Preparation of cinnamyl aldehyde-loaded solid-liquid two-phase artificial cell and application of cinnamyl aldehyde-loaded solid-liquid two-phase artificial cell in targeted

Abstract

Provided is a cinnamyl aldehyde-loaded solid-liquid biphasic artificial cell (SL-BACs) which has a solid-phase protective film and a liquid multicore, and which is efficiently and stably produced using a microfluidic T-type chip. The SL-BACs can provide multi-aspect treatment assistance for colitis induced by salmonella typhimurium. Firstly, an aptamer in a liquid multinuclear shows accurate targeting at an infected part; secondly, the encapsulation efficiency of the SL-BACs on the cinnamyl aldehyde is relatively high, and is about 82.9 percent; thirdly, the intestinal retention time of the SL-BACs is prolonged to 15 h through the membrane structure; in addition, the SL-BACs show pH responsiveness, liquid multi-core antibiosis is controlled to be released, and the sterilization rate is 95.28%. The SL-BACs can also reduce the secretion of proinflammatory cytokines, optimize the composition of intestinal microbiota and maintain the steady state of the intestinal tract. In a word, the SL-BACs provide necessary conditions for modularizing the artificial cells into an oral system for targeted therapy.

Description

Technical Field

[0001] The invention belongs to the field of biomaterials, and particularly relates to the preparation of solid-liquid biphase artificial cells loaded with cinnamaldehyde and their application in targeted treatment products for enteritis. Background Art

[0002] The gastrointestinal tract is essential for nutrient absorption and immune defense. However, as the main interface between the body and the external environment, it is particularly vulnerable to foodborne pathogens, leading to infections and diarrheal diseases. These diseases have a significant impact on health and economic stability, with the World Health Organization reporting that unsafe food causes 550 million cases of diarrheal illness each year. One of the main causes is Salmonella Typhimurium, which damages intestinal tissue and the gut microbiota, causing severe gastrointestinal problems such as abdominal pain, diarrhea, and vomiting. S. Typhimurium invades by adhering to and colonizing tissues, forming vesicles containing the pathogen. S. Typhimurium is a major cause of acute gastroenteritis and is commonly found in the intestines of animals and transmitted to humans through contaminated food and water. Antibiotics are the main treatment for S. Typhimurium disease, but their effectiveness is limited by their nonspecific anti-inflammatory effects, increasing antibiotic resistance, and poor targeting, leading to health problems.

[0003] Oral therapy has shown efficacy in treating intestinal bacterial infections; however, it faces significant challenges, including resistance to harsh gastric conditions, low drug bioavailability, insufficient targeting, nonspecific distribution, and potential side effects. In recent years, artificial cell-based drug delivery systems have attracted widespread attention due to their unique biomimetic design and multifunctional capabilities. Artificial cells are engineered particles designed to mimic biological cells and are manufactured using natural or synthetic materials. By engineering artificial cells to have precise targeting functions and employing environmentally responsive materials, drugs can be accurately delivered to pathological sites, thereby improving their bioavailability and therapeutic efficacy. Summary of the invention

[0004] One of the purposes of the present invention is to provide a solid-liquid biphasic artificial cell (SL-BACs) loaded with cinnamaldehyde, which is engineered to have a precise targeting function and adopts environmental responsive materials, so that the drug can be accurately delivered to the pathological site of enteritis, thereby improving the bioavailability and therapeutic effect of the drug.

[0005] The second object of the present invention is to provide a method for preparing solid-liquid biphase artificial cells (SL-BACs) loaded with cinnamaldehyde, which has simple process and low cost.

[0006] The third object of the present invention is to provide an application of solid-liquid biphase artificial cells (SL-BACs) loaded with cinnamaldehyde.

[0007] To achieve the above objectives, the present invention provides a Salmonella typhimurium nucleic acid aptamer, characterized in that the nucleic acid aptamer sequence is shown in SEQ ID NOs. 2-10.

[0008] On the other hand, the present invention provides a cinnamaldehyde nucleic acid aptamer, characterized in that the nucleic acid aptamer sequence is shown in SEQ ID NOs.11-15.

[0009] On the other hand, the present invention provides a solid-liquid biphase artificial cell loaded with cinnamaldehyde, characterized in that the solid-liquid biphase artificial cell comprises a solid phase part and a liquid multi-core part; the solid phase part is formed by cross-linking polysaccharides and solidifying by ion diffusion; the liquid multi-core part contains a water-soluble liquid phase and a water-insoluble oil phase.

[0010] The solid phase part comprises sodium alginate, quaternary ammonium salt chitosan and calcium ions; the liquid multi-core part comprises an aptamer and cinnamaldehyde; the aptamer sequence is: 5'-CAGGAGGTAGGGTCTGGAGAATGGTTTCACTGTTCACTCCCCTTCCGCATCACTGTTCACTCC CCTTCCGCAT-3', as shown in SEQ ID NO.16.

[0011] On the other hand, the present invention provides a method for preparing a solid-liquid biphase artificial cell loaded with cinnamaldehyde, and the preparation method of the solid-liquid biphase artificial cell is as follows: adding an aptamer to a buffer solution, cooling on ice for 10 minutes after denaturation; adding a cinnamaldehyde solution, and stirring the mixture in the dark; adding 0.2 mL of quaternary ammonium salt chitosan and magnetically stirring; adding 0.2 mL of sodium alginate, and incubating for several hours with magnetic stirring; using a microfluidic chip with a T-shaped shear channel, introducing the generated droplets into a calcium chloride solution through the channel to induce solidification into a solid-liquid biphase artificial cell loaded with cinnamaldehyde; and collecting the solid-liquid biphase artificial cells and washing them twice.

[0012] The aptamer sequence is: 5'-CAGGAGGTAGGGTCTGGAGAATGGTTTCACTGTTCACTCCCCTTCCGCATCACTGTTCACTC CCCTTCCGCAT-3', as shown in SEQ ID NO.16; the final concentration of the aptamer is 10pmol / L-100nmol / L; the mass concentration of the quaternary ammonium salt chitosan is 0.05-0.3%; the mass concentration of the sodium alginate is 0.05-0.5%; the mass concentration of the calcium chloride is 1.5-5.5%; the microfluidic chip has two inlets, which are used for the dispersed phase and the continuous phase respectively; the dispersed phase is a mixture of sodium alginate-quaternary ammonium salt chitosan, the aptamer and cinnamaldehyde solution; the continuous phase is nitrogen; the airflow in the microfluidic chip applies shear stress to the mixed liquid flow in the T-shaped shear channel, and the flow rates of the nitrogen and the mixed liquid are adjusted, the nitrogen flow rate is 0.5m / s, and the mixed liquid flow rate is 0.1m / s.

