Quantitative detection method of nucleic acid sample and application

Abstract

The invention provides a probe and primer combination, a standard substance, a detection kit, a Real-time PCR detection method and application of the Real-time PCR detection method in detection of a nucleic acid sample.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and in particular relates to a probe, a probe and primer combination, a standard product, a Real-time PCR detection kit and a detection method for detecting nucleic acid samples. Background Art

[0002] The maize transformant MN85zN-Ey is a maize transgenic material that is insect-resistant and resistant to glufosinate (Chinese patent application number is 2024119174418). It has excellent resistance to lepidopteran pests such as fall armyworm and corn borer, and good tolerance to glufosinate. This transformant can be used to breed insect-resistant and herbicide-resistant maize varieties. Establishing a transformant-specific detection method can provide an effective detection method for the identification and supervision of genetically modified organisms, and provide technical support for the safety management of agricultural genetically modified organisms.

[0003] The detection of transformant specificity mainly uses the common PCR method, but its disadvantages are low sensitivity, inability to monitor the PCR process in real time, and inability to quantify. With the development of molecular biology technology, Real-time PCR (real-time fluorescence quantitative PCR) has been widely used in transgenic detection. Compared with conventional PCR technology, it has the characteristics of short time consumption, simple operation, good specificity, and high sensitivity. The process can be monitored in real time, the results can be directly observed, and quantitative detection can be performed.

[0004] Real-time PCR methods can be divided into two types: dye method and probe method. The fluorescent dye in the dye method Real-time PCR can bind to double-stranded DNA to emit fluorescence, and its binding is non-specific. The primer dimers and DNA templates in the system will bind to it, so the specificity of the dye method is not high. The probe in the probe method can specifically bind to the template, and its amplification curve reflects the accumulation of specific products. It does not contain non-specific amplification components, and its sensitivity is 10 times higher than that of the dye method. In addition, the dye method only supports single-channel reactions. If multi-channel experiments are required, or if different targets of the same sample are to be detected, the probe method is the most commonly used. Summary of the invention

[0005] To solve the above problems, the present invention provides probes, probe and primer combinations, standard products, detection kits, and Real-time PCR detection methods for detecting nucleic acid samples. The above nucleic acid sample can be genomic DNA of a corn MN85zN-Ey transformant, or genomic DNA of a MN85zN-Ey transformant derivative line, or genomic DNA of a mixed corn material containing MN85zN-Ey transformants, or a nucleic acid sample containing MN85zN-Ey identity information separated from the above sample by PCR amplification or the like. Since the sequence shown in SEQ ID NO. 1 is a specific sequence for confirming the identity information of the MN85zN-Ey transformant, any sample containing a nucleic acid molecule of the sequence shown in SEQ ID NO. 1 can be detected by the method provided by the present invention.

[0006] The present invention can accurately identify maize MN85zN-Ey transformants by designing highly sensitive and specific probes, upstream primers and downstream primers, and can separate them from conventional maize and other transgenic maize materials that do not contain MN85zN-Ey. The detection method has the advantages of high specificity, sensitivity and ease of operation, and makes up for the shortcomings of conventional PCR methods, such as cumbersome procedures and low detection sensitivity.

[0007] The present invention provides a probe, characterized in that the nucleotide sequence of the probe is 5'-TTGGATCAGATTGTCGTTTCCCGCC-3'.

[0008] In some embodiments, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group. When the probe is in a free state, the fluorescence emitted by the fluorescent group will be absorbed by the quencher group; during the PCR amplification process, the fluorescent group at the 5' end of the probe tightly bound to the template will be cleaved by the Taq enzyme, thus away from the quencher group at the 3' end, and the fluorescence emitted by the fluorescent group can be received by the instrument, and the generated fluorescence signal is proportional to the amount of amplified product in the sample.

[0009] In some embodiments, the fluorescent group includes any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA or Texas; the quenching group includes any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL or MGB; In some embodiments, the fluorescent group / quencher group combination is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA, or VIC / BHQ2; In the test of randomly selected fluorescent groups and quenching groups, the probes labeled with the above fluorescent groups and quenching groups can obtain specific detection results. At the same time, the probe labeled with FAM at the 5' end and BHQ1 at the 3' end has the lowest labeling cost and can be used as the most preferred probe labeling scheme.

