Nucleic acid combination product, kit for detecting Rosetonia and detection method

Abstract

The invention belongs to the technical field of molecular biological detection, and particularly relates to a nucleic acid combination product, a kit for detecting Rosetonia and a detection method. The invention provides a nucleic acid combination product for detecting Ralstonia piceatrii, Ralstonia mannitolyticum and Ralstonia fraud, and different pathogens are detected by detecting targets on the different pathogens. With the adoption of the nucleic acid combination product, the detection and distinguishing of the Ralstonia piceatrii, the Ralstonia mannitolyticum and the Ralstonia fraud can be simultaneously realized in a single-tube reaction system. In addition, the nucleic acid combination product disclosed by the invention is high in sensitivity, precision and specificity, and has a very high clinical test value.

Description

Technical Field

[0001] The present application belongs to the field of molecular biology detection technology, and specifically relates to a nucleic acid combination product, a kit for detecting Ralstonia, and a detection method. Background Art

[0002] Ralstonia is a new genus proposed by Japanese scholar Yabuuchi et al. in 1995, and was officially announced as effective in the International Journal of Bacterial Taxonomy and Evolution in 1996. Ralstonia belongs to the Burkholderiales family of the Betaproteobacteria in taxonomy. Currently, Ralstonia includes 6 species, including Ralstonia pickettii, Ralstonia mannitolilytica, Ralstonia insidiosa, Ralstonia solanacearum, Ralstonia pseudosolanacearum and Ralstonia syzygii. Some other species that were originally classified as Ralstonia, such as Ralstonia uncommon, have been reclassified as Cupriavidus.

[0003] Ralstonia is an aerobic, non-fermenting, Gram-negative bacillus with a very wide ecological niche. It is widely distributed in water and soil in the environment and can grow and reproduce in nutrient-deficient, humid environments. It is an opportunistic pathogen for humans and an important plant pathogen.

[0004] Ralstonia piezogenes is a representative species of the genus Ralstonia. It is a strictly aerobic, non-fermenting Gram-negative rod; it is motile or non-motile. Motile strains have polar monoflagellum or periflagellum and do not form spores. Ralstonia piezogenes has been found in a variety of clinical specimens, including blood, urine, sputum, and cerebrospinal fluid. The bacterium has also been isolated from many water sources, including drinking water, bottled water, dental water supply, hospital water supply, space shuttle water supply system, standard purified water, laboratory high-purity water system, and industrial ultrapure water / high-purity water, and it has been found to form biofilms on plastic industrial water pipes. Ralstonia treacherous is the closest relative of Ralstonia piezogenes and can be isolated from river and pond water, soil, activated sludge, laboratory pure water system, industrial ultrapure water or distribution system. Ralstonia mannitololepticus is also closely related to Ralstonia pietermaritzia, and in recent years, reports of human infections caused by Ralstonia mannitolepticus have increased.

[0005] At present, there are no reports on the joint testing of three bacteria: Ralstonia pekinensis, Ralstonia mannitolol, and Ralstonia deceptiva. Summary of the invention

[0006] Based on this, an embodiment of the present application provides a nucleic acid combination product, which can perform a joint test on three bacteria: Ralstonia peutz, Ralstonia mannitolol, and Ralstonia fragilis, and has high sensitivity and specificity.

[0007] On the one hand, the present application provides a nucleic acid combination product, the nucleic acid combination product comprising:

[0008] An upstream primer having a sequence as shown in SEQ ID NO.1, and a downstream primer having a sequence as shown in SEQ ID NO.2;

[0009] An upstream primer having a sequence as shown in SEQ ID NO.4, and a downstream primer having a sequence as shown in SEQ ID NO.5;

[0010] The upstream primer has a sequence as shown in SEQ ID NO.7, and the downstream primer has a sequence as shown in SEQ ID NO.8.

[0011] In one embodiment, the nucleic acid combination product further comprises:

[0012] A detection probe having a sequence as shown in SEQ ID NO.3;

[0013] A detection probe having a sequence as shown in SEQ ID NO.6;

[0014] The detection probe has a sequence as shown in SEQ ID NO.9.