[0013] On the other hand, the present invention provides the use of the Salmonella typhimurium nucleic acid aptamer in a food safety detection reagent and / or a Salmonella detection kit.

[0014] On the other hand, the present invention provides the use of the cinnamaldehyde nucleic acid aptamer in a cinnamaldehyde biosensor, a detection kit, and a detection reagent.

[0015] On the other hand, the present invention provides the use of the solid-liquid biphasic artificial cell loaded with cinnamaldehyde in the preparation of a medicine or product for preventing and / or treating gastrointestinal diseases.

[0016] On the other hand, the present invention provides application of the preparation method in the preparation of solid-liquid biphase artificial cells.

[0017] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0018] The present invention uses gas shearing technology to design and manufacture solid-liquid biphasic artificial cells (SL-BACs), which exhibit multiple functions, including targeted antibacterial activity, strong anti-inflammatory effects, enhanced prebiotic absorption, intestinal tissue repair, and regulation of intestinal microbiota. SL-BACs are used to alleviate enteritis caused by Salmonella typhimurium through oral administration, and the main advantages are as follows:

[0019] (I) Targeting: A portion of the liquid multicore, CAB-3T, was screened and evaluated and demonstrated its ability to precisely target and inhibit the growth of Salmonella Typhimurium at the site of infection.

[0020] (ii) Controlled release: SL-BACs resist degradation in the acidic gastric environment and gradually degrade in the intestinal environment according to pH conditions, releasing liquid polynuclear cells.

[0021] (III) Improved bioavailability: Due to its colon-specific adhesion properties, the formulation can extend the local drug retention time to 15 hours. In addition, SL-BACs mitigate the irritation of cinnamaldehyde, reduce gastric irritation, minimize the loss caused by gastric acid, prevent the oxidative denaturation of cinnamaldehyde, and improve its storage stability.

[0022] (IV) Intestinal tissue repair: SL-BACs modulated intestinal immune inflammation and regulated the intestinal microbiota.

[0023] In summary, the present invention enhances existing therapeutic approaches and provides new insights into future drug design and development. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The expression and purification of Salmonella typhimurium flagellin, as well as the SELEX and truncation of aptamers for Salmonella typhimurium. A is a western blot analysis showing the expression of Salmonella typhimurium flagellin; B is the preliminary determination of the binding strength of 10 candidate aptamers to Salmonella typhimurium flagellin using qPCR (average fluorescence intensity of FITC). C is the preliminary determination of the binding strength of 10 candidate aptamers to Salmonella typhimurium using qPCR. D is the binding affinity of 7 candidate aptamers determined by flow cytometry. E is the binding fluorescence intensity of different truncations of 12-17-1 to Salmonella typhimurium flagellin. F is the binding fluorescence intensity of tandem aptamers determined by fluorescence spectrophotometer. G is the binding affinity of bivalent aptamer T23-2 determined by flow cytometry. H is the binding strength of bivalent aptamer T23-2 to Salmonella typhimurium under different treatments determined by flow cytometry. I shows the molecular docking of the bivalent aptamer T23-2 and the flagellin of Salmonella typhimurium.

[0025] Figure 2 The expression conditions of Salmonella typhimurium flagellin are optimized. A is the optimization of the expression temperature of Salmonella typhimurium flagellin by Coomassie Brilliant Blue staining; B is the optimization of the IPTG concentration expression conditions of Salmonella typhimurium flagellin by Coomassie Brilliant Blue staining; C is the analysis of the purification effect of Salmonella typhimurium flagellin by Coomassie Brilliant Blue staining; D is the construction of a standard curve to determine the concentration of Salmonella typhimurium flagellin.

[0026] Figure 3Figure 1 is the high-throughput sequencing result of aptamer pool 10 and aptamer pool 12. Figure 2 is the high-throughput sequencing result of aptamer pool 10 and aptamer pool 12. Figure 3 is the high-throughput sequencing result of aptamer pool 10 and aptamer pool 12. Figure 4 is the high-throughput sequencing result of aptamer pool 10 and aptamer pool 12. Figure 5 is the high-

[0027] Figure 4 The binding specificity of 10 candidate aptamers to 6 different mixed bacteria was determined by qPCR.

[0028] Figure 5 Figure 2 is the truncation of cinnamaldehyde-specific aptamers and the connection of Salmonella typhimurium aptamers and cinnamaldehyde aptamers. A is the determination of the binding affinity of different CA55 truncations to cinnamaldehyde by fluorescence spectrometry. B is the determination of the binding affinity of CAB-3T to Salmonella typhimurium by flow cytometry. C is the determination of the binding specificity of CAB-3T to different bacteria by flow cytometry. D is the determination of the binding strength of CAB-3T to different strains of Salmonella typhimurium by flow cytometry. E is the determination of the binding effect of CAB-3T to cinnamaldehyde by colorimetry using gold nanoparticles (AuNPs). F is the determination of the binding affinity of CAB-3T to cinnamaldehyde by colorimetry using AuNPs.

[0029] Figure 6 is the secondary structure of the ligated aptamer.

[0030] Figure 7 The invention discloses the preparation principle and application of a solid-liquid biphase artificial cell.

[0031] Figure 8 The preparation and characterization of SL-BACs. A is a photograph of SL-BACs, a magnified image, a representative optical microscope image, and the size distribution of the obtained SL-BACs. B is a representative optical microscope image of an artificial cell without liquid multinuclei. C and D are element distribution diagrams of SL-BACs. E is a characterization of the binding effect of CAB-3T and QCS at different times using agarose gel electrophoresis. F is a characterization of the immersion of CAB-3T in artificial colon fluid (ACF) at different times using agarose gel electrophoresis. G is the peak area of ​​the added cinnamaldehyde measured by gas chromatography. H is the peak area of ​​the pH-responsive release of cinnamaldehyde in SL-BACs measured by gas chromatography. I is a representative photo showing the morphological changes of SL-BACs in artificial gastric fluid (AGF, pH 1.0), artificial small intestinal fluid (ASF, pH 6.8), and artificial colon fluid (ACF, pH 7.8). J is a representative optical microscopy image showing the morphological changes of SL-BACs in artificial gastric fluid (AGF, pH 1.0), artificial small intestinal fluid (ASF, pH 6.8), and artificial colon fluid (ACF, pH 7.8) (scale bar, 100 μm).

