Photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system

Abstract

The invention relates to the technical field of salmonella detection, and provides a photonic crystal fluorescence sensor based on recombinase polymerase amplification and a CRISPR / Cas12a system, and the photonic crystal fluorescence sensor comprises a biosensing platform and a photonic crystal array; the reaction components of the biosensing platform comprise an RPA reagent, an upstream primer, a downstream primer, Cas12a protein, crRNA, an ssDNA probe and a buffer solution; the photonic crystal array is mainly constructed by a PDMS substrate, polystyrene microspheres, ethanol and a microwell plate analyzer; the detection sensitivity of the salmonella is obviously improved.

Description

Technical Field

[0001] The present application belongs to the technical field of Salmonella detection, and in particular to a photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system. Background Art

[0002] Salmonella is one of the most common foodborne pathogens, and its rapid and sensitive detection is of great significance for the prevention and diagnosis of foodborne diseases. At present, the detection methods of Salmonella are mainly culture identification method and hybridization chain reaction (PCR). However, the culture identification method requires steps such as pre-enrichment, selective bacterial growth, separation and biochemical identification, and it usually takes 4-7 days to get the results. The operation is complicated, time-consuming and laborious. PCR consists of three basic reaction steps: denaturation-annealing-extension. First, the template DNA is heated to about 94°C, and the double-stranded template DNA is denatured and dissociated into single strands. Then the temperature is reduced to about 55°C, and the primers are complementary to the single-stranded template DNA. Finally, the complex formed by the DNA template and the primer is synthesized under the action of Taq enzyme, with dNTP as the reaction raw material and the target sequence as the template, according to the principle of base complementary pairing and the principle of semi-conservative replication, a new semi-conservative replication chain complementary to the template DNA chain is synthesized. Repeating the above three steps can achieve the result of replicating the target sequence. However, the PCR method relies on relatively expensive thermal cycling equipment, such as a PCR instrument, and requires professional operation and the need to set up complex temperature change programs, which limits its application in rapid on-site testing, especially in areas with scarce resources. Summary of the invention

[0003] The purpose of this application is to provide a photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system, aiming to solve the above-mentioned problems existing in the PCR method.

[0004] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0005] A photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system, including a biosensing platform and a photonic crystal array;

[0006] The reaction components of the biosensor platform include RPA reagent, upstream primer, downstream primer, Cas12a protein, crRNA, ssDNA probe and buffer;

[0007] The photonic crystal array is mainly composed of a PDMS substrate, polystyrene microspheres, ethanol and a microplate analyzer.

[0008] In the present invention, the biosensor platform is used for the detection of Salmonella, and the photonic crystal array is used for physically amplifying the fluorescent signal obtained by the detection, and the two work synergistically to significantly improve the detection sensitivity.

[0009] By selecting microplates of different specifications, rapid scanning of different numbers of samples can be achieved, thereby performing high-throughput ultra-sensitive analysis.

[0010] The RPA reagent amplifies the invA gene of Salmonella, and the generated amplicon is used as the activation chain of the CRISPR / Cas system to initiate the CRISPR reaction. For the CRISPR system, first, the Cas12a protein forms a binary complex with crRNA. When the target Salmonella DNA is present, the RPA amplicon can be specifically recognized by the crRNA designed based on the PAM (TTTN) sequence on the invA gene, thereby forming a ternary complex. After being activated, the Cas12a protein can specifically cut the double-stranded DNA of the target gene near the PAM sequence site, and at the same time, its trans-cutting activity is activated, non-specifically cutting the ssDNA fluorescent probe present in the solution. The ssDNA probe is modified using the fluorescent group FAM and the quenching group BHQ1. When the ssDNA is cut and cracked, the fluorescence of FAM is restored, and the product is loaded onto the photonic crystal array to further enhance the signal, and the result is read using a microplate analyzer. Thanks to the specific amplification of RPA, the specific recognition of crRNA and target gene amplicons based on base complementary pairing, and CRISPR / Cas signal amplification, the specificity and sensitivity of the detection are significantly improved, making it an effective method for detecting Salmonella.

