Application of IL-12p70 protein in cognitive impairment diseases

Abstract

The invention relates to the technical field of biological protein, in particular to application of IL-12p70 protein in cognitive impairment diseases. The IL-12p70 protein with the expression level lower than the normal expression level is used as the biomarker of the cognitive disorder disease. In a body with cognitive impairment, the expression level of the IL-12p70 protein is obviously reduced compared with the level of a healthy body, which indicates that the IL-12p70 protein has the potential of a marker for potentially indicating whether the body suffers from cognitive impairment, and in addition, the IL-12p70 protein has the potential of a marker for potentially indicating whether the body suffers from cognitive impairment in an experiment of a nerve cell injury model induced by multiple injury factors. The IL-12p70 protein can activate a PI3K-AKT-BCL2 signal channel to enhance the survival of nerve cells, and after the expression of the IL-12p70 protein is inhibited by the recombinant knock-down adenovirus, the recovery degree of the cognitive impairment disease is poor, which shows that the IL-12p70 protein has significant correlation with the cognitive impairment disease.

Description

Technical Field

[0001] The present application relates to the field of biological protein technology, and in particular to an application of IL-12p70 protein in cognitive impairment diseases. Background Art

[0002] Cognitive impairment is manifested by a variety of neurological symptoms, including memory loss, inattention and difficulty in decision-making, which can seriously affect the quality of life of patients. Cognitive impairment mainly includes Alzheimer's disease, mild cognitive impairment, attention deficit disorder, dementia, primary progressive aphasia, chemotherapy-related cognitive impairment (chemo-brain), cognitive impairment caused by neurological diseases (neurologic disorder-related cognitive impairments), etc. Among them, cognitive impairment caused by neurological diseases includes Parkinson's disease, epilepsy, stroke, multiple sclerosis, normal pressure hydrocephalus, posterior cortical atrophy and traumatic brain injury. Although Alzheimer's disease accounts for a large proportion of cases of cognitive impairment, in addition to Alzheimer's disease, there are many other neurological diseases that can affect mental functions such as memory, thinking and reasoning ability, leading to cognitive impairment. These neurological diseases include frontotemporal lobar degeneration, Huntington's disease, Lewy body dementia and traumatic brain injury. In addition, the hippocampus is located deep in the medial temporal lobe of the brain and is part of the limbic system. Its main functions include forming learning memory and regulating emotional behavior. Studies have shown that the structural and functional integrity of the hippocampus is essential for normal learning and memory consolidation, which indicates that changes in the structure and function of the hippocampus are related to the severity and development of neurodegenerative diseases associated with cognitive decline. In addition, many cognitive deficit symptoms can be induced by bilateral hippocampal damage in animal models, which further illustrates the key role of the hippocampus in cognition.

[0003] Current studies have shown that increased levels of pro-inflammatory cytokines IL-6 and IL-8 in peripheral blood are associated with decreased cognitive function. For example, knocking down systemic IL-6 expression can enhance cognitive function in elderly mice. In addition, animal studies have shown that after anesthesia and surgery in the hippocampus, IL-1β, IL-6, IL-10, and TNF-α in the body increase, indicating that these inflammatory cytokines are associated with the occurrence of postoperative cognitive impairment. However, at this stage, there have been no reports on the use of IL-12p70 in cognitive impairment. Summary of the invention

[0004] The present application provides an application of IL-12p70 protein in cognitive impairment diseases to solve the following technical problem: how to fill the gap in the application of IL-12p70 in cognitive impairment diseases.

[0005] In a first aspect, the present application provides a biomarker for cognitive impairment, wherein an IL-12p70 protein with expression levels below the normal level is used as a biomarker for cognitive impairment.

[0006] Optionally, the expression level of the IL-12p70 protein is less than 0.7 times the expression level of the normal IL-12p70 protein.

[0007] Optionally, the expression level of the IL-12p70 protein is positively correlated with the degree of the cognitive impairment disease.

[0008] In a second aspect, the present application provides a detection reagent for cognitive impairment diseases for non-diagnosis and treatment purposes, wherein the detection reagent includes a reagent for detecting IL-12p70 gene transcription level, translation level and / or IL-12p70 protein expression level.

[0009] Optionally, the detection reagent includes at least one of the following:

[0010] An oligonucleotide fragment complementary to the mRNA of the IL-12p70 gene, a primer specifically binding to the mRNA of the IL-12p70 gene, a probe specifically binding to the mRNA of the IL-12p70 gene, and an antibody specifically binding to the IL-12p70 protein.