[0032] Fig. 9 Optimization of the concentration of reagents for preparing Apt-CHM. A shows the release changes of microbeads cross-linked with different concentrations of calcium chloride (0.5, 1.0, 2.0, 4.0, 6.0%) after immersion in artificial gastric fluid (AGF, pH 1.0) for 2 hours, artificial small intestinal fluid (ASF, pH 6.8) for 4 hours, and artificial colonic fluid (ACF, pH 7.8) for 72 hours. B shows the release changes of microbeads cross-linked with different concentrations of sodium alginate (SA) (0.2, 0.4, 0.6, 0.8, 1.0%) after immersion in artificial gastric fluid (AGF, pH 1.0) for 2 hours, artificial small intestinal fluid (ASF, pH 6.8) for 4 hours, and artificial colonic fluid (ACF, pH 7.8) for 72 hours. C is the release change of microbeads formed by cross-linking chitosan quaternary ammonium salt (QCS) with different concentrations (0.1, 0.2, 0.3, 0.4, 0.5%) after immersion in artificial gastric fluid (AGF, pH 1.0) for 2 h, artificial small intestinal fluid (ASF, pH 6.8) for 4 h, and artificial colon fluid (ACF, pH 7.8) for 72 h.

[0033] Fig.10 Agarose gel characterization of CAB-3T after cleavage of SL-BACs in ACF.

[0034] Fig.11 The antibacterial effect and biocompatibility of SL-BACs. A is the antibacterial activity against Salmonella typhimurium (10 10 CFU / mL). B is the relative activity of bacteria analyzed by measuring OD600 to determine the antibacterial activity against Salmonella typhimurium (10 10 CFU / mL). C is a representative image of the antibacterial effect of SL-BACs supernatant immersed in artificial gastric fluid (AGF, pH 1.0), artificial small intestinal fluid (ASF, pH 6.8) and artificial colonic fluid (ACF, pH 7.8) for different times. D is the result of SL-BACs cytotoxicity against Caco2 and NCM460 cells measured using the CCK8 kit. E is the live / dead cell staining results after Caco2 and NCM460 cells were co-incubated with SL-BACs observed by confocal laser scanning microscopy (green, Calcein-AM, live cells; red, PI, dead cells).

[0035] Fig.12 A is the antibacterial effect of sodium alginate evaluated by the inhibition zone method; B is the antibacterial effect of chitosan determined by the coating plate method; C is the antibacterial effect of aptamer CAB-3T evaluated by the inhibition zone method.

[0036] Fig.13The antibacterial effects of SL-BACs and liquid polynuclear CA (free CA) at different time intervals were evaluated using the spread plate method.

[0037] Fig.14 Figure 2 is the therapeutic effect of oral SL-BACs on Salmonella typhimurium-induced colitis in rats. A is the fluorescence distribution outside the gastrointestinal tract of healthy rats and rats with Salmonella typhimurium-induced colitis 1, 3, 8, 15 and 24 hours after oral administration of indocyanine green-modified SL-BACs. B is a schematic diagram of the animal experimental scheme. C is a detailed record and analysis of daily body weight changes, n = 6. D is the calculation and analysis of daily disease activity index (DAI) scores in different groups, n = 6. E is the ratio of spleen weight in different groups, n = 6. F is the quantification of colon length in different groups, n = 6. G is a representative photo of the rat anus, and the red circle indicates diarrhea and redness. H is a representative digital photo of the colon morphology and length of different groups, and the red circle shows severe inflammation, n = 6. I is a hematoxylin and eosin (H&E) stained image of colon tissue in different groups (scale bar = 100 μm).

[0038] Fig.15 SL-BACs inhibit intestinal inflammation. A) Live / dead cell staining of bacteria treated with supernatant released by SL-BACs in artificial colonic fluid (ACF), observed by confocal laser scanning microscopy (green, cinnamaldehyde lcein-AM, live cells; red, PI, dead cells). B) Scanning electron microscopy (SEM) images of Salmonella typhimurium treated with supernatant released by SL-BACs in ACF at different time points. C) Immunohistochemical staining image showing myeloperoxidase (MPO) (scale bar = 100 μm). D) Representative immunohistochemical staining of proliferating cell nuclear antigen (PCNA).

[0039] Fig.16SL-BACs promote timely repair of intestinal tissue. A is immunofluorescence analysis of type 1 macrophages (DAPI blue, CD68 green, TNF-α red) and type 2 macrophages (DAPI blue, CD68 green, CD163 red) in colon tissue by confocal microscopy. B is the mRNA levels of interleukin 1 (IL-1), chemokine receptor 7 (CCR7), arginase-1 (Arg-1), transforming growth factor-beta 1 (TGF-β1), and interleukin 10 (IL-10) in colon tissue of different groups. The significance between the two groups was evaluated using the Mann-Whitney U test. ns., no significant difference; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. C is the levels of interleukin-6 (IL-6), rat interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), TGF-β1 and IL-10 in the serum of different groups. The significance between the two groups was evaluated using the Mann-Whitney U test. ns., no significant difference; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. DETAILED DESCRIPTION

[0040] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] Example 1 SELEX, tailoring and ligation of aptamers of Salmonella typhimurium and cinnamaldehyde

[0042] Protein expression: The FliC gene encoding Salmonella flagellin was ligated into the prokaryotic expression vector pET28a(+). After sequence verification, the recombinant vector was transformed into Escherichia coli BL21(DE3) competent cells to establish a prokaryotic expression system. Protein expression was induced, followed by centrifugation to collect the cell pellet. The precipitate was resuspended in bacterial lysis buffer and ultrasonically disrupted. After disruption, the lysate was centrifuged to obtain the supernatant. The supernatant was purified using Ni-NTA agarose FF. The bound protein was gradient eluted with different concentrations of imidazole (10mmol / L, 20mmol / L, 50mmol / L, 100mmol / L, 200mmol / L and 500mmol / L). Finally, the protein samples were analyzed by SDS-PAGE and western blot, and the purity of Salmonella flagellin was evaluated using Image J software. The protein concentration was quantified using the Bradford assay, with bovine serum albumin as the reference standard, and the corresponding standard curve was generated.