[0010] The present invention also provides a primer and probe combination, characterized in that: it comprises the above-mentioned probe and two primers, the nucleotide sequences of the primers are 5'-CCTGAATGGCGAATGCTAGAG-3' and 5'-TGTACTGGCAATGTTATGTGTTTCC-3'; The above-mentioned probe and probe and primer combination were selected through software design, experimental screening and verification, and were located at the downstream boundary of the exogenous insertion sequence of the MN85zN-Ey transformant.

[0011] The present invention also provides a standard, characterized in that: the standard is one or more nucleic acid samples with a concentration of not less than 87 copies / μL; the nucleic acid sample contains a nucleic acid molecule with a sequence shown in SEQ ID NO. 1; In some embodiments, the standard comprises five concentrations of 8.7×10 5 copies / μL, 8.7×10 4 copies / μL, 8.7×10 3 copies / μL, 8.7×10 2 MN85zN-Ey genomic DNA of 10.7×10 copies / μL and 8.7×10 copies / μL; the DNA sample contains the nucleic acid molecule shown in SEQ ID NO. 1; In some embodiments, the preparation method of the standard is: take a MN85zN-Ey genomic DNA sample with a concentration of 2.2 μg / μL, dilute it 10 times, 10 times, 2 times, 10 3 times, 10 4 times.

[0012] The present invention also provides a detection kit, characterized in that: the detection kit comprises the above-mentioned probe and primer combination and the above-mentioned standard product; In some embodiments, the detection kit comprises: Primer 1, sequence: 5′-CCTGAATGGCGAATGCTAGAG-3′; Primer 2, sequence: 5′-TGTACTGGCAATGTTATGTGTTTCC-3′; probe, sequence: 5′-TTGGATCAGATTGTCGTTTCCCGCC-3′; Standard, 5 concentrations of 8.7×10 5 copies / μL, 8.7×10 4 copies / μL, 8.7×10 3 copies / μL, 8.7×10 2 MN85zN-Ey genomic DNA samples with 10 copies / μL and 8.7×10 copies / μL; the nucleic acid sample contains a nucleic acid molecule with a sequence shown in SEQ ID NO. 1; The 5' end of the probe is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group BHQ1.

[0013] The present invention also provides a real-time PCR detection method, characterized in that: the real-time PCR detection is performed using the above detection kit, wherein the final concentrations of primer 1 and primer 2 in the PCR reaction system are both 0.4 μM, and the final concentration of the probe is 0.2 μM.

[0014] The present invention also provides the use of the above-mentioned probe, probe and primer combination, standard, detection kit, and detection method in qualitative or quantitative detection of nucleic acid samples; wherein the nucleic acid sample contains a nucleic acid molecule with a sequence shown in SEQ ID NO. 1.

[0015] The beneficial effects of the present invention are as follows: after software design and multiple test screenings, a combination of 1 probe and 2 primers is obtained from a large number of probe-primer combinations, and on this basis, a Real-time PCR detection method is established and optimized using standard products with a suitable concentration gradient. The above-mentioned probes, probe and primer combinations, standard products, detection kits, and Real-time PCR detection methods can specifically detect nucleic acid samples containing SEQ ID NO. 1 with a concentration of not less than 87 copies / μL, and can effectively distinguish MN85zN-Ey materials from other corn materials that do not contain MN85zN-Ey, with extremely high sensitivity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Other features, objects and advantages of the present application will become more apparent by reading the detailed description of non-limiting embodiments made with reference to the following drawings: Figure 1 Sensitivity test curve. Among them, 1: 8.7×10 5 Copies / μL; 2: 8.7×10 4 Copies / μL; 3: 8.7×10 5 Copies / μL; 4: 8.7×10 2 copies / μL; 5: 8.7×10 copies / μL; 6: 8.7 copies / μL.

[0017] Figure 2 Standard curve and linear equation.