[0011] In a third aspect, the present application provides a biological fragment for treating cognitive impairment, wherein the biological fragment includes a gene fragment that regulates the expression level of IL-12p70 protein.

[0012] Optionally, the gene fragment includes a gene fragment encoding an IL-12p35 subunit.

[0013] In a fourth aspect, the present application provides a genetically engineered vector for treating cognitive impairment, wherein the genetically engineered vector comprises a vector and a gene fragment encoding an IL-12p35 subunit carried on the vector.

[0014] In a fifth aspect, the present application provides a combination drug for treating cognitive impairment, wherein the combination drug comprises at least one of the following:

[0015] IL-12p70 protein, agents that regulate the expression level of IL-12p70 protein, and agents that regulate the expression level of IL-12p35 subunit.

[0016] Optionally, the combination drug further comprises the biological fragment described in the third aspect and / or the genetic engineering vector described in the fourth aspect.

[0017] The above technical solution provided by the embodiment of the present application has the following advantages compared with the prior art:

[0018] The present application provides a biomarker for cognitive impairment. Through a large number of experiments, it was found that in organisms with cognitive impairment, the expression level of IL-12p70 protein was significantly lower than that of healthy organisms, which indicates that IL-12p70 protein has the potential to be a marker for indicating whether the organism suffers from cognitive impairment. In addition, in experiments on a neural cell damage model induced by multiple damaging factors, it was found that the IL-12p70 protein can activate the PI3K-AKT-BCL2 signaling pathway to enhance the survival of neural cells. After inhibiting the expression of IL-12p70 protein by recombinant knockdown adenovirus, the recovery of cognitive impairment was poor, which indicates that IL-12p70 protein has a significant correlation with cognitive impairment. Therefore, IL-12p70 protein with expression levels lower than normal can be used as a biomarker for cognitive impairment to evaluate the onset and progression of cognitive impairment, thereby filling the gap in the application of IL-12p70 in cognitive impairment in the prior art. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and, together with the description, serve to explain the principles of the present application.

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0021] Figure 1This is an experimental diagram of the electroacupuncture treatment of the postoperative cognitive impairment mouse model provided in the embodiment of the present application, wherein: Figure 1 A is the experimental flow chart of the design. Figure 1 B is the behavioral test results of the cognitive impairment mouse model. Figure 1 C is the result graph of the time spent searching for the hidden platform during the water maze training of the cognitive impairment mouse model. Figure 1 D is the route map of the mouse model of cognitive impairment in finding the hidden platform on the day of water maze training. Figure 1 E is the time it takes for the cognitive impairment mouse model to find the hidden platform on the day of water maze training. Figure 1 F is the result of the new object recognition test of the cognitive impairment mouse model after water maze training. Figure 1 G is the expression level of IL-12p70 protein, an inflammatory factor, in the serum of a mouse model of cognitive impairment. Figure 1 H is the expression level of IL-12p40 subunit in the serum of cognitive impairment mouse model;

[0022] Figure 2 The results of the postoperative serum concentration test of IL-12p70 protein in different populations provided in the embodiments of the present application are shown in FIG. Figure 2 A is the expression level of IL-12p70 protein in the serum of elderly patients (age>60 years old) before and after surgery. Figure 2 B is the expression level of IL-12p70 protein in the serum of young patients (age < 60 years old) before and after surgery. Figure 2 C is the correlation result of the concentration of IL-12p70 protein in the patient's serum before surgery and age. Figure 2 D is the correlation result of the serum IL-12p70 protein concentration and age in postoperative patients. Figure 2 E is a graph showing the correlation between the decrease in serum IL-12p70 protein concentration and age in patients after surgery;

[0023] Figure 3 This is a diagram showing the expression of the receptor of the IL-12p70 protein on nerve cells provided in the examples of the present application, wherein: Figure 3 A is the result of mRNA expression level of IL12RB2, the receptor of IL-12p70 protein in nerve cells. Figure 3 B is the result of the effect of different mass concentrations of IL-12p70 protein on the proliferation of the neural cell line PC12;