[0043] Magnetic beads-SELEX (MB-SELEX): The initial library (SEQ ID NO.1) contained a random region of 40 nucleotides (Table 1). In the first round, negative selection was performed first, followed by positive selection. 1 nmol of the DNA library was dissolved in 140 μL of 1× binding buffer (BB), denatured at 95°C for 3-4 minutes, and then cooled on ice for 10 minutes. The library was then incubated with magnetic beads (MB) in 200 μL of 1×BB at room temperature for 30 minutes. After magnetic separation, the unbound supernatant, i.e., the portion containing the unbound sequence, was collected. Subsequently, 200 μL of the supernatant was incubated with flagellin (2 mg / mL) bound to MB in 500 μL of 1×BB at room temperature for 1 hour. After magnetic separation again, the precipitate was collected and washed three times with 500 μL of 1×BB. Next, 500 μL of 1× Taq buffer (10 mmol / L Tris, 1.5 mmol / L MgCl2, 50 mmol / L KCl, 1% Triton X-100, pH 9.0) was incubated at 95°C for 10 minutes to elute single-stranded DNA (ssDNA) bound to flagellin. After magnetic separation, the supernatant was collected.

[0044] Cell-SELEX: 350 μL of bacterial suspension was centrifuged at 8000 rpm for 2 minutes at 4°C. The pellet was washed once with 1×BB and then resuspended in 350 μL of the same buffer. Subsequently, the suspension was mixed with 10 μL of aptamer (10 μM) in 140 μL of 1×BB and incubated for 40 minutes. Next, it was centrifuged at 10,000 rpm for 2 minutes at 4°C and then washed three times with 1×BB. The sample was resuspended in 1× Taq buffer and incubated at 95°C for 10 minutes. Centrifuged again at 10,000 rpm for 2 minutes at 4°C and the supernatant was separated. The DNA library was enriched using qPCR, and then the PCR products were analyzed using 4% agarose gel electrophoresis to optimize the number of amplification cycles. If there were impurities, the double-stranded DNA of the correct size was recovered. Subsequently, ssDNA was generated by digestion using Lambda exonuclease. After digestion, the enzyme was inactivated by incubation at 75°C for 10 minutes. Take 10 μL of the digestion product and analyze it using 12% denaturing polyacrylamide gel electrophoresis, and evaluate the digestion efficiency by gel imaging. After digestion, the resulting ssDNA library was purified by sodium acetate-ethanol precipitation and prepared for subsequent SELEX rounds. The specific steps are as follows: the digestion products were mixed, 0.1 volume of sodium acetate (3 mol / L, pH 5.2) and 2 volumes of pre-cooled anhydrous ethanol were added, gently mixed and incubated at -80°C for 3 hours. Subsequently, centrifuged at 12,000 rpm for 15 minutes at 4°C. The precipitate was collected, resuspended with 70% pre-cooled ethanol, gently mixed and centrifuged again under the same conditions. Finally, the precipitate was collected, dried at room temperature to ensure complete evaporation of ethanol, and then dissolved in an appropriate amount of TE buffer. Finally, the DNA pools of rounds 10 and 12 were cloned and sequenced. In summary, the entire selection process consisted of 12 rounds: the first 5 rounds were performed by MB-SELEX, and the next 7 rounds included 5 rounds of Cell-SELEX (rounds 6, 8, 9, 11, and 12) and 2 rounds of MB-SELEX (rounds 7 and 10). Among them, 5 rounds were designated as negative selection (rounds 1, 4, 5, 9, and 12).

[0045] like Figure 1 As shown in A, a 51.6 kDa protein with a 6×His tag was successfully obtained through induction with isopropyl-β-D-thiogalactoside (IPTG) and subsequent purification, which mainly existed in a soluble form. Western blotting confirmed its specific reaction with the His tag monoclonal antibody. The expression temperature, IPTG concentration and purification system were also optimized. SDS-PAGE electrophoresis showed that the optimal conditions for expressing Salmonella typhimurium flagellin were 16°C and 1 mmol / L IPTG. After purification using Ni-NTA agarose gel FF, the purity of the Salmonella typhimurium flagellin obtained was about 70%, and the concentration was about 2.0 mg / mL ( Figure 2). By using the Escherichia coli expression system to express the Salmonella typhimurium flagellin gene FliC, a high-purity and high-concentration Salmonella typhimurium flagellin fusion protein was successfully obtained.

[0046] Subsequently, a combination of magnetic bead-SELEX and cell-SELEX techniques was designed. The process included 12 rounds, and pools 10 and 12 were subjected to high-throughput sequencing and analysis. The distribution of abundance values ​​of sequences of different lengths showed that the sequence length was mainly concentrated at 83nt, indicating that contamination by short chains, primer dimers or large fragments was minimal, thus confirming the purity of the oligonucleotide library. The top 10 abundances of pools 10 and 12 were measured and their homology was compared. The homology between the components of the two pools was 100%, indicating that as the screening progressed, the enrichment effect of the sequences was significant, thereby identifying several specific sequences that could specifically bind to Salmonella typhimurium. Based on abundance and homology, the 20 sequences were divided into 8 families, and 10 candidate oligonucleotide sequences were identified ( Figure 3 ).

[0047] The binding strengths of 10 candidate oligonucleotides were initially determined using qPCR technology, such as Figure 1 BC. The binding trend of Salmonella typhimurium was consistent. The sequences with less differences were excluded by preliminary differentiation based on the specificity of the six mixed bacterial strains, and seven candidate oligonucleotides 10-16-2 (SEQ ID NO.2), 10-15-1 (SEQ ID NO.3), 10-15-2 (SEQ ID NO.4), 12-20 (SEQ ID NO.5), 12-17-1 (SEQ ID NO.6), 12-13-2 (SEQ ID NO.7), and 12-13-4 (SEQ ID NO.8) were identified (Table 1). Subsequently, the affinity and specificity of these oligonucleotides were measured respectively using flow cytometry. The dissociation constants (Kd) of these oligonucleotides were 82.06 nmol / μL, 73.09 nmol / μL, 63.31 nmol / μL, 62.27 nmol / μL, 62.95 nmol / μL, 70.15 nmol / μL, and 64.24 nmol / μL, respectively. Figure 1 D). Based on specific test results ( Figure 4), sequences 12-20 (SEQ ID NO.5) and 12-17-1 (SEQ ID NO.6) were identified as the most effective candidate aptamers. Subsequently, the oligonucleotides were optimized by cutting. The binding affinities of the cut sequences of 12-20 (SEQ ID NO.5) and 12-17-1 (SEQ ID NO.6) were first compared. Flow cytometric analysis showed that the truncated sequence of 12-17-1 (SEQ ID NO.6) showed superior binding affinity compared with 12-20 (SEQ ID NO.5), while 12-17-1 (SEQ ID NO.6) and its truncated sequence both showed high specificity. To further elucidate the binding site, additional truncations were performed on 12-17-1 (SEQ ID NO. 6), and flow cytometric analysis revealed three major findings: first, truncations resulted in reduced fluorescence binding intensity; second, binding intensity decreased significantly after T23; third, the absence of the 5'-CA pair in 17-T21 resulted in a significant decrease in binding intensity compared to 17-T23, highlighting the importance of 17-T23, especially the 5'-CA ( Figure 1 E).