[0018] Figure 3 Specific sample detection test: 1: a mixed sample of B104 and MN85zN-Ey (sample 1); 2: a mixed sample of B104 and MN85N-E1 (sample 2). DETAILED DESCRIPTION

[0019] The present invention will be further described below in conjunction with the accompanying drawings. The following examples are only used to illustrate the present invention but do not limit the scope of the present invention.

[0020] The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stalks, roots, root tips, anthers, etc. It should be understood that the parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves and roots, which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of the present invention and are therefore at least partially composed of transgenic cells.

[0021] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences before the coding sequence (5' non-coding sequences) and regulatory sequences after the coding sequence (3' non-coding sequences). "Native gene" refers to a gene found in nature with its own regulatory sequences. "Chimeric gene" refers to any gene that is not a natural gene, which contains regulatory and coding sequences that are not found in nature. "Endogenous gene" refers to a natural gene that is located in its natural position in the genome of an organism. "Foreign gene" is a foreign gene that is now present in the genome of an organism and did not exist originally, and also refers to a gene introduced into a recipient cell through a transgenic step. Foreign genes can include natural genes or chimeric genes inserted into non-natural organisms. "Transgenic" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where recombinant DNA has been inserted can be called an "insertion site" or "target site."

[0022] Transformation procedures that cause random integration of foreign DNA can result in transformants containing different flanking regions, which are specifically contained in each transformant. When recombinant DNA is introduced into plants by traditional hybridization, its flanking regions are usually not changed. Transformants will also contain a unique junction between a segment of heterologous insert DNA and genomic DNA or between two segments of genomic DNA or between two segments of heterologous DNA. "Joint" is the point where two specific DNA fragments connect. For example, the junction is present at the position where the insert DNA connects to the flanking DNA. Junction points are also present in transformed organisms, where two DNA fragments are connected together in a manner found in natural organisms. "Joint DNA" refers to the DNA that contains a junction point.

[0023] MN85zN-Ey transformants are plants and seeds comprising transgenic corn MN85zN-Ey and plant cells or regenerable parts thereof, wherein the plant parts of MN85zN-Ey include but are not limited to cells, pollen, ovules, flowers, buds, roots, stems, silks, inflorescences, ears, leaves and products from the corn plant MN85zN-Ey, such as corn stover, corn meal, corn flour, corn oil and biomass remaining in corn crop fields.

[0024] The term "probe" is an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule is bound, such as a radioisotope, a ligand, a chemiluminescent agent or an enzyme. The probe is complementary to a strand of the target nucleic acid. In the present invention, the probe is complementary to a DNA strand from the genome of transgenic corn MN85zN-Ey, whether the genomic DNA is from transgenic corn MN85zN-Ey or seeds or plants or seeds or extracts from transgenic corn MN85zN-Ey and other derivative lines, or a nucleic acid molecule containing MN85zN-Ey identity information isolated from MN85zN-Ey. The probe of the present invention includes not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of the target DNA sequence.

[0025] The term "primer" is a separate nucleic acid molecule that anneals to a complementary target DNA strand through nucleic acid hybridization, forms a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pair of the present invention relates to its use in amplifying a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods. Example 1 Design and screening of specific primer / probe combinations The specific detection method of transformants requires the design of primers and probes at the border sequences upstream and downstream of the insertion site, and the PCR amplification product needs to include the exogenous sequence and the maize genome sequence. Therefore, first, primers and probes should be designed based on the border sequences of the maize MN85zN-Ey insertion site.

[0026] 1. Design primer and probe combinations A portion of the upstream or downstream border sequence (100-600 bp) is input as a template into the software (such as ABI PrimerExpress 3.0). The template sequence must contain both the maize genome sequence (at least 50 bp in length) and the exogenous insertion sequence (at least 50 bp in length). The two template sequences are shown as SEQ ID NO. 2 and SEQ ID NO. 3.

[0027] After setting the relevant parameters in the software according to the following requirements, dozens of primer and probe combinations were obtained. These combinations were all from the downstream boundary sequence of the MN85zN-Ey insertion site, and each combination contained 2 primers and 1 probe.

