Real-time fluorescence isothermal amplification detection kit for detecting whether meat product is doped with chicken component or not and application of real-time fluorescence isothermal amplification detection kit

Abstract

The invention discloses a real-time fluorescence isothermal amplification detection kit for detecting whether meat products are doped with chicken components and application. The real-time fluorescence isothermal amplification detection kit for detecting whether the meat product is doped with the chicken component or not is constructed based on Cas9-H840A and exo probes, sgRNA-guided Cas9-H840A can accurately recognize target genome DNA, and a target fragment is amplified under the action of Bsu DNA polymerase with strand displacement activity and single-stranded binding protein; the exo probe can specifically recognize a complementary sequence and cut a THF site with the help of exonuclease III to realize signal amplification. The real-time fluorescent isothermal amplification detection kit disclosed by the invention has extremely high specificity and sensitivity on chicken detection in a complex sample environment, can accurately and sensitively detect whether chicken is doped in meat products or not, and has good accuracy, practicability and universality on actual sample detection.

Description

Technical Field

[0001] The invention relates to a detection kit for detecting whether a meat product is adulterated, in particular to a real-time fluorescence constant temperature amplification detection kit for detecting whether chicken components are mixed into the meat product and its application, belonging to the field of molecular detection of whether meat products are adulterated. Background Art

[0002] Meat products are essential foods in human daily life, providing the body with high-quality animal protein, fat, minerals, etc., but economically motivated adulteration (EMA) is emerging in an endless stream. Polymerase chain reaction (PCR) is the most widely used detection method based on nucleic acids, and its amplification results need to be visualized and analyzed by electrophoresis and gel imaging. The reliance on expensive thermal cyclers and complex result analysis make PCR unsuitable for use on-site or outside laboratories and in places with scarce resources. Constant temperature amplification technology not only gets rid of the limitations of PCR but also meets the needs of on-site detection. Existing constant temperature amplification technologies include exponential reaction amplification (EXPRA), strand displacement amplification (SDA), recombinase polymerase amplification (RPA), helicase-dependent amplification (HDA), loop-mediated isothermal amplification (LAMP) and rolling circle amplification (RCA). Although the above-mentioned isothermal amplification technology has successfully overcome the dependence on thermal cycling instruments, it still has the following disadvantages: (a) There is a problem of specificity, and the primer requirements are extremely high, making primer design difficult; (b) It is highly sensitive and can be easily contaminated by aerosols, resulting in false positive test results; (c) Some isothermal amplifications require pre-denaturation to separate dsDNA; (d) The reaction cost is high and requires multiple enzymes.

[0003] Originally derived from the adaptive immune system of bacteria and archaea to combat invading nucleic acid components, the CRISPR / Cas system has now become an important tool in transcriptional regulation, genome editing, and in situ DNA / RNA detection. In particular, various CRISPR effectors, including Cas9, Cas12a, and Cas13a / b, have been explored due to their advantages such as simplicity and high sensitivity / specificity, and the prospects for CRISPR-based nucleic acid diagnostics (CRISPR-Dx) are encouraging. However, all CRISPR-Dx methods reported to date require an initial amplification step, such as PCR, NASBA, and RPA, to specifically amplify the target nucleic acid, and the CRISPR effector is only used for endpoint analysis. In other words, the performance of these CRISPR-Dx methods is mainly determined by the initial amplification, while the superior sensitivity and strict PAM recognition of the CRISPR system have not been fully utilized. Similar to most monoclonal antibodies, CRISPR effectors have equilibrium dissociation constants for their targets in the nanomolar range, suggesting that they are highly advantageous for sensitive recognition of nucleic acids, and their low tolerance for PAM-proximal mismatches also suggests that CRISPR effectors can provide sufficient specificity for detecting single nucleotide polymorphisms (SNPs).

[0004] Therefore, in order to better identify whether chicken is adulterated in meat products, it is necessary to develop a simple, stable and highly specific nucleic acid isothermal amplification detection kit or detection method. Summary of the invention

[0005] One of the purposes of the present invention is to provide a real-time fluorescence constant temperature amplification detection kit for detecting whether chicken ingredients are mixed into meat products;

[0006] The second object of the present invention is to provide a real-time fluorescence constant temperature amplification detection kit for detecting whether chicken ingredients are mixed in meat products and to apply it to detecting whether chicken ingredients are mixed in meat products;

[0007] To achieve the above purpose, the main technical solutions adopted by the present invention include:

[0008] The present invention first provides a real-time fluorescence isothermal amplification detection kit for detecting whether chicken ingredients are mixed in meat products, comprising: a Cas9-H840A:sgRNA complex, a primer pair for amplifying a chicken genome, an exo probe, a Bsu DNA polymerase, a single-stranded DNA binding protein SSB, a nuclease inhibitor, an exonuclease III, a dNTP mix and a buffer.