[0015] In one embodiment, the nucleic acid combination product also includes an internal reference primer pair and an internal reference detection probe.

[0016] In one embodiment, the internal reference primer pair includes: an upstream primer with a sequence as shown in SEQ ID NO.10, and a downstream primer with a sequence as shown in SEQ ID NO.11.

[0017] In one embodiment, the sequence of the internal reference detection probe is shown as SEQ ID NO.12.

[0018] In one embodiment, both ends of the detection probe are labeled with a fluorescent reporter group and a fluorescent quencher group, respectively.

[0019] In one embodiment, the 5' end of the detection probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0020] In one embodiment, the fluorescent reporter group includes one or more of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, RED610, Texas Red, RED670 and NED.

[0021] In one embodiment, the fluorescence quenching group includes one or more of TAMRA, BHQ and a non-fluorescent quencher that binds to a molecular groove.

[0022] On the other hand, the present application provides the use of the nucleic acid combination product in the preparation of a detection kit for Ralstonia pekinensis, Ralstonia mannitololense and Ralstonia trephiniae.

[0023] On the other hand, the present application provides a kit for detecting Ralstonia pekinensis, Ralstonia mannitololense and Ralstonia fragilis, comprising the nucleic acid combination product.

[0024] In one embodiment, the kit further includes: one or more of a nucleic acid releasing reagent, a nucleic acid extracting reagent, and a nucleic acid amplification reagent.

[0025] In one embodiment, the nucleic acid amplification reagent includes DNA polymerase, dNTP, UNG enzyme, PCR buffer and Mg 2+ One or more of .

[0026] On the other hand, the present application provides a method for detecting Ralstonia pekinensis, Ralstonia mannitolol and Ralstonia fragilis, comprising: providing a nucleic acid sample to be tested, and using the nucleic acid combination product to perform a PCR amplification reaction on the nucleic acid sample to be tested. Details of one or more embodiments of the present application are set forth in the following description, and other features, objects and advantages of the present application will become apparent from the specification and claims thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0028] Figure 1 The test results for Ralstonia piezosus;

[0029] Figure 2 To solve the Ralstonia mannitol test results;

[0030] Figure 3To falsify the Ralstonia test results;

[0031] Figure 4 It is the positive control test result;

[0032] Figure 5 This is the sensitivity test result of Ralstonia piezosus;

[0033] Figure 6 To solve the sensitivity test results of Ralstonia mannitol;

[0034] Figure 7 To falsify the sensitivity test results of Ralstonia;

[0035] Figure 8 This is the precision test result of Ralstonia piezoelectrica;

[0036] Fig. 9 To solve the precision test results of Ralstonia mannitol;

[0037] Fig.10 To falsify the precision test results of Ralstonia;

[0038] Fig.11 The specific test results of the nucleic acid product of this application;

[0039] Fig.12 This is a comparison chart of primer and probe testing for Ralstonia pekinensis. DETAILED DESCRIPTION

[0040] Below in conjunction with embodiment and example, the application is further described in detail.It should be understood that these embodiments and examples are only used to illustrate the application and are not used to limit the scope of the application, and the purpose of providing these embodiments and examples is to make the understanding of the disclosure of the application more thorough and comprehensive.It should also be understood that the application can be implemented in many different forms, is not limited to the embodiment and example described herein, and those skilled in the art can make various changes or modifications without violating the connotation of the application, and the equivalent form obtained also falls within the protection scope of the application.In addition, in the description below, a large number of specific details are given in order to provide a more comprehensive understanding of the application, and it should be understood that the application can be implemented without one or more of these details.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0042] the term

[0043] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0044] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0045] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0046] As used herein, "combination thereof", "any combination thereof", "any combination thereof" etc. include all suitable combinations of any two or more of the listed items.

[0047] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc., shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0048] In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0049] In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0050] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0051] In the present application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1 to 10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges included therein.

[0052] The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

[0053] In the present application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0054] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference separately. Unless they conflict with the invention purpose and / or technical solution of this application, the cited documents involved in this application are cited with all contents and all purposes. When the cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the cited documents are involved in this application, the examples and preferred methods of the cited relevant technical features can also be incorporated into this application as references, but are limited to the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be modified adaptively according to the description of this application.