[0028] The probes and primers meet all of the following requirements: ① The length of the primer is between 18 and 25 bp, and the length of the probe is between 18 and 30 bp; ② The Tm value of the primer is 58~60℃, and the Tm value of the probe is 8-10℃ higher than that of the primer; ③ Avoid generating complementary sequences of more than 3 bases inside the probe, inside the primer, or between the probe and the primer; ④ The first base at the 5' end of the probe is not G; ⑤ The two primers are located in the maize genome and the exogenous insertion sequence respectively.

[0029] ⑥ The length of the PCR product is between 80-300 bp.

[0030] Finally, 5 sets of primers and probes with higher software scores were selected as candidate combinations for further screening. The candidate combinations are shown in Table 1.

[0031] Table 1 Five candidate primers and probes with higher software design scores combination Primer 1 Primer 2 Probe P A1 CCTGAATGGCGAATGCTAGAG TGTACTGGCAATGTTATGTGTTTCC TTGGATCAGATTGTCGTTTCCCGCC A2 GCGAATGCTAGAGCAGCTTGA TGTACTGGCAATGTTATGTGTTTCC TTGGATCAGATTGTCGTTTCCCGCC A3 TGGCAATGTTATGTGTTTCCAATAT CCTGAATGGCGAATGCTAGAG CGGGAAACGACAATCTGATCCAAGCTC A4 TGGCAATGTTATGTGTTTCCAATAT GCCTGAATGGCGAATGCTA CGACAATCTGATCCAAGCTCAAGCTGC A5 GCGAATGCTAGAGCAGCTTGA TGTACTGGCAATGTTATGTGTTTCC TCAGATTGTCGTTTCCCGCCTTCAGTT 2. Primer synthesis and screening The five sets of primers shown in Table 1 were synthesized and screened for specific primers. The screening process was as follows: (1) Use ordinary PCR amplification reaction to detect primers 1 and 2 of the five candidate combinations. The electrophoresis results are shown in Table 2. The results show that combinations A2 and A5 amplified two bands, that is, there was non-specific amplification; the primers of combinations A1, A3 and A4 amplified a single specific band of the expected size, so combinations A2 and A5 were eliminated; primers 1 and primer 2 of combinations A1, A3 and A4 met the requirements and were further tested.

[0032] Table 2 Specific primers for conventional PCR screening combination Number of amplified bands Band size (bp) Does it meet the requirements? A1 1 100-250 yes A2 2 250-500，100-250 no A3 1 100-250 yes A4 1 100-250 yes A5 2 250-500，100-250 no (2) Real-time PCR reaction using SYBR Green dye was used to detect primer 1 and primer 2 of combinations A1, A3 and A4. The results of real-time PCR reaction are shown in Table 3. The results showed that the amplification curves of the three combinations were normal, with Ct values ​​<35, and the melting curves were single peaks. Therefore, primer 1 and primer 2 of combinations A1, A3 and A4 met the requirements and can be further tested.

[0033] Table 3 SYBR Green dye method Real-time PCR screening of specific primers combination Amplification curve Ct value Melting curve Does it meet the requirements? A1 have 26.88 Single Peak yes A3 have 28.17 Single Peak yes A4 have 27.94 Single Peak yes 3. Probe synthesis and screening Probes of the synthesis combinations A1, A3 and A4 were modified with the fluorescent labeling group FAM at the 5' end and the fluorescent quenching group BHQ1 at the 3' end.

[0034] The primers and probes of combinations A1, A3 and A4 were tested by real-time PCR reaction using the probe method, and the reaction results are shown in Table 4. The results showed that combinations A1, A3 and A4 were successfully amplified, with Ct values ​​of 32.91, 34.72 and 35.85, respectively, and combination A1 had the highest fluorescence signal value.

[0035] Therefore, combination A1 with the smallest Ct value and the highest fluorescence signal value was selected as the primer and probe for quantitative detection of maize transformant MN85zN-Ey.