[0009] Wherein, the Cas9-H840A:sgRNA complex is composed of Cas9-H840A protein, crRNA and tracrRNA, the crRNA is composed of a forward crRNA and a reverse crRNA, the forward crRNA is selected from the nucleotide sequence shown in SEQ ID No.3 or SEQ ID No.4, and the reverse crRNA is selected from the nucleotide sequence shown in SEQ ID No.5 or SEQ IDNo.6; in a preferred specific embodiment of the present invention, the crRNA is composed of the forward crRNA shown in SEQ ID No.4 and the reverse crRNA shown in SEQ ID No.5.

[0010] In a preferred specific embodiment of the present invention, the nucleotide sequence of the tracrRNA is shown in SEQ ID No.7.

[0011] The primer pair used for amplifying the chicken genome is a forward primer and a reverse primer designed with the chicken Cytb genomic DNA as the target; as a reference embodiment, the primer pair is selected from any pair of primers in the following (1)-(3): (1) a primer pair consisting of a forward primer shown in SEQ ID No.8 and a reverse primer shown in SEQ ID No.9; (2) a primer pair consisting of a forward primer shown in SEQ ID No.10 and a reverse primer shown in SEQ ID No.11; (3) a primer pair consisting of a forward primer shown in SEQ ID No.12 and a reverse primer shown in SEQ ID No.13. In a preferred specific embodiment of the present invention, the primer pair consists of a forward primer shown in SEQ ID No.12 and a reverse primer shown in SEQ ID No.13.

[0012] In a preferred specific embodiment of the present invention, the sequence of the exo probe is as follows: ATGTTATGCCGACTGAGTAGGCCTTAGAGG / i6FAMdT / G / idSp / G / iBHQ 1dT / TTGCCGCGGAGTAAG; wherein i6FAMdT is FAM-dT, idSp is tetrahydrofuran; and iBHQ1dT is BHQ1-dT.

[0013] In a preferred embodiment of the present invention, the buffer is NEB buffer 2.

[0014] Figure 1The present invention is shown as a detection principle for detecting whether chicken ingredients are mixed in meat products by using a real-time fluorescence constant temperature amplification detection kit, including: first, a pair of sgRNA (crRNA and tracrRNA) is used to guide the Cas9-H840A protein to specifically identify the chicken Cytb genomic DNA target, and introduce a gap in the upstream and downstream of the amplified target fragment. A pair of primers containing a PAM site bind through the gap, and amplification is initiated under the action of Bsu DNA polymerase and single-stranded DNA binding protein. In this step, two amplification products of different lengths containing the target amplification sequence can be obtained (Step 1-Step 2). Then, Cas9-H840A continues to recognize the amplification product and start amplification. During the amplification process, the exo probe specifically recognizes the amplified fragment, cuts the THF site through the nuclease exonuclease III, and releases the fluorescent signal. This step can amplify a 211bp target nucleic acid sequence (Step 2-Step 3). Finally, it can be amplified by Cas9-H840A cutting-primer recognition-amplification-exo probe cleavage cycle, and a real-time fluorescent signal is generated (Step 4). The entire amplification process is carried out under constant temperature conditions, with excellent specificity and sensitivity.

[0015] Another aspect of the present invention is to apply the real-time fluorescence isothermal amplification detection kit to detect whether chicken ingredients are mixed in meat products, comprising:

[0016] (1) extracting and preparing DNA from meat product samples to be tested;

[0017] (2) mixing the DNA with the Cas9-H840A:sgRNA complex, a primer pair for amplifying the chicken genome, an exo probe, Bsu DNA polymerase, a single-stranded DNA binding protein SSB, a nuclease inhibitor, exonuclease III, a dNTP mix and a buffer to establish a real-time fluorescence constant temperature amplification system, amplifying at a constant temperature in a fluorescence constant temperature amplification instrument and recording the fluorescence signal;

[0018] (3) If a strong fluorescent signal is generated, the meat product sample to be tested is adulterated with chicken ingredients; if no fluorescent signal is generated, the meat product sample to be tested is not adulterated with chicken ingredients.