[0055] Fluorescence quantitative PCR (Quantitative Real-time PCR) technology is a method that uses fluorescent chemicals to measure the total amount of products after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. It includes the non-specific SYBRGreen I dye method and the specific Taqman hydrolysis probe method.

[0056] Taq man fluorescence quantitative technology is based on Taq man fluorescent probe, which is an oligonucleotide with a fluorescent emission group and a fluorescent quenching group labeled at both ends. When the probe is intact, the fluorescent signal emitted by the emission group is absorbed by the quenching group; when PCR amplification is performed, the 5'-3' exonuclease activity of the Taq enzyme will enzymatically degrade the probe, separating the fluorescent emission group and the fluorescent quenching group, so that the fluorescent monitoring system can receive the fluorescent signal, that is, for each DNA chain amplified, a fluorescent molecule is formed, achieving complete synchronization between the accumulation of the fluorescent signal and the formation of the PCR product, thereby achieving quantification.

[0057] In this application, BioEdit software was used to compare the homology of the retrieved sequences of 16S rRNA of Ralstonia pekinensis, hemH gene of Ralstonia mannitolol, and 16S rRNA of Ralstonia trephinia, and Primer Express3.0 and DNASTAR lasergene software were used to design primers and probes in the conserved segments, and 3 sets of detection primers and corresponding detection probes were designed for each target through retrieval analysis using the Blast tool in the GenBank database.

[0058] Three sets of primers and probes designed for Ralstonia pekinensis are as follows: RP-F1, RP-R1, RP-P1, RP-F2, RP-R2, RP-P2, RP-F3, RP-R3, RP-P3.

[0059] Three sets of primers and probes designed for Ralstonia mannitoleptica are as follows: RM-F1, RM-R1, RM-P1, RM-F2, RM-R2, RM-P2, RM-F3, RM-R3, RM-P3.

[0060] The three sets of primers and probes designed for Ralstonia fragilis are as follows: RI-F1, RI-R1, RI-P1, RI-F2, RI-R2, RI-P2, RI-F3, RI-R3, RI-P3.

[0061] The present application further conducts joint testing on the different target systems screened out, and adds optimized internal standards, including the housekeeping gene RNase P primer probe system RNase PF, RNase PR, and RNase PP, for joint testing to form a multiple system, thereby obtaining the nucleic acid combination product of the present application.

[0062] On the one hand, the present application provides a nucleic acid combination product, which includes:

[0063] A primer pair for detecting Ralstonia piezogenes, comprising an upstream primer having a sequence as shown in SEQ ID NO.1, and a downstream primer having a sequence as shown in SEQ ID NO.2;

[0064] A primer pair for detecting Ralstonia mannitolense, comprising an upstream primer having a sequence as shown in SEQ ID NO.4, and a downstream primer having a sequence as shown in SEQ ID NO.5;

[0065] The detection primer pair for Ralstonia treacherous includes an upstream primer whose sequence is shown as SEQ ID NO.7, and a downstream primer whose sequence is shown as SEQ ID NO.8.

[0066] In a specific example, the nucleic acid combination product also includes: a detection probe for Ralstonia pieri, whose sequence is shown in SEQ ID NO.3; a detection probe for Ralstonia mannitolologenetics, whose sequence is shown in SEQ ID NO.6; and a detection probe for Ralstonia trexate, whose sequence is shown in SEQ ID NO.9.

[0067] In a specific example, the nucleic acid combination product also includes an internal reference primer pair and an internal reference detection probe.

[0068] Optionally, the internal reference primer pair includes: an upstream primer whose sequence is shown as SEQ ID NO.10, and a downstream primer whose sequence is shown as SEQ ID NO.11.

[0069] Optionally, the sequence of the internal reference detection probe is shown as SEQ ID NO.12.