[0011] As a possible design, the nucleotide sequences of the upstream primer and the downstream primer are as follows:

[0012] 5'AAGCAAAACGTAGCGCCGCCAAACCTAA3',

[0013] 5'CACTCGCATCAAATCAAAATAGACCGTA3';

[0014] or, 5'TAGCGCCGCCAAACCTAAAACCAGCAAA3',

[0015] 5'AATAATTTACCACTCGCATCAAATCAAA3';

[0016] or, 5'GTACTCTTCTATTTTAAATTCCGTGAAGCAAAAC3',

[0017] 5'GCGTTACCCAGAAATACTGACTGCTACCTTGCTG3'.

[0018] As a possible design, the nucleotide sequences of the upstream primer and the downstream primer are as follows:

[0019] 5'AAGCAAAACGTAGCGCCGCCAAACCTAA3',

[0020] 5'CACTCGCATCAAATCAAAATAGACCGTA3'.

[0021] As a possible design, the nucleotide sequence of the ssDNA probe is as follows:

[0022] FAM-TTATTATT-BHQ1.

[0023] As a possible design, the nucleotide sequence of the crRNA is TAATTTCT ACTAAGTGTAGATTCGAGATCGCCAATCAGTCCTAA; or, TAA TTTCTACTAAGTGTAGATCAGATCTTCACGCCGGCTCTTCG.

[0024] As a possible design, the nucleotide sequence of the crRNA is TAATTTCT ACTAAGTGTAGATTCGAGATCGCCAATCAGTCCTAA.

[0025] As a possible design, the concentration of the Cas12a protein is 25-200 nM, preferably 100 nM.

[0026] As a possible design, the concentration of the crRNA is 25-200 nM, preferably 150 nM.

[0027] As a possible design, the buffer is NEBuffer r2.1, and the concentration is 0.5 times that of standard NEBuffer r2.1.

[0028] As a possible design, the photonic crystal fluorescence sensor is used to detect Salmonella, and the detection limit of the concentration of Salmonella is 1 to 1×10 8 CFU / mL.

[0029] The present invention also discloses a method for preparing a photonic crystal fluorescence sensor, which is specifically as follows:

[0030] Making a photonic crystal array

[0031] A PDMS substrate was prepared on a microplate analyzer, and then a photonic crystal was prepared on the surface of the PDMS substrate by a solvent evaporation method, as follows:

[0032] PDMS and curing agent (for example: Dow Corning DC-184 polydimethylsiloxane kit, USA) were stirred at a ratio of 10:1 (m / m) for 30 minutes and then vacuum treated until the bubbles disappeared, and the mixture was added to a microplate (a 96-size microplate can be used in the present invention) and dried at 70°C. Then, 5% (wt) monodisperse polystyrene suspension was mixed with 50% ethanol at a ratio of 1:1 (V / V) to obtain a 2.5% (wt) PS nanosphere solution, 10 μL of which was added to the surface of the prepared PDMS substrate, dried at 70°C, and ethanol and water were evaporated to obtain a PCs array.

[0033] The steps for testing for Salmonella are:

[0034] S1. Dissolve the synthesized primer powder (the nucleotide sequence was provided to Sangon Biotech Co., Ltd., and the primer powder was synthesized by the company) with TE buffer and dilute to 10μM for use. Prepare the reaction premix system: Take 29.5μL of PrimerFree Rehydration buffer, 2μL of 10μM upstream primer and 10μM downstream primer, and 13μL of enzyme-free water, add them to the RPA reaction tube to dissolve the freeze-dried enzyme and mix well, and centrifuge for 3s using a microcentrifuge. Then add 1μL of the DNA template extracted from Salmonella to the solution, add 2.5μL of 280mM magnesium acetate to the tube cap, centrifuge it using a microcentrifuge to mix it into the reaction solution, flick it to mix well, and centrifuge it again, and place it at 37℃ for 20min.

[0035] S2. Take 2 μL of the reaction product and add it to a total volume of 20 μL. The final concentrations of the components added are 100 nM Cas12a, 150 nM crRNA, 500 nM ssDNA fluorescent probe and 0.5×NEBuffer r2.1. Mix the reaction solution and place it at 37°C for 1-60 min. After the reaction, load 2 μL of the solution onto the photonic crystal array and read the fluorescence signal intensity using a multifunctional microplate analyzer.

[0036] The above detection procedure was used for the concentration of 1 to 1×10 8 CFU / mL Salmonella DNA was extracted for detection. As the concentration of Salmonella increased, the fluorescence intensity gradually increased. The cutoff value was determined by the average of three measurements of the negative control plus three times the standard deviation. The results showed that the detection limit was as low as 1 CFU / mL.