[0019] As a preferred specific embodiment of the present invention, the real-time fluorescence isothermal amplification system established in step (2) is as follows:

[0020] 10μL Cas9-H840A:sgRNA complex, 1μL 10μM forward primer, 1μL 10μM reverse primer, 1μL 10μM exo probe, 2μL sample DNA to be tested, 0.5μL Bsu DNA polymerase, 0.5μL single-stranded DNA binding protein SSB, 0.5μL nuclease inhibitor, 0.5μL exonuclease III, 0.5μL 10mM dNTP mix and 2μL 10×NEBbuffer 2.

[0021] As a preferred specific embodiment of the present invention, the constant temperature described in step (2) can be any constant temperature between 30°C and 42°C; the present invention finds that as the temperature increases, the fluorescence signal shows a trend of first increasing and then decreasing, and too high a temperature will affect the amplification efficiency. The fluorescence ratio after amplification at 39°C for 30 minutes is higher than that at 37°C and 42°C. Therefore, the present invention preferably uses 39°C as the optimal temperature for constant temperature amplification.

[0022] As a preferred embodiment of the present invention, the amplification time in step (2) can be 10-60 min, preferably 30 min.

[0023] The present invention utilizes sgRNA-guided Cas9-H840A to accurately identify target genomic DNA, and amplifies the target fragment under the action of Bsu DNA polymerase with strand displacement activity and single-stranded binding protein; wherein the exo probe can specifically recognize the complementary sequence and cut the THF site with the help of nuclease exonuclease III to achieve signal amplification.

[0024] The results of specificity tests show that the Cas9-H840A isothermal amplification detection system and detection method established in the present invention have extremely high specificity for chicken in a complex sample environment, and do not cross-react with other animal-derived ingredients, and can meet the needs of adulteration detection in complex detection environments.

[0025] The results of the sensitivity test showed that the Cas9-H840A isothermal amplification detection system and detection method established in the present invention have extremely high picomolar sensitivity in a complex sample environment, which is sufficient to detect chicken adulteration in meat products.

[0026] It can be seen from the test results of actual samples using the Cas9-H840A isothermal amplification detection system and detection method established by the present invention that the test results of the Cas9-H840A isothermal amplification detection system established by the present invention are consistent with the RT-RPA results, proving that the method of the present invention has good accuracy, practicality and versatility.

[0027] Compared with the classic isothermal amplification technology, the real-time fluorescent isothermal amplification detection kit or detection method based on Cas9-H840A-exo established in the present invention has the following advantages: (1) The primer design is simple, and there is no need for complex and time-consuming specific primer screening steps; (2) The entire amplification reaction is carried out at 39°C, and no thermal cycler is required; (3) Based on the specific cutting of Cas9-H840A:sgRNA and the recognition of exo probes, the amplification reaction has extremely high specificity.

[0028] In summary, the present invention makes full use of the high sensitivity, strict specificity and unique conformational rearrangement of CRISPR effectors in recognizing target DNA, and uses Cas9-H840A to specifically recognize target nucleic acids to introduce a pair of gaps, so that primers bind and specifically start the amplification reaction, and perform real-time fluorescence monitoring under the mediation of exo probes. The isothermal amplification reaction can achieve picomolar sensitivity within 30 minutes, and rapid on-site detection can be achieved through a portable and very stable amplification instrument, which has great potential for applications in portable diagnostic equipment, instant diagnosis, and on-site analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the PCR primer amplification site and crRNA cleavage site.

[0030] Figure 2 This is a flowchart of real-time fluorescence amplification based on Cas9-H840A and exo probes.

[0031] Figure 3 Validation results for dsDNA PCR primer specificity.

[0032] Figure 4 This is the crRNA screening result.

[0033] Figure 5 Cut dsDNA for crRNA-F2 / crRNA-R1.

[0034] Figure 6 PAGE gel analysis of the feasibility of Cas9-H840A isothermal amplification and the synergistic effect of Cas9-H840A:sgRNA and Bsu DNA polymerase.

[0035] Figure 7 Results of primer length optimization for Cas9-H840A isothermal amplification.

[0036] Figure 8 The results of temperature optimization for Cas9-H840A isothermal amplification.

[0037] Fig. 9 These are the results of the Cas9-H840A isothermal amplification specificity test.