[0024] Figure 4 The results of detecting the neuroprotective effect of IL-12p70 protein in multiple nerve cell injury models provided in the examples of the present application are shown in FIG. Figure 4A is a graph showing the change in cell survival rate after adding microglial supernatant rich in inflammatory factors and IL-12p70 protein to the neural cell line PC12. Figure 4 B is the flow cytometry test result of adding microglial supernatant rich in inflammatory factors and IL-12p70 protein to the neural cell line PC12. Figure 4 C is the result of adding glutamate and IL-12p70 protein to the neural cell line PC12 and the change of cell survival rate. Figure 4 D is the flow cytometry test result of adding glutamate and IL-12p70 protein to the neural cell line PC12. Figure 4 E is the result of the change in cell survival rate after adding hydrogen peroxide and IL-12p70 protein to the neural cell line PC12. Figure 4 F is the flow cytometry test result of adding hydrogen peroxide and IL-12p70 protein into the neural cell line PC12;

[0025] Figure 5 This is a graph showing the effect of the IL-12p70 protein provided in the examples of the present application on the cell injury model constructed from primary hippocampal cells, wherein: Figure 5 A is a graph showing the death of neurons after adding microglial supernatant rich in inflammatory factors and IL-12p70 protein to primary hippocampal neurons. Figure 5 B is the result of neuronal cell death after adding glutamate and IL-12p70 protein to primary hippocampal neuronal cells. Figure 5 C is a graph showing the results of neuronal cell death after adding hydrogen peroxide and IL-12p70 protein to primary hippocampal neuronal cells;

[0026] Figure 6 This is a diagram of the changes in substances related to the PI3K / AKT / BCL2 signaling pathway after adding IL-12p70 protein to the nerve cell injury model provided in the embodiment of the present application, wherein: Figure 6 A is a graph showing the changes in substances related to the PI3K / AKT / BCL2 signaling pathway after adding IL-12p70 protein to various neural cell injury models constructed from the neural cell line PC12. Figure 6 B is a graph showing the changes in substances related to the PI3K / AKT / BCL2 signaling pathway after adding IL-12p70 protein to various neuronal cell injury models constructed with primary hippocampal cells. Figure 6 C is a comparison of the changes in substances related to the PI3K / AKT / BCL2 signaling pathway in the hippocampus tissues of mice with cognitive impairment and mice treated with electroacupuncture. Figure 6 D is a statistical graph showing the changes in substances related to the PI3K / AKT / BCL2 signaling pathway in the hippocampus tissues of mice with cognitive impairment and mice treated with electroacupuncture;

[0027] Figure 7 A diagram showing changes in substances related to the PI3K / AKT / BCL2 signaling pathway after adding inhibitors of different gradient concentrations and types and IL-12p70 protein to a nerve cell injury model provided in an embodiment of the present application, wherein: Figure 7 A is a graph showing the changes in substances related to the PI3K / AKT / BCL2 signaling pathway after adding IL-12p70 protein and different concentrations of the inhibitor LY294002 to various neural cell injury models constructed from the neural cell line PC12. Figure 7 B is a statistical result of the changes in substances related to the PI3K / AKT / BCL2 signaling pathway after adding IL-12p70 protein and different concentrations of the inhibitor LY294002 to various neural cell injury models constructed by the neural cell line PC12. Figure 7 C is a graph showing the changes in substances related to the PI3K / AKT / BCL2 signaling pathway after adding IL-12p70 protein and different concentrations of the inhibitor MK2206 to various neural cell injury models constructed with the neural cell line PC12. Figure 7 D is a statistical result of the changes in substances related to the PI3K / AKT / BCL2 signaling pathway after adding IL-12p70 protein and different concentrations of the inhibitor MK2206 to various neural cell injury models constructed by the neural cell line PC12;

[0028] Figure 8 This is an experimental diagram of the IL-12p70 protein and electroacupuncture combined to treat a postoperative cognitive impairment mouse model provided in the examples of the present application, wherein: Figure 8 A is the experimental flow chart of the design. Figure 8 B is the result of the time spent searching for the hidden platform during the water maze training of the mouse model of cognitive impairment after different treatments. Figure 8 C is the route map of the mouse model of cognitive impairment after different treatments in finding the hidden platform on the day of water maze training. Figure 8 D is the statistical result of the cognitive impairment mouse model during the water maze training period after different treatments. Figure 8 E is the motor ability results of the cognitive impairment mouse model during the water maze training period after different treatments;

[0029] Fig. 9 A comparison of the PI3K / AKT / BCL2 signaling pathway in the neurons of the hippocampus of the mouse model treated differently according to the embodiments of the present application, wherein: Fig. 9 A is the result of NeuN staining and Ac-caspase-3 staining of hippocampal neurons in different treatment methods of mouse models. Fig. 9B is the result of p-AKT staining and NeuN staining of neurons in the hippocampus of the mouse model with different treatments. Fig. 9 C is the result of BCL2 staining of neurons in the hippocampus of the mouse model with different treatments. Fig. 9 D is a statistical graph of Ac-caspase-3 staining, p-AKT staining and BCL2 staining of neurons in the hippocampus of mouse models with different treatments. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solution and advantages of the embodiments of the present application clearer, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.