[0048] Subsequently, in order to enhance the binding affinity, multivalent aptamers were created by tandem connection. The binding properties of trivalent aptamer T21-3 (SEQ ID NO.9) and bivalent aptamer T23-2 (SEQ ID NO.10) were evaluated. Fluorescence spectrophotometer results showed that tandem connection enhanced the binding strength, and T21-3 (SEQ ID NO.9) and T23-2 (SEQ ID NO.10) showed similar binding abilities ( Figure 1 F). Secondly, the Kd value determined by flow cytometry showed that the affinity of T23-2 (SEQ ID NO.10) (Table 1) was 52.42 nmol / L, which was superior to the affinity of T21-3 (SEQ ID NO.9) (Table 1) (62.03 nmol / L). Figure 1 G). These findings indicate that the bivalent aptamer T23-2 (SEQ ID NO.10) with high affinity and specificity was successfully obtained. In addition, flow cytometric analysis of heat-treated and protease-treated Salmonella typhimurium showed reduced binding compared to the control group, indicating that bacterial surface proteins are essential for binding ( Figure 1H). Finally, molecular docking showed that hydrogen bonding was the main force of interaction, among which bases C1, A2, C3, T4, C10, C13, C14, C15, and T46 were crucial for binding. The binding sites between the oligonucleotide and the amino acids of the protein were as follows: C1-threonine 405 and threonine 172, A2-threonine 172, C3-aspartic acid 171, T4-glycine 169 and glutamic acid 166, C10-aspartic acid 354, C13-lysine 349, C14-threonine 359, C15-threonine 347, and T46-alanine 398 ( Figure 1 I) The results confirmed that the 5'-CA of T23-2 is essential for binding.

[0049] Table 1. Aptamer sequences of Salmonella typhimurium

[0050]

[0051]

[0052] To facilitate the attachment of cinnamaldehyde to the aptamer and its subsequent formation of liquid multicores in SL-BACs, the aptamer of cinnamaldehyde was tailored to enhance its binding affinity (Table 2). The initial aptamer sequence was designated as CA55. The binding affinity was quantitatively evaluated using gold nanoparticles (AuNPs) colorimetry, and five reaction conditions were optimized: the effect of cinnamaldehyde and its solvent on color contrast, sodium chloride (NaCl) concentration, NaCl-induced aggregation time, aptamer concentration, and aptamer dispersion time. The affinities of aptamers CA55 (SEQ ID NO.11), CA31 (SEQ ID NO.12), CA24 (SEQ ID NO.13), CA17 (SEQ ID NO.14), and CA16 (SEQ ID NO.15) were determined ( Figure 5 A), the Kd values ​​were 15.20, 2.10, 1.80, 2.14 and 5.26 μM, respectively. Therefore, CA24 (SEQ ID NO. 13) with the highest affinity was selected.

[0053] Table 2 Aptamer sequences of cinnamaldehyde

[0054]

[0055] Finally, in order to simultaneously target Salmonella typhimurium and bind to cinnamaldehyde, the CAB-3T (SEQ ID NO. 16) sequence was synthesized based on the secondary structure and Tm value analysis ( Table 3 ; Figure 6 Flow cytometry showed that CAB-3T (SEQ ID NO.16) had a strong binding to Salmonella typhimurium, with a Kd of approximately 48.66 nmol / L ( Figure 5B) and showed remarkable specificity ( Figure 5 C). The ability to distinguish between different strains of S. typhimurium (CMCC 50115, LT2, ATCC 14028) was evaluated using flow cytometry, and the results showed that CAB-3T (SEQ ID NO. 16) exhibited binding ability, although there were slight differences ( Figure 5 D). In addition, AuNPs colorimetric analysis showed that CAB-3T (SEQ ID NO.16) had a high binding affinity to cinnamaldehyde ( Figure 5 E), Kd value is 0.4246μM ( Figure 5 F). These findings indicate that CAB-3T (SEQ ID NO. 16) can strongly bind to S. typhimurium and cinnamaldehyde.

[0056] Table 3 Salmonella typhimurium and cinnamaldehyde aptamer connection sequence

[0057]

[0058] Example 2 Preparation and Characterization of Solid-Liquid Biphase Artificial Cells (SL-BACs)

[0059] Preparation of SL-BACs: SL-BACs were made using air flow shearing technology. First, 20 nM CAB-3T (SEQ ID NO.16) was added to 60 μL of 1× HEPES buffer, incubated at 95°C for 3-4 minutes, and then cooled on ice for 10 minutes. Subsequently, 0.1 mL of 4.672 mmol / mL cinnamaldehyde was added, and the mixture was stirred for 40 minutes in the dark. Next, 0.2 mL of 0.4% w / v quaternary ammonium chitosan (QSC) was added and magnetically stirred for 30 minutes. Finally, 0.2 mL of 0.8% w / v sodium alginate (SA) was added and incubated under magnetic stirring for 5 hours. Then, a microfluidic chip with a T-shaped shear channel was used. The resulting droplets were introduced into a 5% w / v calcium chloride solution through the channel to induce solidification into SL-BACs. The SL-BACs were collected and washed twice to remove residual ions on the surface, and then they were stored in ultrapure water. The entire operation was performed in a sterile environment. Figure 7 ).

[0060] Characterization by SEM and energy dispersive X-ray spectroscopy (EDS) analysis: To ensure that phosphorus (P) comes only from nucleic acids, ddH2O was used instead of 1× HEPES buffer in the preparation of SL-BACs. SL-BACs were quickly frozen in liquid nitrogen for 2 minutes and then dried using a vacuum freeze dryer for 48 hours. Characterization was performed using a SIGMA300 field emission SEM (ZEISS, Germany). The elemental composition of the beads was then analyzed using an energy dispersive X-ray spectrometer.