[0038] Fig.10 Sensitivity test of Cas9-H840A isothermal amplification: Real-time fluorescence curve of chicken Cytb gene amplification at different concentrations.

[0039] Fig.11 Sensitivity test of Cas9-H840A isothermal amplification: linear relationship between F-F0 and DNA copy number. DETAILED DESCRIPTION

[0040] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0041] Main reagents and instruments

[0042] The reagents used in the following experiments are shown in Table 1:

[0043] Table 1 Experimental reagents and production companies

[0044]

[0045] Note: Cas9-H840A is a mutant of Cas9. Cas9 can cut double-stranded DNA, but Cas9-H840A can only cut one strand of the double-stranded DNA.

[0046] The instruments used in the following tests are shown in Table 2:

[0047] Table 2 Experimental instruments and production companies

[0048]

[0049] Experimental Example 1 Screening test of crRNA

[0050] 1 Test method

[0051] 1.1 Preparation of Cas9 cleavage fragments

[0052] In order to facilitate the subsequent screening of crRNA, a 662 bp fragment to be cut (dsDNA) was amplified by PCR using chicken genomic DNA as a template (the nucleotide sequence of the 662 bp is Figure 1 As shown), PCR primers and crRNA cleavage site as shown Figure 1The amplification system and reaction procedure are shown in Table 3, and the amplification product was simply verified by gel electrophoresis. The PCR amplification product was purified using the QIAGEN QIAquick Enzymatic Reaction Oligonucleotide DNA Fragment Recovery Kit. The purification steps are as follows: (1) Add 125 μL of Buffer PNI to every 25 μL of PCR product and mix well; (2) Place the QIAquick purification column in a 2 mL collection tube; (3) Transfer the mixed solution in step (1) to the QIAquick purification column and centrifuge at 6000 rpm for 1 min; (4) After discarding the waste liquid, return the purification column to the collection tube; (5) Add 750 μL of Buffer PE and centrifuge at 6000 rpm for 1 min; (6) After discarding the waste liquid, return the purification column to the collection tube and centrifuge again at 13000 rpm for 1 min; (7) Transfer the purified nucleic acid to a clean 1.5 mL centrifuge tube; (8) Add 20 μL of EB buffer and the center of the QIAquick purification membrane, let stand for 1 min, and then centrifuge at 13000 rpm for 1 min. (9) Store the purified nucleic acid at -20°C for later use.

[0053] Table 3 PCR amplification system and reaction procedure

[0054]

[0055] 1.2 crRNA screening

[0056] Two upstream and downstream crRNAs were designed respectively, and the crRNA and tracrRNA sequences are shown in Table 4. Cas9 with double-stranded cleavage ability and the purified dsDNA were used to screen crRNA. The Cas9 cleavage system is shown in Table 5. Take 1μL 10×Cas9 reaction buffer, 1μL Cas9 protein, 1μL 10μM crRNA and 1μL 10μMtracrRNA in a 200μL centrifuge tube, vortex centrifuge and let stand at 25℃ for 15min. Add 6μL PCR amplification product, vortex centrifuge and cut at 37℃ for 1h, and finally put it in a 90℃ water bath to stop the reaction. Use nucleic acid electrophoresis to verify the cleavage activity of crRNA.

[0057] Table 4 crRNA and tracrRNA sequences

[0058]

[0059] Table 5 CRISPR / Cas9 cutting system

[0060]

[0061] 2 Test results

[0062] In order to make the experimental results easier to observe, a 662bp dsDNA was amplified as the cutting target of Cas9:sgRNA. The dsDNA amplification results are shown in Figure 2. Figure 3 As shown, a 1000 bp DNA marker is used, lane 1 is dsDNA of 662 bp, and lanes 2, 3, 4, 5, 6, 7, and 8 are nucleic acids from other animal sources (duck, pig, cattle, sheep, goose, pigeon, and quail). It can be seen that the primer has good specificity, and there is no non-specific amplicon that interferes with the observation of subsequent nucleic acid cleavage results.

[0063] dsDNA was used to screen crRNA, and the screening results were as follows Figure 4 As shown, crRNA-F1 cuts dsDNA into two fragments of about 200bp and 400bp, and crRNA-F2 cuts dsDNA into two fragments of about 300bp, with similar cutting effects. crRNA-R1 and crRNA-R2 cut dsDNA into two fragments of about 500bp and 100bp, with similar cutting effects. In the case of similar cutting efficiency, this experiment selects a combination of crRNA-F2 (SEQ ID No.4) and crRNA-R1 (SEQ ID No.5) with shorter amplified fragments.