[0036] Table 4 Probe method Real-time PCR screening specific primers and probe combinations combination Amplification curve Ct value Filter results A1 have 32.91 √ A3 have 34.72 disuse A4 have 35.85 disuse The probe and primer of combination A1 are located at the downstream boundary of the exogenous insertion sequence. The specific sequence and position are as follows (lowercase letters are vector sequences, uppercase letters are genome sequences, the bold part indicates the location of the primer, and the underlined part indicates the location of the probe): cctgaatggcgaatgctagagcagcttgagc ttggatcagattgtcgtttcccgccttcagtttaaactatcagtgtttgacaggatatattggAAACACATAACATTGCCAGTACA The primer and probe sequences are as follows: Primer 1: 5'-CCTGAATGGCGAATGCTAGAG-3' Primer 2: 5'-TGTACTGGCAATGTTATGTGTTTCC-3' Probe P: FAM-TTGGATCAGATTGTCGTTTCCCGCC-BHQ1 Example 2 Preparation of Standards To quantitatively analyze the initial template amount of a sample using real-time PCR, it is necessary to use a standard sample with a known copy number to make a standard curve, then obtain the Ct value of the sample to be tested through PCR, and finally calculate the copy number of the sample from the standard curve. Therefore, first of all, it is necessary to prepare a suitable standard sample, and the preparation method is as follows: 1. Extraction of genomic DNA from maize MN85zN-Ey The CTAB method was used for extraction. The specific steps are as follows: 1) Take 0.2 g of corn MN85zN-Ey sample leaves, grind them into powder, add 500-800 μL CTAB, and incubate at 65°C for 0.5 h; 2) Add 700 μL of chloroform or chloroform:isoamyl alcohol (24:1), shake slowly, centrifuge at 12,000 rpm for 15 min, and take 400-700 μL of the supernatant; 3) Add 1 mL of pre-cooled anhydrous ethanol or isopropanol, mix thoroughly, centrifuge at 12,000 rpm for 10 min, and discard the supernatant; 4) Wash the precipitate with 75% alcohol, centrifuge at 12000 rpm for 5 min, discard the alcohol, and invert to absorb water and dry; 5) Dissolve the DNA in 50 μL ddH2O, take 5 μL for electrophoresis, and measure the DNA concentration using a UV spectrophotometer to be 2.2 μg / μL.

[0037] 2. Preparation of a series of concentration gradient standards When performing real-time PCR, the concentration of the standard template needs to be expressed in "copies / μL".

[0038] Calculation formula: Template concentration (copies / μL) = Avogadro constant × number of template moles, where Avogadro constant = 6.02 × 10 23Copy / mol, template molecular weight = template DNA length (number of bases) × 660 (average molecular weight of bases).

[0039] According to the above formula, 2.2 μg / μL of MN85zN-Ey genomic DNA solution is 6.02×10 23 copies / mol×(2.2×10 -6 g / μL) / (2300*10 6 ×660 g / mol), which is 8.7×10 5 Copies / μL Take 1 μL of the above solution and dilute it 10 times to get a concentration of 8.7×10 5 ~8.7×10 copies / μL standard. Store at -20℃ for future use. Example 3 Establishment and optimization of probe-based real-time PCR reaction system The present invention obtains a usable probe and primer combination through the operation of Example 1, and obtains a series of standard products with concentration gradients through Example 2. However, whether the specific Real-time PCR reaction system can have a better effect is also affected by factors such as the concentration of primers and probes. Therefore, in order to obtain efficient and accurate quantitative results, the PCR reaction system needs to be further optimized.

[0040] 1. Establish a preliminary Real-time PCR reaction system The reaction system was established by diluting the primer and probe combination A1 screened in Example 1, adding deionized water to dilute it to a working solution with a concentration of 10 μM, and performing probe method Real-time PCR amplification.

[0041] The PCR reaction system was as follows: 2×qPCR Mix 10 μL, 10 μM upstream primer 0.5 μL, 10 μM downstream primer 0.5 μL, 10 μM probe 0.25 μL, template DNA 1 μL, ddH2O was added to a total volume of 20 μL. MN85zN-Ey genomic DNA was used as a template, and ddH2O was used as a blank control.

[0042] The real-time PCR reaction program was: 95°C for 10 min; 95°C for 10 s, 60°C for 20 s, and 72°C for 40 s (collecting fluorescence signals), for a total of 40-45 cycles.