[0031] Various embodiments of the present application may be presented in the form of a range; it should be understood that the description in the form of a range is only for convenience and brevity and should not be understood as a rigid limitation on the scope of the present application; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within the range; for example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5 and 6, which applies regardless of the range; in addition, whenever a numerical range is indicated in this document, it is meant to include any cited numbers (fractions or integers) within the indicated range.

[0032] In this document, the terms including "including" and "including" mean "including but not limited to". Relational terms such as "first" and "second" are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. "And / or" describes the association relationship of associated objects, indicating that there can be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone; where A and B can be singular or plural. "At least one" means one or more, and "plurality" means two or more; "at least one", "at least one of the following" or similar expressions refer to any combination of these items, including any combination of single or plural items; for example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple. "Parts" such as parts by weight and parts by mass indicate the proportional relationship between the components. In the proportional relationship involved in this article, the parameters that need to be described by proportion should be understood as the first term of the proportional formula in the order of description, and the proportional numbers should be understood as the second term of the proportional formula. For example, if the mass ratio of substance A, substance B and substance C is 1:2:3, then substance A, substance B and substance C should correspond to the proportional numbers in the proportional formula in the order of description, that is, the mass of substance A: the mass of substance B: the mass of substance C = 1:2:3.

[0033] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in this article can be purchased from the market or prepared by existing methods.

[0034] It should be noted that among many cognitive impairment diseases, postoperative cognitive impairment is a common and serious complication after anesthesia surgery. Its main manifestations are symptoms such as memory loss, decreased attention, and impaired information processing function. Postoperative cognitive impairment will increase the patient's risk of suffering from long-term cognitive impairment diseases, and will also reduce the quality of life, prolong hospitalization, increase medical expenses, and even increase the probability of death and other serious consequences.

[0035] The present application provides an embodiment of a biomarker for cognitive impairment, wherein an IL-12p70 protein with expression level lower than the normal level is used as a biomarker for cognitive impairment.

[0036] It should be noted that the cognitive impairment disease may be a neurological cognitive impairment caused by factors such as anesthesia surgery, Alzheimer's disease, Huntington's disease, traumatic brain injury (TBI), Parkinson's disease, prion disease or HIV infection.

[0037] In some optional embodiments, the expression level of the IL-12p70 protein is less than 0.7 times the expression level of the normal IL-12p70 protein;

[0038] In these embodiments, the expression level of IL-12p70 protein can be less than 0.7 times the expression level of normal IL-12p70 protein. By clarifying the specific expression level of IL-12p70 protein that is lower than the normal expression level, the expression level requirement of IL-12p70 protein as a biomarker can be further clarified.

[0039] In some optional embodiments, the expression level of the IL-12p70 protein is positively correlated with the degree of the cognitive impairment disease.

[0040] In these embodiments, the expression level of IL-12p70 protein may be positively correlated with the degree of cognitive impairment, and the degree of cognitive impairment in the body may be determined by the expression level of IL-12p70 protein.

[0041] Based on a general inventive concept, the embodiment of the present application provides a detection reagent for cognitive impairment diseases for non-diagnosis and treatment purposes, the detection reagent comprising a reagent for detecting IL-12p70 gene transcription level, translation level and / or IL-12p70 protein expression level;

[0042] The detection reagent is implemented based on the above-mentioned biomarker. The specific principle of the biomarker can be referred to the above-mentioned embodiment. Since the detection reagent adopts part or all of the technical solutions of the above-mentioned embodiment, it at least has all the beneficial effects brought by the technical solutions of the above-mentioned embodiment, which will not be described one by one here.