[0064] Experimental Example 2: Feasibility verification test of Cas9-H840A isothermal amplification

[0065] 1 Test method

[0066] The crRNA (crRNA-F2 / crRNA-R1) obtained by screening in Experimental Example 1 was selected for feasibility verification of CRISPR / Cas9-H840A isothermal amplification. The amplification system consists of two parts, A and B, as shown in Table 6: Part A contains a Cas9-H840A:sgRNA complex, which consists of 2μL Cas9-H840A, 1μL 10μM crRNA-F2, 1μL 10μM crRNA-R1, 2μL 10μMtracrRNA, 1μL 10×reaction buffer and ddH2O to form a 10μL cutting system, which is left at room temperature for 15min. The amplification system of part B consists of 1μL 10μM forward primer, 1μL 10μM reverse primer, 2μL dsDNA, 0.5μL Bsu DNA polymerase, 0.5μL single-stranded DNA binding protein SSB, 0.5μL nuclease inhibitor, 0.5μL 10mM dNTP mix, 2μL 10×NEBbuffer2 and 2μL ddH2O. After mixing A and B, put them in a constant temperature water bath at 37℃ to start amplification. After 30 minutes, put them in a water bath at 90℃ to stop the reaction, and verify the amplification results by nucleic acid electrophoresis.

[0067] Table 6 CRISPR / Cas9-H840A isothermal amplification system

[0068]

[0069]

[0070] 2 Test results

[0071] In this experiment, agarose gel electrophoresis (PAGE) was used to intuitively verify the feasibility of CRISPR / Cas9-mediated isothermal amplification and the synergistic effect of Cas9-H840A:sgRNA and Bsu DNA polymerase.

[0072] The crRNA-F2 and crRNA-R1 screened in Experimental Example 1 simultaneously cut dsDNA. Figure 5 As shown in Figure 4, three bands of 300 bp, 200 bp, and 100 bp appeared in lane 4, proving that the CRISPR / Cas9 system can specifically cut the target nucleic acid. Seven different groups were set up, each containing dsDNA and other variables (primers, Cas9-H840A:sgRNA complex, and Bsu DNA polymerase) to verify the feasibility of isothermal amplification and the synergistic effect between different components. The gel electrophoresis results are shown in Figure 4. Figure 6As shown, the band in lane 1 is 662bp of dsDNA, and lane 2 adds primer dimers on the basis of lane 1. In the case of Cas9-H840A:sgRNA complex but without Bsu DNA polymerase and primers, only one dsDNA template was observed (lane 3). In the case of Cas9-H840ACas9-H840A:sgRNA complex and primers but without Bsu DNA polymerase, there are still only dsDNA templates and primer dimers (lane 4). In the case of Bsu DNA polymerase and primers but without Cas9-H840ACas9-H840A:sgRNA complex, no new bands appear (lane 5). In the case of Cas9-H840A:sgRNA complex and Bsu DNA polymerase but without primers, no amplification product appears (lane 6). In the presence of Cas9-H840A:sgRNA complex, Bsu DNA polymerase and primers, three bands of 550bp, 450bp and 250bp appeared in lane 7. The above results strongly demonstrated the feasibility of isothermal amplification of Cas9-H840A.

[0073] Experimental Example 3 Optimization experiment of Cas9-H840A constant temperature amplification parameters

[0074] 1 Test method

[0075] In this experiment, TwistAmp exo probe was used to monitor Cas9-H840A amplification in real time. The probe sequence is shown in Table 7. The 20 μL amplification system contained 10 μL Cas9:sgRNA complex, 1 μL 10 μM forward primer, 1 μL 10 μM reverse primer, 1 μL 10 μM exo probe, 2 μL 662 bp dsDNA ( Figure 1 The nucleotide sequence shown in the figure), 0.5 μL Bsu DNA polymerase, 0.5 μL single-stranded DNA binding protein SSB, 0.5 μL nuclease inhibitor, 0.5 μL exonuclease III, 0.5 μL 10 mM dNTP mix and 2 μL 10× NEB buffer 2. A portable fluorescence thermostatic amplification instrument was used for amplification at 37°C for 30 min, and the fluorescence signal was recorded every 60 s.