[0043] 2. Optimizing the Real-time PCR Reaction System The final concentration of the primers was set to 5 concentration gradients, namely 0.2, 0.3, 0.4, 0.5 and 0.6 μM, and the corresponding probe concentration was 1 / 2 times the primer concentration. The real-time PCR test results of each treatment are shown in Table 5.

[0044] Table 5 Tests of different primer and probe concentrations Final primer concentration (μM) Final probe concentration (μM) Ct 0.2 0.1 31.44 0.3 0.15 30.60 0.4 0.2 28.15 0.5 0.25 29.82 0.6 0.3 31.08 The results showed that the PCR reaction system with a primer concentration of 0.4 μM and a probe concentration of 0.2 μM had the smallest Ct value and the highest fluorescence signal value. Therefore, the final concentration of the primers in the subsequent experiments was determined to be 0.4 μM and the probe concentration was 0.2 μM.

[0045] The optimized reaction system is: 2×qPCR Mix 10 μL, 10 μM upstream primer 0.8 μL, 10 μM downstream primer 0.8 μL, 10 μM probe 0.4 μL, template DNA 1 μL, ddH2O to a total volume of 20 μL. MN85zN-Ey genomic DNA was used as a template, and ddH2O was used as a blank control. Example 4 Sensitivity Test Sensitivity refers to the minimum copy number of a sample that can be detected by the PCR amplification reaction, that is, the minimum detection limit. When Real-time PCR is used to detect standards of different concentrations, when a certain concentration of standard can form an amplification curve but the Ct value is >35, it is considered that the concentration of the standard exceeds the minimum detection limit of the PCR system.

[0046] The probe and primer combination A1 described in Example 1, the reaction system optimized in Example 3, and the standard sample (concentration 8.7×10 5 ~8.7 copies / μL) as template (three parallel tests for each concentration) and ddH2O as blank control, real-time PCR amplification was performed to determine the minimum detection limit of the detection method of the present invention. The amplification curve was obtained based on the fluorescence signal detected by the instrument. The results are shown in Figure 1 and Table 6. The results show that when the concentration of the standard is less than 87 copies / μL, the amplification curve Ct is greater than 35. Therefore, the detection limit of Real-time PCR is 87 copies / μL.

[0047] The above sensitivity test results show that when the sample does not show a typical amplification curve or the Ct value is greater than 35, that is, the transformant concentration in the sample is lower than 87 copies / μL, it is considered that the MN85zN-Ey transformant is not detected in the sample and the test result is negative.

[0048] Table 6 Sensitivity test results sample 1 2 3 4 5 6 Template concentration (copies / μL) <![CDATA[8.7×10 5 ]]> <![CDATA[8.7×10 4 ]]> <![CDATA[8.7×10 3 ]]> <![CDATA[8.7×10 2 ]]> 8.7×10 8.7 Ct 21.15 24.02 26.80 29.42 32.68 36.05 Example 5 Drawing a standard curve Real-time PCR is performed using multiple standards with gradient concentrations as templates and the Ct values ​​are recorded. A standard curve is drawn based on the initial template amount (logarithm of the copy number) and the Ct value to obtain the standard equation. When the initial template of the sample to be tested needs to be quantified, only the amplification curve needs to be obtained, the Ct value needs to be read, and the initial template amount of the sample to be tested can be calculated by inserting it into the standard equation.

[0049] The standard sample of Example 2 (concentration 8.7×10 5 ~8.7×10 copies / μL) as a template (three parallel tests for each concentration), ddH2O as a blank control, using the primer / probe combination A1 of Example 1 and the reaction system of Example 2, real-time PCR amplification was performed.

[0050] Draw a standard curve with the logarithm of the standard concentration as the horizontal axis and the Ct value as the vertical axis. Figure 2 The standard curve equation of the present invention is y = -2.7817x + 37.958 (y represents the Ct value, and x represents the logarithm of the copy number). The standard curve has a good linear relationship, R² = 0.9811, and a high correlation coefficient, which meets the requirements of Real-time PCR quantitative detection.

[0051] Example 6 Detection Kit A kit for detecting maize MN85zN-Ey was prepared according to the following composition: 2×qPCR Mix, 10 μM upstream primer, 10 μM downstream primer, 10 μM probe, standard sample of Example 2 (concentration 8.7×10 5 Copies / μL ~8.7×10 2 copies / μL) and ddH2O.

