-CoA, that is, at least Mcl played a role in the pathway, catalyzing maloyl-CoA to produce glyoxylate while generating acetyl-CoA.

[0096] 2. Verification of L-aspartate nutritional deficiency

[0097] To further verify that the Athena pathway can operate completely, all the genes of the source pathway of the background oxaloacetate in E. coli (ppc, pck, mdh, mqo, citE) were knocked out. Those skilled in the art should understand that the gene editing experiment of E. coli BW25113 mentioned above was carried out in accordance with standard molecular cloning techniques. The sgRNA sequence used for ppc gene editing: CGACTACGAAAGCTGGTCAG; the sgRNA sequence used for pck gene editing: CCTGTCTCAGGAGAATGAAC; the sgRNA sequence used for mdh gene editing: AGCGTTATTGGTGGTCACAG; the sgRNA sequence used for mqo gene editing: GGACGTGGTTAATCACCATC; the sgRNA sequence used for citE gene editing: CTGCGTATCGAAAAAGCCTG.

[0098] The main verification method is as follows: streak the relevant strains from the -80℃ refrigerator onto a culture dish containing LB solid medium (5g / L yeast extract, 10g / L tryptone, 10g / L NaCl, 1.5wt% agar powder) and activate it in a 37℃ incubator. After a single colony grows, inoculate it into a test tube containing 4mL LB liquid medium (5g / L yeast extract, 10g / L tryptone, 10g / LNaCl) and culture it overnight. Wash it three times with sterile phosphate buffer (PBS, 0.01M, pH7.2-7.4) and transfer it to the basic medium for culture. The basic medium formula is 14g / L K2HPO4·3H2O, 5.2g / L KH2PO4, 1g / LNaCl, 1g / L NH4Cl, 0.5g / L MgSO4·7H2O, 2% glucose, 10mM L-sodium malate solution. The relevant strains were placed in an automatic growth curve measuring instrument to measure OD 600 Conduct testing.

[0099] Through the above, an aspartate auxotrophic strain ( Figure 7 C in the medium). L-malate was added to the basic medium to explore whether the constructed carbon sequestration pathway can catalyze L-malate to ultimately produce oxaloacetate, the precursor of aspartate ( Figure 7 C in the figure). Since the efficiency of L-malic acid entering E. coli cells is low, this study also overexpressed the C4-dicarboxylate transporter DctP from B. subtilis to improve the absorption of L-malic acid by the recombinant strain. Figure 7As shown in D, after knocking out the genes of the background oxaloacetate source pathway, the strain still could not grow in the basic medium even if dctP was overexpressed and L-malic acid was added, which indicates that the strain cannot use L-malic acid to replenish aspartic acid. After the aspartate auxotrophic strain was loaded with the constructed carbon sequestration pathway, the recombinant strain showed a growth state. This shows that the carbon sequestration pathway is running, and L-malic acid is finally converted into oxaloacetate, and then aspartic acid is replenished. In summary, the constructed Athena pathway operates and functions normally in Escherichia coli.

[0100] Example 3: Identification and optimization of key genes in the Escherichia coli tunable hybrid central network (Athena)

[0101] The key genes of the pathway were explored. Since the carbon sequestration pathway is the pathway for the production of acetyl-CoA, in strains that cannot grow after the aceE gene is knocked out, this pathway serves as a source of acetyl-CoA and promotes the growth of the strain. Based on the strain with aceE knocked out and the Athena pathway gene integrated, each gene in the pathway was overexpressed on the plasmid and the growth of the strain was tested.

[0102] Those skilled in the art should understand that the above plasmid construction experiment, each step is carried out according to standard molecular cloning technology. The plasmid can be pACYCDuet-1, the promoter can be P j23119 (For the construction method of plasmid, refer to Cao Y, et al. Improved phloroglucinol production by metabolically engineered Escherichiacoli. Appl Microb Biotechnol 2011, 91(6): 1545-1552.) The plasmids overexpressing genes related to the above pathways were transformed into strains integrated with the basic Athena pathway by heat shock method.