[0076] Table 7 CRISPR / Cas9-H840A amplification primers and probe sequences

[0077]

[0078] In order to study the effect of primer length on amplification results, three sets of primers with different lengths were designed in this experiment, and the primer sequences are shown in Table 7. The Cas9-H840A amplification system and reaction procedure were the same as above, with three parallels set up in each group.

[0079] In order to study the effect of temperature, three temperature gradients of 37°C, 39°C and 42°C were set up. The reaction system and reaction procedure were the same as above, and three parallel experiments were set up in each group.

[0080] 2 Test results

[0081] The test results are as follows Figure 7 As shown in the figure, the long primers showed a larger fluorescence ratio (F / F0) than the short primers. This is because the stability between the long primers and the amplification template is higher after Cas9-H840A catalyzes the cleavage of the original spacer sequence. Finally, the third set of primers was selected for subsequent isothermal amplification performance studies. The reaction temperature was then optimized, and three temperature gradients of 37°C, 39°C, and 42°C were selected. The real-time fluorescence results are shown in Figure 2. Figure 8 As shown in the figure, with the increase of temperature, the fluorescence signal showed a trend of first increasing and then decreasing. Too high a temperature would affect the amplification efficiency. The fluorescence ratio after 30 minutes of amplification at 39°C was higher than that at 37°C and 42°C. Therefore, 39°C was finally selected as the optimal temperature for constant temperature amplification.

[0082] Test Example 4 Cas9-H840A constant temperature amplification specificity test

[0083] 1 Test method

[0084] In order to verify the specificity of isothermal amplification based on Cas9-H840A and exo probe, a series of animal DNA templates of different species (chicken, duck, pig, cattle, sheep, goose, pigeon) were prepared. The above-established and optimized isothermal amplification system of Cas9-H840A combined with exo probe was used for detection. Three parallels were set up for each group, and the control group was treated in the same way, but without genomic DNA.

[0085] 2 Test results

[0086] Real-time fluorescence amplification results Fig. 9As shown in the figure, the fluorescence intensity of chicken genomic DNA can reach 3100, which is significantly different from other animal-derived nucleic acids. Cas9-H840A protein is the switch for isothermal amplification. The cutting of Cas9-H840A depends not only on the sequence consistency between the sgRNA spacer and the protospacer, but also on the PAM site, which provides the first guarantee for amplification specificity, while the exo probe releases fluorescent signals through complementary base pairing to provide the second guarantee for amplification specificity. In summary, this detection system has extremely high specificity for chicken and does not cross-react with other animal-derived components, meeting the needs of adulteration detection in complex detection environments.

[0087] Test Example 5 Cas9-H840A constant temperature amplification sensitivity test

[0088] 1 Test method

[0089] In order to verify the sensitivity of isothermal amplification mediated by Cas9-H840A and exo probe, chicken genomic DNA was diluted (800nM, 400nM, 40nM, 4nM, 400pM, 40pM, 4pM and 400aM). The above-established and optimized isothermal amplification system of Cas9-H840A combined with exo probe was used for detection, and three parallels were set for each group. The control group was treated in the same way, but without genomic DNA.

[0090] 2 Test results

[0091] Under optimal conditions, this experiment used chicken Cytb genomic DNA as a model target to study the sensitivity of Cas9-H840A real-time fluorescence isothermal amplification. 800nM chicken genomic DNA was diluted at different times, and the results of Cas9-H840A real-time fluorescence detection were as follows: Fig.10 As shown in Figure 2, the fluorescence signal of Cas9-H840A amplification decreases with the decrease of genome concentration, and the LOD within 30 minutes is about 4pM. The linear relationship between the fluorescence difference (F-F0) and the gene copy number is shown in Figure 2. Fig.11 As shown, the linear regression equation is y=273*logx+61, R 2 =0.995 (where y is F-F0, F and F0 are the fluorescence intensities at 30 min in the presence and absence of DNA template, respectively). The above results show that the Cas9-H840A isothermal amplification detection method established in the present invention has extremely high sensitivity, which is sufficient to detect chicken adulteration in meat products. This simple, accurate and highly sensitive isothermal amplification technology is an ideal on-site detection tool.

[0092] Experimental Example 6 Actual sample application test of Cas9-H840A isothermal amplification

[0093] In order to verify the practical application capability of the Cas9-H840A isothermal amplification established in the present invention, 10 kinds of processed meat products were purchased from the market and tested using the isothermal amplification system of CRISPR / Cas9 combined with exo probe established and optimized as above. A portable fluorescent isothermal amplification system was used to record the fluorescence signal in real time, and the amplification results were compared with the RT-RPA results.