[0070] The specific sequence above is:

[0071] TAGTTGGTGAGGTAAAGGCTC (SEQ ID NO.1)

[0072] CCCAGGTATTAACCAGAGCCA (SEQ ID NO.2)

[0073] GACGATCAGTAGCTGGTCTGAGAGGA (SEQ ID NO.3)

[0074] CAGTGATACGGATCGCCCAGT (SEQ ID NO.4)

[0075] GATGCGCAATCAGCCTGAAC (SEQ ID NO.5)

[0076] CAGGGTCCGTCGCGGCACAC (SEQ ID NO.6)

[0077] ATTTTGGACAATGGGGGCAAC (SEQ ID NO.7)

[0078] CATCCACACCTAATATTAGTAAGTGCGA (SEQ ID NO.8)

[0079] GATCCAGCAATGCCGCGTGTGTGA (SEQ ID NO.9)

[0080] CGGTCATGGGACTTCAGC (SEQ ID NO.10)

[0081] ACCTGAAGGCTCTGCG (SEQ ID NO.11)

[0082] TTGCAGATTTGGACCTGCGAGC (SEQ ID NO.12)

[0083] In a specific example, both ends of the detection probe are labeled with a fluorescent reporter group and a fluorescent quencher group, respectively.

[0084] Optionally, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0085] In a specific example, the fluorescent reporter group includes, but is not limited to, one or more of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, RED610, Texas Red, RED670, and NED. It is understood that the absorbance values ​​of these groups are not close, and different channels can be selected, so they will not interfere with each other.

[0086] Optionally, the fluorescence quenching group includes one or more of TAMRA, BHQ and a non-fluorescent quencher that binds to the molecular groove.

[0087] Non-fluorescent quenchers (NFQ) are a class of chemical substances used in fluorescence detection technology. They can quench fluorescence by interacting with fluorescent substances and converting the excited state energy in fluorescent substances into a non-fluorescent form. This quenching effect is crucial for controlling the switching of fluorescent signals and realizing the detection and quantitative analysis of fluorescent signals.

[0088] For example, in a specific embodiment, the fluorescent reporter group of the Ralstonia pekinensis 16S rRNA probe is FAM; the fluorescent reporter group of the Ralstonia mannitololense 16S rRNA probe is HEX; the fluorescent reporter group of the Ralstonia trephinia 16S rRNA is ROX; and the fluorescent reporter group of the RNaseP gene is CY5.

[0089] On the other hand, the present application provides the use of the above-mentioned nucleic acid combination product in the preparation of a detection kit for Ralstonia pekinensis, Ralstonia mannitololense and Ralstonia trephiniae.

[0090] The present application also provides a kit for detecting Ralstonia pekinensis, Ralstonia mannitololense and Ralstonia fragilis, and the kit includes the above-mentioned nucleic acid combination product.

[0091] In a specific example, the kit further includes a nucleic acid release reagent, a nucleic acid extraction reagent, a DNA polymerase, dNTPs, a UNG enzyme, a PCR buffer, and Mg. 2+ One or more of .

[0092] On the other hand, the present application provides a method for detecting Ralstonia peutz, Ralstonia mannitololense and Ralstonia trephinsis for non-disease diagnosis purposes, comprising:

[0093] The nucleic acid of the sample to be tested is extracted or released, and the nucleic acid combination product is used to perform PCR amplification on the nucleic acid sample to be tested.

[0094] The expression of Ralstonia piscivorans, Ralstonia mannitololense and Ralstonia fragilis is highly correlated with a variety of infectious diseases such as acquired pneumonia, sepsis in patients with cerebral hemorrhage, bacteremia in patients with cardiac cancer, etc. Therefore, the nucleic acid composition and detection method provided in the present application have a high clinical test value.

[0095] In addition, due to the high polymorphism of Ralstonia piscivorans, Ralstonia mannitololense and Ralstonia fragilis, they can also be used for research in fields such as sociology (such as bacterial species distribution, etc.).

[0096] The present application provides a nucleic acid combination product for detecting Ralstonia piezogenes, Ralstonia mannitololase and Ralstonia fragilis. Different pathogens are detected by detecting targets on different pathogens. The nucleic acid combination product can simultaneously detect and distinguish Ralstonia piezogenes, Ralstonia mannitolase and Ralstonia fragilis in a single-tube reaction system. In addition, the nucleic acid combination product of the present application has high sensitivity, precision and specificity, and has high clinical test value.