[0052] The primers and probes were combination A1 described in Example 1.

[0053] The reaction system of the kit can be: 2×qPCR Mix 10 μL, 10 μM upstream primer 0.8 μL, 10 μM downstream primer 0.8 μL, 10 μM probe 0.4 μL, template DNA 1 μL, ddH2O 7 μL, and the total reaction volume is 20 μL.

[0054] The reaction program of the kit for Real-time PCR is: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 20 s, 72℃ for 40 s (collecting fluorescence signals), for a total of 40-45 cycles.

[0055] When the kit is used to detect samples, an amplification curve is obtained through the fluorescent signal detected by the instrument, and the sample copy number is calculated based on the standard equation established by the standard and the Ct value of the sample to be tested. Example 7 Specificity test and sample detection The genomic DNA of the maize transformant MN85zN-Ey, the receptor control B104, and the other transformant material MN85N-E1 were extracted using the DNA extraction method (CTAB method) of Example 2.

[0056] The genomic DNA of B104 and MN85zN-Ey was mixed as sample 1, and the genomic DNA of B104 and MN85N-E1 was mixed as sample 2. Real-time PCR amplification was performed using the kit described in Example 6 and the reaction system of Example 3 to perform specific test detection. The amplification curve was obtained according to the fluorescent signal detected by the instrument, as shown in FIG. Figure 3 shown.

[0057] The copy number of each sample was calculated based on the Ct value of the amplification curve. The results are shown in Table 7: The Ct value of the amplification curve of sample 1 was 26.18, and the copy number was 1.7×10 5 The test result is positive; the amplification curve Ct value of sample 2 is greater than 35, and the copy number is lower than the minimum detection limit of 87 copies / μL, so the test result is negative. It can be seen that the detection system established by the present invention has good specificity.

[0058] Table 7 Specificity test results of the tested samples sample Ct Copy number 1 26.18 <![CDATA[1.7×10 5 ]]> 2 37.16 1.9 <![CDATA[ddH2O]]> - - The above is only a preferred embodiment of the present invention, and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with this profession can use the technical content disclosed above to make changes or modifications to equivalent embodiments of equivalent changes without departing from the scope of the technical solution of the present invention. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A probe and primer combination, characterized in that The nucleotide sequence of the probe is 5'-TTGGATCAGATTGTCGTTTCCCGCC-3', and the nucleotide sequences of the primers are 5'-CCTGAATGGCGAATGCTAGAG-3' and 5'-TGTACTGGCAATGTTATGTGTTTCC-3'.

2. The probe and primer combination according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group; The fluorescent group is any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA or Texas; the quenching group is any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL or MGB.

3. The probe and primer combination according to claim 2, characterized in that: The combination of the fluorescent group and the quenching group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA or VIC / BHQ2.

4. The probe and primer combination according to claim 3, characterized in that: The fluorescent group is FAM; the quenching group is BHQ1.

5. A detection kit, characterized in that: The detection kit comprises the probe and primer combination according to any one of claims 1 to 4 and a standard; Wherein, the standard is a MN85zN-Ey sample with a concentration of not less than 87 copies / μL; Among them, the MN85zN-Ey sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO.

1.

6. The detection kit according to claim 5, characterized in that: The standard substances are 5 concentrations of 8.7×10 5 copies / μL, 8.7×10 4 copies / μL, 8.7×10 3 copies / μL, 8.7×10 2 copies / μL and 8.7×10 copies / μL of MN85zN-Ey genomic DNA.

7. Real-time PCR detection method, characterized in that: Real-time PCR detection is performed using the detection kit according to any one of claims 5 to 6, wherein the final concentration of primers in the PCR reaction system is 0.4 μM, and the final concentration of the probe is 0.2 μM.

8. Use of the probe and primer combination according to any one of claims 1 to 4, the detection kit according to any one of claims 5 to 6, and the detection method according to claim 7 in quantitative detection of MN85zN-Ey samples; in, The MN85zN-Ey sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1.

Images