[0043] It should be noted that the detection reagent can be a detection reagent for detecting mRNA, tRNA, etc. transcribed from the IL-12p70 gene, and can also be a detection reagent for detecting the expression level of IL-12p70 protein or other derivative proteins translated from the IL-12p70 gene. By clarifying the expression levels of these transcription factors and translation factors, the expression level of IL-12p70 protein can be indirectly clarified, thereby assisting in determining whether the body is in a state of cognitive impairment based on the intermediate information of the IL-12p70 protein expression level; in addition, the detection reagent can also directly detect the expression level of IL-12p70 protein to directly obtain the intermediate information of the IL-12p70 protein expression level, thereby assisting in determining whether the body is in a state of cognitive impairment.

[0044] In some optional embodiments, the detection reagent includes at least one of the following:

[0045] An oligonucleotide fragment complementary to the mRNA of the IL-12p70 gene, a primer specifically binding to the mRNA of the IL-12p70 gene, a probe specifically binding to the mRNA of the IL-12p70 gene, and an antibody specifically binding to the IL-12p70 protein;

[0046] In these embodiments, the detection reagent may include at least one of an oligonucleotide fragment complementary to the mRNA of the IL-12p70 gene, a primer specifically binding to the mRNA of the IL-12p70 gene, a probe specifically binding to the mRNA of the IL-12p70 gene, and an antibody specifically binding to the IL-12p70 protein, which can further clarify the detection object related to the transcription level, translation level and expression level of the IL-12p70 gene, so as to accurately obtain the intermediate information of the expression level of the IL-12p70 protein, thereby assisting in determining whether the body is in a state of cognitive impairment.

[0047] Based on a general inventive concept, an embodiment of the present application provides a biological fragment for treating cognitive impairment, wherein the biological fragment includes a gene fragment that regulates the expression level of IL-12p70 protein.

[0048] The biological fragment is realized based on the above-mentioned biomarker. The specific principle of the biomarker can be referred to the above-mentioned embodiment. Since the biological fragment adopts part or all of the technical solutions of the above-mentioned embodiment, it at least has all the beneficial effects brought by the technical solutions of the above-mentioned embodiment, which will not be described one by one here.

[0049] It should be noted that the gene fragment that regulates the expression level of IL-12p70 protein may be a nucleotide fragment that promotes the expression of IL-12p70 protein.

[0050] In some optional embodiments, the gene fragment includes a gene fragment encoding an IL-12p35 subunit;

[0051] In these embodiments, based on the fact that the IL-12p70 protein is a heterodimeric molecule composed of the IL-12p35 subunit and the IL-12p40 subunit, the expression of the IL-12p70 protein can be indirectly promoted by regulating the expression level of the IL-12p35 subunit, so as to ultimately increase the expression level of the IL-12p70 protein in the body, thereby alleviating the effects of cognitive impairment on the body based on overexpression of the IL-12p70 protein.

[0052] It should be noted that the L-12p35 subunit will not be secreted alone, and must be combined with the IL-12p40 subunit in the cell to correctly fold and secrete the IL-12p70 protein; in addition, the IL-12p40 subunit can be secreted in the form of a monomer or a homodimer (IL-12p80), and can also form the IL-23 protein with the IL-12p19 subunit. At the same time, no significant changes in the IL-12p40 subunit were found in serum tests, which shows that the expression level of the IL-12p70 protein cannot be accurately obtained by regulating or detecting the IL-12p40 subunit alone; therefore, the expression process of the IL-12p70 protein can be regulated by regulating the content of the IL-12A gene encoding the IL-12p35 subunit, and ultimately the expression level of the IL-12p70 protein can be regulated.

[0053] It should be noted that the IL-12A gene may have a nucleotide sequence as follows: atgtgtccagcgcgca gcctcctcct tgtggctacc ctggtcctcc tggaccacct cagtttggcc agaaacctccccgtggccac tccagaccca ggaatgttcc catgccttca ccactcccaa aacctgctga gggccgtcagcaacatgctc cagaaggcca gacaaactct agaattttac ccttgcacttctgaagagat tgatcatgaagatatcacaa aagataaaac cagcacagtg gaggcctgtt taccattgga attaaccaag aatgagagttgcctaaattc cagagagacc tctttcataa ctaatgggag ttgcctggcc tccagaaaga cctcttttatgatggccctg tgccttagta gtatttatga agacttgaag atgtaccagg tggagttcaa gaccatgaatgcaaagcttc tgatggatcc taagaggcag atctttctag atcaaaacat gctggcagtt attgatgagctgatgcaggc cctgaatttc aacagtgaga ctgtgccaca aaaatcctcc cttgaagaac cggatttttataaaactaaa atcaagctct gcatacttct tcatgctttc agaattcggg cagtgactat tgatagagtgatgagctatc tgaatgcttc ctaa.