[0037] The beneficial effects of the present invention are:

[0038] 1. The present invention combines recombinase polymerase amplification and clustered regularly interspaced short palindromic repeat sequence signal amplification reaction with photonic crystal physical enhancement signal for the first time and uses it for the detection of Salmonella, which significantly improves the sensitivity of Salmonella detection.

[0039] 2. The present invention solves the problems existing in the existing culture method and PCR method in detecting Salmonella, and can achieve low-cost, high-throughput and high-sensitivity detection of Salmonella.

[0040] 3. The present invention can achieve the versatility of nucleic acid target detection by changing the primers and crRNA sequences, has a wide detection range, and has good application prospects.

[0041] 4. The present invention can compare the signal of the detected sample with the signal detected by the standard concentration gradient, and make a judgment based on the fluorescence intensity value to achieve semi-quantitative analysis of the magnitude of Salmonella.

[0042] 5. The present invention has strong anti-interference ability, good specificity, and can be used for actual sample analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0044] Figure 1 is a schematic diagram of the photonic crystal fluorescence sensor array detecting Salmonella in an embodiment of the present application;

[0045] Figure 2 It is a fluorescence enhancement multiple result diagram of the photonic crystal arrays with different particle sizes in the embodiment of the present application and a scanning electron microscope image of its surface;

[0046] Figure 3 is an optimization diagram of various reaction conditions of the photonic crystal fluorescence sensor in detecting Salmonella in the embodiment of the present application;

[0047] Figure 4 The photonic crystal fluorescence sensor in the embodiment of the present application is used to detect different concentrations of Salmonella (1-1×10 8 CFU / mL) and its specificity verification result diagram;

[0048] Figure 5 It is the amplification curve and quantitative curve of qPCR detection of different concentrations of Salmonella;

[0049] Figure 6 This is a comparison chart of the photonic crystal fluorescence sensor and qPCR detection results of 40 simulated actual samples. DETAILED DESCRIPTION

[0050] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0051] Example 1

[0052] This embodiment discloses a photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system, including a biosensing platform and a photonic crystal array;

[0053] The reaction components of the biosensor platform include RPA reagent, upstream primer, downstream primer, Cas12a protein, crRNA, ssDNA probe and buffer;

[0054] The photonic crystal array is mainly composed of a PDMS substrate, polystyrene microspheres, ethanol and a microplate analyzer.

[0055] like Figure 1 As shown, it is a detection principle diagram of a photonic crystal fluorescence sensor. When there is target Salmonella DNA, RPA primers recognize and amplify the invA gene of Salmonella, and the generated amplicon starts the CRISPR reaction as the activation chain of the CRISPR / Cas system. First, Cas12a protein forms a binary complex with crRNA, and the RPA amplicon can be specifically recognized by the crRNA designed based on the PAM (TTTN) sequence on the invA gene, thereby forming a ternary complex. After being activated, Cas12a protein can specifically cut the double-stranded DNA of the target gene near the PAM sequence site, and its trans-cutting activity is activated at the same time, non-specifically cutting the ssDNA fluorescent probe present in the solution, and the fluorescence of FAM is restored, and the product is loaded onto the photonic crystal array to further enhance the signal, and the result is read using a microplate analyzer. When there is no target Salmonella DNA in the system, RPA cannot amplify the amplicon containing the PAM sequence, and the activity of Cas12a protein is in an inhibited state, and the fluorescent ssDNA probe cannot be cut, so no fluorescent signal is generated. Thanks to the specific amplification of RPA, the specific recognition of crRNA and target gene amplicons based on base complementary pairing, and CRISPR / Cas signal amplification, the specificity and sensitivity of detection are significantly improved.

[0056] The fabrication of the photonic crystal array is as follows:

[0057] PDMS and curing agent (in this embodiment, the curing agent is specifically the American Dow Corning DC-184 polydimethylsiloxane kit) are stirred at a ratio of 10:1 (m / m) for 30 minutes and then vacuum treated until the bubbles disappear, and the mixture is added to a microplate (a 96-size microplate can be used in the present invention) and dried at 70° C. Then, a 5% (wt) monodisperse polystyrene suspension is mixed with 50% ethanol at a ratio of 1:1 (V / V) to obtain a 2.5% (wt) PS nanosphere solution, 10 μL of which is added to the surface of the prepared PDMS substrate, dried at 70° C., and the ethanol and water are evaporated to obtain a photonic crystal array.