[0097] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0098] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0099] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0100] Example 1

[0101] This embodiment provides a nucleic acid combination product for amplifying Ralstonia peutz, Ralstonia mannitolol, and Ralstonia fragilis:

[0102] The primers and probes used in this application are shown in Table 1:

[0103] Table 1

[0104]

[0105] Among them, the fluorescent reporter group of the 16S rRNA probe of Ralstonia pekinensis is FAM; the fluorescent reporter group of the 16S rRNA probe of Ralstonia mannitolol is HEX; the fluorescent reporter group of the 16S rRNA of Ralstonia trephinia is ROX; and the fluorescent reporter group of the RNaseP gene is CY5.

[0106] Example 2

[0107] This embodiment provides a method for detecting Ralstonia peutz, Ralstonia mannitololense and Ralstonia facilis.

[0108] 1. PCR reaction system

[0109] The fluorescent PCR reaction solution of this embodiment includes Mg 2+ , dNTPs (100 mM), UNG enzyme (2 U / µL), Taq enzyme (5 U / µL) and PCR buffer (1×) as well as the primers and probes in Example 1. The specific reaction system is shown in Table 2 below:

[0110] Table 2

[0111]

[0112] 2. PCR Amplification Procedure

[0113] On PCR instruments such as ABI 7500 fluorescence quantitative PCR instrument, Life Technologies Quant StudioTM 5 fluorescence PCR instrument, SLAN-96P fully automatic medical PCR analysis system, PCR amplification was performed according to certain temperature and time setting programs. The specific amplification program is shown in Table 3:

[0114] Table 3

[0115]

[0116] Explanation of test results: If the sample has an obvious S-shaped amplification curve in the FAM, HEX (VIC), ROX, and CY5 channels, and the Ct value is ≤40, it is judged as positive; if the sample has no amplification curve (No Ct) or the Ct value is greater than 40 in the FAM, ROX, and CY5 channels, and the HEX (VIC) internal standard channel is positive (Ct value ≤40), it is judged as negative, as shown in Table 4 below:

[0117] Table 4

[0118]

[0119] 3. Verification of the validity of test results

[0120] The combined product of the present application was used to detect the full-length plasmids of Ralstonia pekinensis, Ralstonia mannitolol, and Ralstonia treacherous, and PCR detection was performed on a Macrostone fluorescent quantitative PCR instrument. The results are as follows: Figure 1~Figure 3 shown; Figure 1 The test result showed positive for Ralstonia piezosus; Figure 2 The test result showed positive for Ralstonia mannitolase; Figure 3 The test result for Ralstonia fragilis was positive; Figure 4 As positive control.

[0121] 4. Detection Sensitivity Verification

[0122] The gradient dilution plasmid was taken, and the concentrations were 500000 copies / mL, 50000 copies / mL, 5000 copies / mL, 500 copies / mL, 200 copies / mL, and the five concentrations were tested respectively, and 5uL was taken as a template. The results showed that the method of the present application has high sensitivity and the detection concentration can reach 500 copies / mL.

[0123] Figure 5 This is the sensitivity test result of Ralstonia piezogenes. Figure 6 To understand the sensitivity test results of Ralstonia mannitol, Figure 7 This is the sensitivity test result for Ralstonia.

[0124] 5. Detection sensitivity verification

[0125] This application selected two concentration levels (500000 copies / mL and 5000 copies / μL) of quality control products for precision determination, and each sample was repeated 10 times. The results showed that the detection rate of the two reference products was 100%, and the coefficient of variation (CV) of the detection Ct value was less than 5%. It can be considered that the nucleic acid composition of this application has good detection precision. The specific test results are as follows Figure 8~Figure 10 As shown, Figure 8 This is the precision test result of Ralstonia piezoelectrica. Fig. 9 To understand the precision test results of Ralstonia mannitol, Fig.10 To falsify the precision test results of Ralstonia.