[0054] Based on a general inventive concept, an embodiment of the present application provides a genetic engineering vector for treating cognitive impairment diseases, wherein the genetic engineering vector comprises a vector and a gene fragment encoding an IL-12p35 subunit carried on the vector.

[0055] The genetic engineering vector is realized based on the above-mentioned biological fragments. The specific composition of the biological fragments can refer to the above-mentioned embodiments. Since the genetic engineering vector adopts part or all of the technical solutions of the above-mentioned embodiments, it has at least all the beneficial effects brought by the technical solutions of the above-mentioned embodiments, which will not be described one by one here.

[0056] It should be noted that the vector may be an expression vector, a plasmid vector, or a viral vector.

[0057] Based on a general inventive concept, the present invention provides a combination drug for treating cognitive impairment, wherein the combination drug comprises at least one of the following:

[0058] IL-12p70 protein, agents that regulate the expression level of IL-12p70 protein, and agents that regulate the expression level of IL-12p35 subunit.

[0059] The genetic engineering vector is implemented based on the above-mentioned biomarkers. The specific principles of the biomarkers can be referred to the above-mentioned embodiments. Since the genetic engineering vector adopts part or all of the technical solutions of the above-mentioned embodiments, it at least has all the beneficial effects brought by the technical solutions of the above-mentioned embodiments, which will not be described one by one here.

[0060] It should be noted that these combination drugs can be various compounds, antibodies, peptide drugs and commercial reagents developed with IL-12p70 protein and the gene encoding IL-12p35 subunit as the target; for example, these combination drugs can be oligonucleotide sequences with complementary sequences to IL-12p70 mRNA, or primers and probes that specifically bind to IL-12p70 mRNA, or antibodies that specifically bind to IL-12p70 protein; in addition, these combination drugs can be the IL-12p70 protein itself.

[0061] In some optional embodiments, the combination drug further comprises the biological fragment and / or the genetic engineering vector;

[0062] In these embodiments, the combination drug may also include biological fragments and / or genetic engineering vectors. The combined use of the above biological fragments and genetic engineering vectors can effectively increase the expression level of IL-12p70 protein to improve the effects of cognitive impairment on the body.

[0063] The present application is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually measured in accordance with national standards / industry standards; if there are no corresponding national standards / industry standards, they are measured in accordance with common international standards, conventional conditions or conditions recommended by the manufacturer.

[0064] Example 1

[0065] 1. The concentration of IL-12p70 protein in serum is positively correlated with the cognitive state of mice. The specific experimental steps are as follows:

[0066] Postoperative cognitive impairment mainly occurs in elderly patients, and elderly experimental animals also suffer from cognitive impairment after surgery. First, a mouse model of postoperative cognitive impairment was constructed, and electroacupuncture, which has been reported to have therapeutic effects, was used for treatment. The specific steps are as follows: Figure 1 A, and were divided into control group, surgical group and treatment group. Subsequently, the cognitive function of mice was analyzed by behavioral tests, such as Figure 1 As shown in B, in the open field test, there were no significant differences in the central movement distance, movement speed and residence time among the control group, the surgery group and the treatment group, which indicated that surgery and electroacupuncture treatment did not affect the spontaneous activity and anxiety behavior of mice. Figure 1 As shown in C, during the 5-day water maze training, the mice in the surgery group spent more time searching for the hidden platform than the control group, while the mice in the electroacupuncture group that received electroacupuncture in addition to surgery spent less time than the surgery group; Figure 1 D and Figure 1 As shown in E, on the day of the water maze test, the underwater platform was removed. The surgery group took more time to reach the original position of the platform than the control group, and the surgery group crossed the platform less frequently, while the electroacupuncture group spent less time than the surgery group. Figure 1 As shown in Figure 5, in the novel object recognition test, the surgery group showed a significant decline in cognitive index, while electroacupuncture treatment restored the cognitive index.

[0067] Therefore, Figure 1 It can be seen that anesthesia surgery caused postoperative cognitive impairment in mice, and electroacupuncture treatment can enhance the cognitive function of mice. Then, the inflammatory factors in the serum of each group of mice were detected, such as Figure 1 As shown in G, the results showed that only the expression level of IL-12p70 protein decreased in the mice in the surgery group, but recovered after EA treatment. Figure 1 As shown in H, there is no difference between the IL-12p40 subunit, which is in the same family as the IL-12p70 protein.