[0061] Digital and microscopic images showed that SL-BACs were spherical in shape with an average size of 580.86±6.94μm ( Figure 8 A). SL-BACs present a solid-liquid biphasic state, in which the liquid multi-core contains cinnamaldehyde, in contrast to the empty interior of artificial cells without cinnamaldehyde ( Figure 8 B), which is crucial for subsequent evaluation and application. By quantifying the release time of cinnamaldehyde, the optimal formula was determined: 5% calcium chloride, 0.8% sodium alginate, and 0.4% quaternary ammonium salt chitosan ( Fig. 9 ). SEM analysis shows that the surface has obvious wrinkles ( Figure 8 C). EDS detected that C, O, P, Ca, Cl and other elements were uniformly distributed in SL-BACs ( Figure 8 CD), indicating successful loading of the oligonucleotide. Agarose gel electrophoresis showed that CAB-3T bound to QSC through electrostatic interaction within 5 minutes and remained in the gel ( Figure 8 E). In addition, it was verified that CAB-3T remained stable for a long time in artificial colon fluid (ACF, pH 7.8) ( Figure 8 F), thereby preventing the premature release of SL-BACs in the intestine. After release through ACF, bands were observed, although diluted by the system ( Fig.10 ), indicating that SL-BACs effectively loaded and released CAB-3T. In addition, the standard curve for quantification of cinnamaldehyde by gas chromatography showed that the peak area of ​​the added cinnamaldehyde was 19,967.63 ( Figure 8 G). The peak area measured after pH-responsive release from SL-BACs was 13,833.93 ( Figure 8 H). Therefore, the encapsulation efficiency of cinnamaldehyde was about 82.9% and the loading efficiency was about 13.1% (the results were obtained by weighing the prepared SL-BACs).

[0062] Example 3 pH-responsive controlled release properties of SL-BACs in the gastrointestinal tract

[0063] Observation of morphological changes of SL-BACs: The morphological changes of SL-BACs were studied by immersing them in artificial gastric fluid (AGF) for 2 h, artificial small intestinal fluid (ASF) for 4 h, and artificial colonic fluid (ACF) for 72 h. Preliminary imaging was performed using a digital camera. Subsequently, the SL-BACs under these different conditions were examined under a microscope to assess degradation. The morphological changes of SL-BACs under different immersion times were observed using a microscope.

[0064] The degradation of SL-BACs was systematically evaluated. SL-BACs were immersed in AGF, ASF and ACF. Figure 8As shown in Figure 1, the structure of SL-BACs remained largely unchanged after immersion in AGF for 2 h and in ASF for 4 h. This observation suggests that SL-BACs effectively maintained their solid-liquid biphasic morphology, thereby indicating that the cell membrane provides substantial protection for the liquid multicore against degradation by gastric acid. In addition, microscopic images confirmed that the shape and size remained unchanged ( Figure 8 J). However, when immersed in AGF and ASF and then transferred to ACF, SL-BACs showed visible damage within 10 h. This suggests that SL-BACs resist gastric acid, protecting the liquid polycore from degradation and allowing its slow release in the intestinal environment.

[0065] Example 4 In vitro antibacterial properties and biocompatibility of SL-BACs

[0066] First, the antimicrobial activity was evaluated by a disk diffusion test, in which the diameter of the antimicrobial growth inhibition zone was measured. Fig.11 A shows that SA@QSC-CA-100 and SA@QSC-CAB-3T@CA-100 (SL-BACs) exhibited the most obvious antibacterial activity both before and after curing. Cinnamaldehyde has excellent antibacterial properties, and SL-BACs still maintain excellent antibacterial activity after cleavage in ACF. In contrast, CAB-3T@CA, SA@QSC, SA@QSC-CAB-3T, and SA@QSC-CAB-3T@CA-20 showed poor antibacterial effects, and no significant antibacterial areas were observed either before encapsulation or after release. This indicates that the antibacterial effects of sodium alginate, quaternary ammonium chitosan, and CAB-3T alone are not as good as cinnamaldehyde. Specifically, we evaluated the antibacterial areas of sodium alginate, quaternary ammonium chitosan, and CAB-3T, respectively. Fig.12 It shows that the quaternary ammonium chitosan and CAB-3T have a positive effect on the 8 CFU / mL of bacteria have antimicrobial properties. It is noteworthy that although ethanol is considered to have antimicrobial properties in liquid culture media, it does not contribute much to the antimicrobial effects observed in the disc diffusion test due to its volatility ( Fig.11 AB). Meanwhile, bacterial survival was evaluated, and the results showed that SA@QSC-CA and SL-BACs exhibited the highest antibacterial activity. Their efficiency exceeded 95% both before and after curing, surpassing the efficacy of the antibiotic recorded at 94.45% ( Fig.11 B). In contrast, the other groups showed poor antibacterial effects, with antibacterial efficiencies less than 15% before and after encapsulation. In addition, the antibacterial efficacy of SL-BACs was evaluated after immersion in AGF, ASF, and ACF for different time intervals. Fig.11As shown in C, no obvious antibacterial area was observed in the collection bath, indicating that cinnamaldehyde was effectively encapsulated in the liquid multicores and no leakage into the collection bath was detected. After 2 hours in AGF and 4 hours in ASF, no significant antibacterial ring was observed in the supernatant, further confirming that SL-BACs were not degraded by gastric acid. In contrast, when SL-BACs were immersed in AGF and ASF for 2 hours and 4 hours, respectively, and then transferred to ACF, a clear antibacterial ring appeared after 10 hours. This indicates that SL-BACs gradually release liquid multicores, thereby exhibiting antibacterial activity in ACF. In addition, SL-BACs maintained their antibacterial efficacy in aqueous solution for up to three months, while non-artificial cells (free cinnamaldehyde) did not show similar antibacterial stability effects ( Fig.13 ). These findings suggest that SL-BACs effectively protect liquid polypores from acidic degradation and promote their gradual release in the intestine, thereby achieving high antimicrobial efficacy in vitro. In addition, the biocompatibility of SL-BACs was evaluated using the human colon cancer cell line Caco2 and the normal human colon mucosal epithelial cell line NCM460 as model systems. CCK8 assay ( Fig.11 D) and confocal laser scanning microscopy ( Fig.11 E) confirmed that SL-BACs were biocompatible, indicating that they were biosafe enough for subsequent animal experiments.