[0058] This embodiment also discloses a method for detecting Salmonella based on the aforementioned photonic crystal fluorescence sensor, which is as follows:

[0059] S1. Dissolve the synthesized primer powder (primer powder is synthesized by the specialized Sangon Biotech Co., Ltd., and since the preparation method is a common method in the field, it will not be described in detail here) with TE buffer and dilute to 10μM for use. Prepare the reaction premix system: Take 29.5μL of Primer Free Rehydration buffer, 2μL of 10μM upstream primer and 10μM downstream primer, and 13μL of enzyme-free water, add them to the RPA reaction tube to dissolve the freeze-dried enzyme and mix well, and centrifuge for 3s using a microcentrifuge. Then add 1μL of the DNA template extracted from Salmonella to the solution, add 2.5μL of 280mM magnesium acetate to the tube cap, centrifuge it using a microcentrifuge to mix it into the reaction solution, flick it to mix well, and centrifuge it again, and place it at 37℃ for 20min.

[0060] S2. Take 2 μL of the reaction product and add it to a total volume of 20 μL. The final concentrations of the components added are 100 nM Cas12a, 150 nM crRNA, 500 nM ssDNA fluorescent probe and 0.5×NEBuffer r2.1. Mix the reaction solution and place it at 37°C for 30 minutes. After the reaction, load 2 μL of the solution onto the photonic crystal array and read the fluorescence signal intensity using a multifunctional microplate analyzer.

[0061] In this example, three pairs of primers (F1-R1, F2-R2, F3-R3) and two crRNAs (crRNA1, crRNA2) were selected and divided into six groups according to the above detection procedure. The specific sequences are shown in Table 1. The detection results are shown in Figure 3 As shown, according to Figure 3 The result shown in A, using primers F1-R1 and crRNA1, has the highest fluorescence signal.

[0062] Example 2

[0063] Compared with Example 1, the particle sizes of the photonic crystal array in this embodiment are 200nm, 220nm, 230nm, 245nm and 260nm, and the fluorescence enhancement multiples are shown in FIG. Figure 2 The left figure in Figure 2 As can be seen from the left figure in the figure, when the particle size of the photonic crystal array is 220nm, the fluorescence enhancement factor is the largest. Figure 2 The right picture in the figure is a scanning electron microscope picture of the surface of the photonic crystal array. It can be seen from the picture that the nano-microspheres are arranged periodically and orderly.

[0064] Example 3

[0065] Compared with Example 1, the concentrations of Cas12a in this embodiment are set to 25, 50, 100, 150, and 200 nM, respectively, and the preferred concentration of Cas12a is 100 nM.

[0066] Example 4

[0067] Compared with Example 1, the crRNA concentrations in this embodiment are set to 25, 50, 100, 150, and 200 nM, respectively, and the preferred crRNA concentration is 150 nM.

[0068] Example 5

[0069] Compared with Example 1, the reaction time in this example is 1 min.

[0070] Example 6

[0071] Compared with Example 1, the reaction buffers in this embodiment are NEBuffer r1.1, NEBuffer r2.1, and NEBuffer r3.1, respectively. The concentration of each buffer is set to 0.1× reaction buffer, 0.5× reaction buffer, 1× reaction buffer, 2× reaction buffer, and 10× reaction buffer, and the preferred reaction buffer is 0.5×NEBuffer r2.1.

[0072] It should be noted that the composition of NEBuffer r1.1 is: 10 mM Bis-Tris-Propane-HCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.0.

[0073] The composition of NEBuffer r2.1 is: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 and 100 pg / mL BSA, and the pH of NEBuffer r2.1 is 7.9.

[0074] The composition of NEBuffer r3.1 is: 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.9.

[0075] Example 7

[0076] Compared with Example 1, the difference in this example is that the concentration of Salmonella is 1 to 1×10 8 CFU / mL, the results are as follows Figure 4 As shown in Figure A, as the concentration of Salmonella increases, the fluorescence intensity gradually increases. The cutoff value is determined by the average of three measurements of the negative control plus three times the standard deviation. The results show that the detection limit is as low as 1 CFU / mL.