[0103] like Figure 8 As shown in the figure, when pck, fumAC and aceA were overexpressed separately in the plasmid, the growth of the strain was better than that of the strain with basic integration of the pathway. This shows that these genes may be key genes for the carbon sequestration pathway. It was also noted that when fumAC was overexpressed, the growth of the strain was improved compared with the basic integration strain of the pathway, while when mtk was overexpressed, the OD of the strain decreased. FumAC and Mtk are enzymes that catalyze the production of fumaric acid and malic acid acyl-CoA branches, respectively, indicating that the metabolic flow of the branch where malic acid is catalyzed by FumAC to produce fumaric acid is relatively low. Enhancing the expression of fumAC may be more conducive to the relative balance of metabolic flows between the fumaric acid and malic acid acyl-CoA branches, thereby promoting the growth of the strain.

[0104] After confirming that pck, fumAC, and aceA are key genes in the pathway, we proceeded to overexpress these genes simultaneously on the plasmid. Figure 8 As shown in Figure 2, the growth of the strain was significantly improved, and its OD 600 It is 1.58 times that before optimization. In summary, we identified the key genes of the Athena pathway by growth coupling, and significantly improved the performance of the Athena pathway by combined overexpression on plasmids, promoting the growth of the strain.

[0105] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations, such as replacing with other strains, or replacing genes in the pathway with other genes with similar functions. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway, characterized in that: Using Escherichia coli as the starting strain, the alcohol dehydrogenase gene adhE, pyruvate formate lyase gene pflB, pyruvate oxidase gene poxB, lactate dehydrogenase gene ldhA, phosphate carrier protein HPr genes ptsH and ptsI, phosphoenolpyruvate carboxylase gene ppc, malate:quinone oxidoreductase gene mqo, malate dehydrogenase genes maeA and maeB, malate synthase A gene aceB, and malate synthase G gene glcB were knocked out of the Escherichia coli genome; at the same time, galactose:H + The transporter gene galP, glucose kinase gene glk, phosphoenolpyruvate carboxykinase gene pck, malate dehydrogenase gene mdh, malate thiokinase Mtk genes sucC-2 and sucD-2, malyl-CoA lyase gene mcl, L-aspartate oxidase gene nadB and ATP-citrate lyase genes aclA and aclB were obtained.

2. The hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway according to claim 1, characterized in that: The Escherichia coli is Escherichia coli BW25113.

3. The hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway according to claim 1, characterized in that: The GenBank accession of the alcohol dehydrogenase gene adhE is AIN31697.1; the GenBank accession of the pyruvate formate lyase gene pflB is AIN31371.1; the GenBank accession of the pyruvate oxidase gene poxB is AIN31340.1; the GenBank accession of the lactate dehydrogenase gene ldhA is AIN31834.1; the GenBank accession of the phosphate carrier protein HPr gene ptsH is 682119888, and the GenBank accession of ptsI is 682119889; the GenBank accession of the phosphoenolpyruvate carboxylase gene ppc is 682121328; the GenBank accession of the malate:quinone oxidoreductase gene mqo is 682119695; the GenBank accession of the malate dehydrogenase gene maeA is 682118999, and the GenBank accession of maeB is The GenBank accession number of the malate synthase A gene aceB is 682121374; the GenBank accession number of the malate synthase G gene glcB is 682120406; the galactose:H + The GenBank accession of the transporter gene galP is 682120377; the GenBank accession of the glucose kinase gene glk is 682119868; the GenBank accession of the phosphoenolpyruvate carboxykinase gene pck is ABR73601.1; the GenBank accession of the malate dehydrogenase gene mdh is 150840995; the GenBank accession of the malate thiokinase Mtk gene sucC-2 is 53757685, and the GenBank accession of sucD-2 is 53757684; the GenBank accession of the malyl-CoA lyase gene mcl is ABA77918.1; the GenBank accession of the L-aspartate oxidase gene nadB is WP_010952532.1; the GenBank accession of the ATP-citrate lyase gene aclA is The GenBank accession number is 21647055, and the GenBank accession number of aclB is 21647054.

4. The hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway according to claim 1, characterized in that: The hybrid central metabolic network chassis cell also includes a fumarase A gene fumA, a fumarase C gene fumC and an isocitrate lyase gene aceA derived from Escherichia coli BW25113 overexpressed in a plasmid; the GenBank accession of the fumarase A gene fumA is 682119124; the GenBank accession of the fumarase C gene fumC is 682119123; and the GenBank accession of the isocitrate lyase gene aceA is 682121375.