[0067] Example 5 Alleviation of Salmonella typhimurium-induced enteritis model in mice by oral administration of SL-BACs

[0068] Animals: SD rats were randomly divided into nine experimental groups, including control group, Salmonella typhimurium (negative control), CAB-3T@CA, SA@QSC, SA@QSC-CAB-3T, SA@QSC-CA, SA@QSC-CAB-3T@CA-20, SL-BACs, and 5-aminosalicylic acid (5-ASA, positive control). First, all rats underwent a four-day adaptive feeding period and then were gavaged with streptomycin (200 mg / kg) for two days. Subsequently, the rats were orally administered with 0.8 mL of Salmonella typhimurium (10 9 CFU / mL) to induce acute bacterial enteritis ( Fig.14 B). During this period, the control group received sterile water. Afterwards, the groups were treated with S. typhimurium, CAB-3T@CA, SA@QSC, SA@QSC-CAB-3T, SA@QSC-CA, and SA@QSC.

[0069] In vivo imaging system (IVIS): IVIS was performed using a multifunctional imaging device (FUSION FX SPECTRA, Vilber GmbH) to monitor the retention of microbeads in the gastrointestinal tract after gastric lavage. Approximately 300 mg of ICG-labeled SL-BACs were orally administered to each rat. Rats were sacrificed 1, 3, 8, 15, and 24 hours after administration, and the stomach, small intestine, and colon were removed for in vivo fluorescence imaging.

[0070] H&E staining: Tissue samples were initially fixed with 4% formaldehyde and then dehydrated through a graded ethanol series. Subsequently, the samples were embedded in paraffin and sectioned to 4 μm thickness. They were then stained sequentially with hematoxylin and eosin. The histopathological features of the tissues were examined and analyzed using an optical microscope.

[0071] Given the pH-responsive properties demonstrated in vitro, it is necessary to conduct in vivo studies to evaluate the efficacy of SL-BACs in the treatment of enteritis. First, a multifunctional imaging device was used to monitor the residence time of SL-BACs in rats. The results showed that SL-BACs were mainly detected in the stomach 1 hour after administration. By 3 hours, weak signals appeared in the stomach and small intestine. At 8 hours, strong fluorescence was noted in the colon. Notably, bright fluorescence persisted in colon tissue 15 hours after administration of SL-BACs and disappeared after 24 hours ( Fig.14 A). This indicates that SL-BACs exhibit a certain degree of colon adhesion in rats with S. typhimurium-induced colitis, which enhances their retention in the intestine. This enhanced retention may be attributed to the efficient adhesion properties of the solid phase. The extended residence time is conducive to the sustained release of liquid multicores and improves drug bioavailability.

[0072] After different treatments, the body weight and disease activity index (DAI) of rats orally treated with Salmonella typhimurium were significantly reduced compared with those in the control group (P<0.0001)( Fig.14 CD). Notably, the body weight and DAI of the SA@QSC-CA and SL-BACs groups improved significantly starting from day 3 after oral administration. Compared with the control rats infected with S. typhimurium, the treated groups recovered an average body weight of 50.52 g and presented an increased colon length ( Fig.14 F). Colonic tissue and spleen showed visible recovery, similar to that observed in the control group. In contrast, the other groups (CAB-3T@CA, SA@QSC, SA@QSC-CAB-3T, SA@QSC-CAB-3T@CA-20) showed obvious signs of colitis, with no statistically significant differences in DAI. Infected rats showed symptoms such as diarrhea and loss of appetite ( Fig.14 G), while no pathological changes were observed in the control group.

[0073] Furthermore, the efficacy of SL-BACs was compared with that of 5-ASA, despite the many side effects of 5-ASA. SL-BACs performed slightly worse than 5-ASA in terms of body weight and DAI, which may be attributed to the slow-release mechanism of SL-BACs. However, when the evaluation included spleen weight ( Fig.14 E), colon length ( Fig.14 The efficacy of oral SL-BACs was comparable to that of 5-ASA when multiple parameters were evaluated, including hematoxylin and eosin (H&E) staining and histological assessment of colonic injury. Together, these results suggest that oral administration of SL-BACs attenuated body weight loss in animals and provided significant protection against S. typhimurium-induced colitis. Fig.14 I) showed that SL-BACs treatment effectively maintained the integrity of the colonic epithelium, alleviated proinflammatory cell infiltration, and restored colonic tissue integrity to a level comparable to that of the control group. These findings suggest that SL-BACs display good biocompatibility and efficacy. The in vivo results suggest that SL-BACs have considerable potential as a therapeutic modality.

[0074] Example 6 SL-BACs inhibit intestinal inflammation and promote timely tissue repair

[0075] Immunohistochemistry: Immunohistochemistry is performed through a series of orderly steps. Immunohistochemical staining is performed using a DAB horseradish peroxidase staining kit. The stained tissue sections are then examined under a light microscope for analysis.

[0076] Immunofluorescence: Immunofluorescence staining is performed in a series of ordered steps. First, tissue sections are dewaxed, hydrated, and rinsed. Subsequently, a rapid blocking solution is applied to block nonspecific binding sites. Tissue sections are then incubated with primary antibodies overnight, washed, and incubated with secondary antibodies for one hour. After incubation, sections are stained with DAPI and rinsed to complete the preparation. The prepared immunofluorescence tissue sections are then examined using a confocal laser microscope.

[0077] mRNA expression analysis: Total RNA was extracted from cells and colon tissue samples using Trizol reagent. Subsequently, 1 μg of RNA was converted into complementary DNA by transcription and then subjected to reverse transcription quantitative polymerase chain reaction.

[0078] To evaluate the protective effect of SL-BACs against S. Typhimurium-induced colitis in rats, additional studies were performed. First, the effect of liquid polysaccharide on bacterial viability was evaluated using a live / dead bacterial staining assay. Bacteria showed green fluorescence at 1 min, a combination of green and red fluorescence at 10 min, red fluorescence at 20 min, and enhanced red fluorescence at 30 min ( Fig.15A). These observations indicate that liquid multicores effectively killed bacteria within 30 min, indicating rapid induction of bacterial cell death. Second, incubation in AGF and ASF did not result in lysis of SL-BACs and had no effect on bacterial growth, as evidenced by the retention of smooth rod-like structures. In contrast, SEM images after incubation in ACF showed significant membrane disruption ( Fig.15 B).