[0094] The test results are shown in Table 8. It can be seen that 3 of the 10 samples contain chicken ingredients, and the test results of the Cas9-H840A isothermal amplification detection system established based on the present invention are consistent with the RT-RPA results, proving that the method of the present invention has good accuracy and practicality. In addition, the method is also universal, and rapid detection of other animal-derived ingredients can be achieved by modifying the target gene, showing great potential in the field of rapid detection of food adulteration.

[0095] Table 8 Actual sample test results

[0096]

[0097] +: positive; -: negative.

Claims

1. A real-time fluorescence isothermal amplification detection kit for detecting whether chicken ingredients are mixed in meat products, characterized in that: include: Cas9-H840A:sgRNA complex, primer pairs for amplifying the chicken genome, exo probe, Bsu DNA polymerase, single-stranded DNA binding protein SSB, nuclease inhibitor, exonuclease III, dNTP mix and buffer; Wherein, the Cas9-H840A:sgRNA complex is composed of Cas9-H840A protein, crRNA and tracrRNA, the crRNA is composed of a forward crRNA and a reverse crRNA, the forward crRNA is selected from the nucleotide sequence shown in SEQ ID No.3 or SEQ ID No.4, and the reverse crRNA is selected from the nucleotide sequence shown in SEQ ID No.5 or SEQ ID No.6; The nucleotide sequence of the tracrRNA is shown in SEQ ID No.

7.

2. The real-time fluorescence isothermal amplification detection kit according to claim 1, characterized in that: The crRNA is composed of the forward crRNA shown in SEQ ID No.4 and the reverse crRNA shown in SEQ ID No.

5.

3. The real-time fluorescence isothermal amplification detection kit according to claim 1, characterized in that: The primer pair used for amplifying the chicken genome is composed of a forward primer and a reverse primer designed with the chicken Cytb genome DNA as the target.

4. The real-time fluorescence isothermal amplification detection kit according to claim 3, characterized in that: The primer pair is composed of a forward primer shown in SEQ ID No.12 and a reverse primer shown in SEQ ID No.

13.

5. The real-time fluorescence isothermal amplification detection kit according to claim 1, characterized in that: The sequence of the exo probe is as follows: ATGTTATGCCGACTGAGTAGGCCTTAGAGG / i6FAMdT / G / idSp / G / iBHQ1dT / TTGCCGCGGAGTAAG; wherein, i6FAMdT is FAM-dT, idSp is tetrahydrofuran; iBHQ1dT is BHQ1-dT.

6. Use of the real-time fluorescence isothermal amplification detection kit according to claim 1 in detecting whether chicken ingredients are mixed into meat products.

7. The use according to claim 6, characterized in that: include: (1) extracting and preparing DNA from meat product samples to be tested; (2) mixing the DNA with the Cas9-H840A:sgRNA complex, a forward primer and a reverse primer for amplifying the chicken genome, an exo probe, a Bsu DNA polymerase, a single-stranded DNA binding protein SSB, a nuclease inhibitor, an exonuclease III, a dNTPmix and a buffer to establish a real-time fluorescence constant temperature amplification system, amplifying at a constant temperature and recording the fluorescence signal; (3) If a fluorescent signal is generated, the meat product sample to be tested is adulterated with chicken ingredients; if no fluorescent signal is generated, the meat product sample to be tested is not adulterated with chicken ingredients.

8. The use according to claim 7, characterized in that: The real-time fluorescence isothermal amplification system established in step (2) is as follows: 10μL Cas9-H840A:sgRNA complex, 1μL 10μM forward primer, 1μL 10μM reverse primer, 1μL 10μM exo probe, 2μL sample DNA to be tested, 0.5μL Bsu DNA polymerase, 0.5μL single-stranded DNA binding protein SSB, 0.5μL nuclease inhibitor, 0.5μL exonuclease III, 0.5μL 10mM dNTP mix and 2μL 10×NEBbuffer 2.

9. The use according to claim 7, characterized in that: The constant temperature in step (2) is any constant temperature between 30-42°C, preferably 39°C.

10. The use according to claim 7, characterized in that: The amplification time in step (2) is 10-60 min, preferably 30 min.

Images