[0077] Example 8

[0078] Compared with Example 1, the difference of this example is that the purpose is to verify the detection specificity of the sensor by detecting the signals of other interfering bacteria and comparing them with the detection of Salmonella. The signal responses of Escherichia coli O157:H7, Staphylococcus aureus, Yersinia enterocolitica, Shigella flexneri and Pseudomonas aeruginosa were detected, and the results are as follows: Figure 4 As shown in Figure B, it can be seen from Figure B that the fluorescence signal when detecting non-Salmonella is significantly lower than that when detecting Salmonella, and the specificity of the photonic crystal sensor is good.

[0079] Comparative Example 1

[0080] This comparative example uses the qPCR method, and the nucleotide sequences of the primers involved are shown in Table 1. The qPCR method is used to detect the concentration of 1 to 1×10 8 CFU / mL of Salmonella, the results are as follows Figure 5 As shown, the detection limit of the qPCR method is 64 CFU / mL, because the photonic crystal fluorescence sensor disclosed in the present invention is superior to the qPCR method.

[0081] Comparative Example 2

[0082] The photonic crystal fluorescence sensor and qPCR method of Example 1 are used to verify the practical applicability of the sensor, specifically:

[0083] The chicken sample was minced, soaked in ultrapure water for 2 hours, and centrifuged to obtain the supernatant; the milk sample was sterilized and centrifuged to remove protein, and the supernatant was obtained. 20 samples of each type were randomly added with an unknown amount of Salmonella, and the detection procedure disclosed in Example 1 was used for detection. The qPCR method was also used for detection. The detection results were compared. The results are as follows: Figure 6 As shown, the correlation R2 between the two is 0.931, and the detection result of the photonic crystal fluorescence sensor of the present invention is in good consistency with the qP CR method.

[0084] Table 1

[0085]

[0086] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system, characterized in that: The photonic crystal fluorescence sensor comprises a biosensing platform and a photonic crystal array; The reaction components of the biosensor platform include RPA reagent, upstream primer, downstream primer, Cas12a protein, crRNA, ssDNA probe and buffer; The photonic crystal array is mainly composed of a PDMS substrate, polystyrene microspheres, ethanol and a microplate analyzer.

2. The photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system according to claim 1, characterized in that The nucleotide sequences of the upstream primer and the downstream primer are as follows: 5'AAGCAAAACGTAGCGCCGCCAAACCTAA3', 5'CACTCGCATCAAATCAAAATAGACCGTA3'; or, 5'TAGCGCCGCCAAACCTAAAACCAGCAAA3', 5'AATAATTTACCACTCGCATCAAATCAAA3'; Or, 5'GTACTCTCTATTTTAAATTCCGTGAAGCAAAC3', 5'GCGTTACCCAGAAATACTGACTGCTACCTTGCTG3'.

3. The photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system according to claim 2, characterized in that The nucleotide sequences of the upstream primer and the downstream primer are as follows: 5'AAGCAAAACGTAGCGCCGCCAAACCTAA3', 5'CACTCGCATCAAATCAAAATAGACCGTA3'.

4. The photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system according to claim 1, characterized in that The nucleotide sequence of the ssDNA probe is as follows: FAM-TTATTATT-BHQ1.

5. The photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system according to any one of claims 1 to 3, characterized in that The nucleotide sequence of the crRNA is TAATTTCTACTAAGTGTAGATTCGAGATCGCCA ATCAGTCCTAA; or, TAATTTCTACTAAGTGTAGATCAGATCTT CACGCCGGCTCTTCG.

6. The photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system according to claim 5, characterized in that The nucleotide sequence of the crRNA is TAATTTCTACTAAGTGTAGATTCGAGATCGCCAATCAGT CCTAA.

7. The photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system according to claim 1, characterized in that The concentration of the Cas12a protein is 25-200 nM, preferably 100 nM.

8. The photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system according to claim 1, characterized in that The concentration of the crRNA is 25-200 nM, preferably 150 nM.

9. The photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system according to claim 1, characterized in that The buffer is NEBuffer r2.1, and the concentration is 0.5 times that of standard NEBuffer r2.

1.

10. The photonic crystal fluorescence sensor based on recombinase polymerase amplification and CRISPR / Cas12a system according to claim 1, characterized in that The photonic crystal fluorescence sensor is used to detect Salmonella, and the detection limit of the concentration of Salmonella is 1 to 1×10 8 CF U / mL.

Images