5. The method for constructing a hybrid central metabolic network chassis cell having both carbon atom economy and energy generation pathway according to any one of claims 1 to 4, characterized in that: The steps include: S1, knock out the alcohol dehydrogenase gene adhE, pyruvate formate lyase gene pflB, pyruvate oxidase gene poxB, and lactate dehydrogenase gene ldhA on the Escherichia coli genome respectively; replace the phosphate carrier protein HPr genes ptsH and ptsI on the genome with galactose:H + transporter gene galP and glucose kinase glk; knock out the phosphoenolpyruvate carboxylase gene ppc, malate:quinone oxidoreductase gene mqo, malate dehydrogenase genes maeA and maeB, malate synthase A gene aceB, and malate synthase G gene glcB on the genome to obtain mutant strain I; S2, screening the activities of phosphoenolpyruvate carboxykinase Pck and malate dehydrogenase Mdh in different hosts; inserting the phosphoenolpyruvate carboxykinase gene pck and malate dehydrogenase gene mdh with the highest activity into the genome of mutant strain I obtained in S1 to obtain mutant strain II; S3. Knock out the citrate synthase encoding gene gltA and the methyl citrate synthase encoding gene prpC in the genome of Escherichia coli BW25113, and construct a genetic screening system for L-aspartate oxidase NadB; use degenerate primers to mutate NadB, and screen mutants using the constructed NadB genetic screening system; sequence the mutant with the best effect, and insert it into the genome of the obtained mutant strain II to obtain mutant strain III; S4. On the basis of mutant strain III, the remaining pathway-related genes are integrated, including malate thiokinase Mtk genes sucC-2 and sucD-2, malyl-CoA lyase gene mcl, and ATP-citrate lyase genes aclA and aclB, to obtain the hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway.

6. The construction method according to claim 5, characterized in that: The Escherichia coli is Escherichia coli BW25113; the method of step S1 comprises: designing a sgRNA sequence targeting a target gene, using CRISPR / Cas9 to knock out the alcohol dehydrogenase gene adhE, the pyruvate formate lyase gene pflB, the pyruvate oxidase gene poxB, and the lactate dehydrogenase gene ldhA on the genome of the starting strain Escherichia coli BW25113 respectively; replacing the phosphate carrier protein HPr genes ptsH and ptsI on the genome with galactose:H + transporter gene galP and glucose kinase glk; knock out the phosphoenolpyruvate carboxylase gene ppc, malate:quinone oxidoreductase gene mqo, malate dehydrogenase genes maeA and maeB, malate synthase A gene aceB, and malate synthase G gene glcB on the genome to obtain mutant strain I.

7. The construction method according to claim 5, characterized in that: In step S2, the host source of the phosphoenolpyruvate carboxykinase pck includes Actinobacillus succinogenes, Bacillus subtilis, Lactiplantibacillus plantarum or Mannheimia succiniciproducens; the host source of the malate dehydrogenase mdh includes Bacillus subtilis, Actinobacillus succinogenes, Lactiplantibacillus plantarum or Corynebacterium glutamicum; Specifically, the method of step S2 comprises: using CRISPR / Cas9 to insert the phosphoenolpyruvate carboxykinase gene pck and the malate dehydrogenase gene mdh with the highest enzyme activity from Actinobacillus succinogenes into the genome of mutant strain I, replacing the background pck and mdh genes of Escherichia coli, and the promoter is P j23119 .

8. The construction method according to claim 5, characterized in that: In step S3, an sgRNA sequence targeting the target gene is designed, and CRISPR / Cas9 is used to knock out the citrate synthase encoding gene gltA and the methyl citrate synthase encoding gene prpC on the genome of the starting strain Escherichia coli BW25113, respectively; the mutation sites of NadB include Q50, G51, G52, E121, H244, L257, L258, T259, E260, A261, R290, H351, L386, S389, S391 and L392.

9. The construction method according to claim 5, characterized in that: In step S4, CRISPR / Cas9 is used to integrate the malate thiokinase Mtk genes sucC-2 and sucD-2, the malyl-CoA lyase gene mcl, and the ATP-citrate lyase genes aclA and aclB into the genome, thereby obtaining the hybrid central metabolic network chassis cell with both carbon atom economy and energy generation pathway.

10. Use of the hybrid central metabolic network chassis cell according to any one of claims 1 to 4 or the hybrid central metabolic network chassis cell constructed by the construction method according to any one of claims 5 to 9 in fixing carbon dioxide and synthesizing acetyl-CoA derivatives.

Images