[0079] The expression of myeloperoxidase (MPO) and proliferating cell nuclear antigen (PCNA), which are key markers of inflammation and cell proliferation, respectively, was further investigated. In the inflammation group, the proportion of MPO-positive neutrophils in the colon tissue was significantly increased. In contrast, the aggregation of MPO-positive neutrophils in the colon tissue was significantly reduced in the SA@QSC-CA and SL-BACs treatment groups, which confirmed the anti-inflammatory effect of SL-BACs ( Fig.15 C, brown part). It is noteworthy that the epithelial layer was relatively intact after S. typhimurium treatment. In addition, the groups treated with SA@QSC-CA microspheres and SL-BACs showed a significant increase in PCNA expression levels ( Fig.15 D, brown part). This indicates that SA@QSC-CA artificial cells and SL-BACs have potential tissue repair properties.

[0080] Immunofluorescence analysis of macrophages in colonic tissues showed that S. typhimurium-induced colitis was associated with increased differentiation of M1 macrophages, as indicated by elevated TNF-α expression. In contrast, in the SL-BACs-treated group, differentiation of M2 macrophages was significantly enhanced, as indicated by increased CD163 expression ( Fig.16 A). In addition, cytokine levels were measured in the study. Compared with the control group, the infected group and the groups receiving less effective treatments (CAB-3T@CA, SA@QSC, SA@QSC-CAB-3T, SA@QSC-CAB-3T@CA-20) showed significantly increased levels of the pro-inflammatory factors interleukin 1 (IL-1) and CC chemokine receptor 7 (CCR7). In contrast, SA@QSC-CA and SL-BACs treatment resulted in a significant decrease in local IL-1 and CCR7 levels, accompanied by an increase in the tissue repair-related cytokine transforming growth factor β1 (TGF-β1). The mRNA expression levels of the anti-inflammatory factors interleukin 10 (IL-10) and arginase-1 (Arg-1) were also observed to be upregulated ( Fig.16B). In addition, we quantified the serum levels of the pro-inflammatory factors rat interleukin 6 (IL-6), rat tumor necrosis factor α (TNF-α), and rat interferon γ (IFN-γ), as well as the anti-inflammatory factors IL-10 and TGF-β1. As expected, the treatment groups involving SA@QSC-CA and SL-BACs showed suppressed expression and secretion of the pro-inflammatory cytokines IL-6, TNF-α, and IFN-γ, while upregulated expression of the anti-inflammatory factors IL-10 and TGF-β1 ( Fig.16 C) These findings suggest that SL-BACs have the ability to modulate intestinal immunity, thereby showing effectiveness in reducing inflammation.

[0081] These changes in bacterial abundance suggest selective antimicrobial properties of the bacteria and that SL-BACs have the potential to optimize the composition of the rat gut microbiota. Therefore, SL-BACs are a promising candidate as a therapeutic approach for bacterial colitis because they could mitigate the side effects of antibiotics or prevent severe infections caused by antibiotic-resistant bacteria.

[0082] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A Salmonella typhimurium nucleic acid aptamer, characterized in that: The nucleic acid aptamer sequences are shown in SEQ ID NOs. 2-10.

2. A cinnamaldehyde nucleic acid aptamer, characterized in that: The nucleic acid aptamer sequences are shown in SEQ ID NOs. 11-15.

3. A solid-liquid biphase artificial cell loaded with cinnamaldehyde, characterized in that: The solid-liquid biphase artificial cell comprises a solid phase part and a liquid multi-core part; the solid phase part is formed by cross-linking polysaccharides and solidifying through an ion diffusion method; the liquid multi-core part comprises a water-soluble liquid phase and a water-insoluble oil phase.

4. The solid-liquid biphase artificial cell according to claim 3, characterized in that: The solid phase part comprises sodium alginate, quaternary ammonium salt chitosan and calcium ions; the liquid multi-core part comprises an aptamer and cinnamaldehyde; the aptamer sequence is: 5'-CAGGAGGTAGGGTCTGGAGAATGGTTTCACTGTTCACTCCCCTTCCGCATCACTGTTCACTCCCCTTCCGCAT-3', as shown in SEQ ID NO.

16.

5. The method for preparing the solid-liquid biphase artificial cell according to claim 3 or 4, characterized in that: The aptamer was added to the buffer solution, and after denaturation, it was cooled on ice for 10 minutes; the cinnamaldehyde solution was added, and the mixture was stirred in the dark; 0.2 mL of quaternary ammonium salt chitosan was added and magnetic stirring was performed; 0.2 mL of sodium alginate was added, and magnetic stirring was performed and incubated for several hours; a microfluidic chip with a T-shaped shear channel was used to introduce the generated droplet into a calcium chloride solution through the channel to induce solidification into a solid-liquid biphasic artificial cell loaded with cinnamaldehyde; The solid-liquid biphase artificial cells were collected and washed twice.

6. The preparation method according to claim 6, characterized in that: The aptamer sequence is: 5'-CAGGAGGTAGGGTCTGGAGAATGGTTTCACTGTTCACTCCCCTTCCGCATCAC TGTTCACTCCCCTTCCGCAT-3', as shown in SEQ ID NO.16; the final concentration of the aptamer is 10pmol / L-100nmol / L; the mass concentration of the quaternary ammonium salt chitosan is 0.05-0.3%; the mass concentration of the sodium alginate is 0.05-0.5%; the mass concentration of the calcium chloride is 1.5-5.5%; the microfluidic chip has two inlets, which are used for the dispersed phase and the continuous phase respectively; the dispersed phase is a mixture of sodium alginate-quaternary ammonium salt chitosan, the aptamer and cinnamaldehyde solution; the continuous phase is nitrogen; the airflow in the microfluidic chip applies shear stress to the mixed liquid flow in the T-shaped shear channel, and the flow rates of the nitrogen and the mixed liquid are adjusted, the nitrogen flow rate is 0.5m / s, and the mixed liquid flow rate is 0.1m / s.

7. Use of the Salmonella typhimurium nucleic acid aptamer according to claim 1 in a food safety detection reagent and / or a Salmonella detection kit.

8. Use of the cinnamaldehyde nucleic acid aptamer as claimed in claim 2 in a cinnamaldehyde biosensor, a detection kit, and a detection reagent.

9. Use of the solid-liquid biphasic artificial cell loaded with cinnamaldehyde as claimed in claim 3 or 4 in the preparation of a medicine or product for preventing and / or treating gastrointestinal diseases.

10. Use of the preparation method according to claim 5 or 6 in the preparation of solid-liquid biphase artificial cells.

Images