[0126] VI. Validation of Assay Specificity

[0127] The nucleic acid detection composition of the present application is used to detect coronaviruses (NL63, HKU1, 229E, OC43), SARS coronavirus, MERS coronavirus, Candida glabrata, Streptococcus pneumoniae, Serratia marcescens, Escherichia coli, Staphylococcus epidermidis, Acinetobacter baumannii, Klebsiella pneumoniae, Candida tropicalis, Candida krusei, Enterococcus faecalis, Haemophilus influenzae, Staphylococcus aureus, influenza A virus, influenza B virus, Neisseria meningitidis, varicella, herpes zoster, herpes simplex, measles, dengue fever, hepatitis A virus, hepatitis B virus, hepatitis C virus, rubella virus, etc.

[0128] The results showed: there was no nonspecific amplification, indicating no cross-reaction with other pathogens and high specificity.

[0129] Comparative Example 1

[0130] This comparative example uses primers and probes of other designs for amplification. The PCR reaction system and amplification procedure are the same as those in Example 2. The test results are as follows: Fig.12 shown.

[0131] The above-described embodiments only express several implementation methods of the present application, which is convenient for understanding the technical solution of the present application in detail, but it cannot be understood as a limitation on the scope of protection of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present application, several deformations and improvements can be made, which all belong to the protection scope of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, the technicians in this field can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by the technicians in this field through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the protection scope of the claims attached to the present application. Therefore, the protection scope of the patent of the present application shall be based on the content of the attached claims, and the description can be used to interpret the content of the claims.

Claims

1. A nucleic acid combination product, characterized in that: The nucleic acid combination product includes: An upstream primer having a sequence as shown in SEQ ID NO.1, and a downstream primer having a sequence as shown in SEQ ID NO.2; An upstream primer having a sequence as shown in SEQ ID NO.4, and a downstream primer having a sequence as shown in SEQ ID NO.5; and, The upstream primer has a sequence as shown in SEQ ID NO.7, and the downstream primer has a sequence as shown in SEQ ID NO.

8.

2. The nucleic acid combination product according to claim 1, characterized in that: The nucleic acid combination product also includes: A detection probe having a sequence as shown in SEQ ID NO.3; and / or A detection probe having a sequence as shown in SEQ ID NO.6; and / or The detection probe has a sequence as shown in SEQ ID NO.

9.

3. The nucleic acid combination product according to claim 1, characterized in that: The nucleic acid combination product also includes an internal reference primer pair and an internal reference detection probe; Optionally, the internal reference primer pair comprises: an upstream primer having a sequence as shown in SEQ ID NO.10, and a downstream primer having a sequence as shown in SEQ ID NO.11; Optionally, the sequence of the internal reference detection probe is shown in SEQ ID NO.

12.

4. The nucleic acid combination product according to any one of claims 2 to 3, characterized in that: The two ends of the detection probe are respectively labeled with a fluorescent reporter group and a fluorescent quencher group; Optionally, the 5' end of the detection probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

5. The nucleic acid combination product according to claim 4, characterized in that: The fluorescent reporter group includes one or more of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, RED610, Texas Red, RED670 and NED.

6. The nucleic acid combination product according to claim 4, characterized in that: The fluorescence quenching group includes one or more of TAMRA, BHQ and a non-fluorescence quencher that binds to a molecular groove.

7. Use of the nucleic acid combination product according to any one of claims 1 to 6 in the preparation of a detection kit for Ralstonia pievophylla, Ralstonia mannitololense and Ralstonia trephiniae.

8. A kit for detecting Ralstonia peutz, Ralstonia mannitololeptica and Ralstonia trephiniae, characterized in that: The kit comprises the nucleic acid combination product according to any one of claims 1 to 6.

9. The kit according to claim 8, characterized in that The kit further comprises: one or more of a nucleic acid releasing reagent, a nucleic acid extracting reagent, and a nucleic acid amplifying reagent; Optionally, the nucleic acid amplification reagent includes DNA polymerase, dNTP, UNG enzyme, PCR buffer and Mg 2+ One or more of .

10. A method for detecting Ralstonia peutz, Ralstonia mannitololeptica and Ralstonia trephinica, characterized in that: include: A nucleic acid sample to be tested is provided, and a PCR amplification reaction is performed on the nucleic acid sample to be tested using the nucleic acid combination product according to any one of claims 1 to 6.

Images