[0068] In summary, the concentration of IL-12p70 protein in serum is related to the cognitive status of mice: in addition, the concentration of IL-12p70 protein is downregulated in mice with postoperative cognitive impairment, and the concentration of IL-12p70 protein returns to normal levels in mice that regain normal cognitive function after electroacupuncture treatment.

[0069] Example 2

[0070] 2. The concentration of IL-12p70 protein in serum is related to the clinical characteristics of postoperative cognitive impairment. The specific experimental steps are as follows:

[0071] IL-12p70 protein expression levels were measured in patients undergoing surgery, such as Figure 2As shown in A, the results showed that the expression level of IL-12p70 protein in the serum of elderly patients (age>60 years) after surgery was significantly decreased compared with that before surgery. Figure 2 As shown in B, the IL-12p70 protein expression level in young patients (age < 60 years) did not change between before and after surgery. Figure 2 As shown in Figure C, the concentration of IL-12p70 protein in the patient's serum before surgery was not correlated with age (spearman r = 0.09, P = 0.45). Figure 2 As shown in D, the serum IL-12p70 protein concentration of postoperative patients was weakly correlated with age (spearman r = -0.22, P = 0.08). Figure 2 As shown in Figure E, the decrease in serum IL-12p70 protein concentration after surgery has a significant weak correlation with age (spearman r = 0.26, P = 0.03), which indicates that the body's ability to maintain a stable IL-12p70 protein concentration gradually decreases with age. In addition, existing clinical phenomena show that postoperative cognitive impairment is more common in the elderly after surgery, and Figure 2 The results shown are consistent with this clinical phenomenon, further indicating that the expression level of IL-12p70 protein is closely related to cognitive status, and therefore IL-12p70 protein has the potential to be a marker for cognitive impairment.

[0072] Example 3

[0073] 3. The receptor of IL-12p70 protein is highly expressed on nerve cells. The specific experimental steps are as follows:

[0074] Real-time PCR was used to detect the mRNA expression of IL-12RB2, the receptor for IL-12p70 protein, in the mouse neural cell line PC12, isolated primary hippocampal neuronal cells, and common mouse tumor cell lines. Figure 3 As shown in A, nerve cells all express high levels of IL12RB2, among which primary hippocampal neurons have significantly high levels of IL12RB2 expression (about 50 times that of PC12 cell lines), which indicates that nerve cells can receive stimulation from IL-12p70 protein through receptors and activate intracellular signaling pathways to produce cellular effects. At the same time, after gradient treatment of PC12 cell lines with IL-12p70 protein in the concentration range of 37.5pg / mL to 4000pg / mL, the results are as follows Figure 3As shown in Figure B, 300pg / mL, 600pg / mL, 3000pg / mL and 4000pg / mL of IL-12p70 protein had a weak promoting effect on the proliferation of PC12 cell lines, but IL-12p70 protein within the gradient range had no harmful effect on nerve cells. This indicates that IL-12p70 protein can stimulate nerve cells and produce non-harmful effects.

[0075] Example 4

[0076] 4. IL-12p70 protein plays a neuroprotective role in the neuronal cell injury model induced by inflammatory factors. The specific experimental steps are as follows:

[0077] In order to clarify the damaging effects of inflammatory factors on nerves, simulate the cell model related to cognitive impairment:

[0078] First, the mouse-derived microglial cell line BV2 was cultured in vitro. During the in vitro culture, lipopolysaccharide (mass concentration 100ng / mL) was added and cultured for 24 hours to fully activate the cells. After 24 hours, the normal culture medium without lipopolysaccharide was replaced for culture, and the inflammatory factors released by BV2 cells were collected. After continuing to culture for 24 hours, the supernatant was collected and centrifuged at 3000r / min for 5 minutes to remove the cell precipitate, and then centrifuged at 15000r / min for 15 minutes to remove impurities, and finally a microglial supernatant rich in inflammatory factors was prepared.

[0079] Then, the above-mentioned microglial supernatant rich in inflammatory factors was added to the mouse-derived neural cell line PC12 cultured in vitro to construct a neural cell injury model, and then IL-12p70 protein was applied for treatment. After 24 hours of treatment, the CCK-8 kit was used to detect changes in cell viability, and flow cytometry was used to detect cell apoptosis after double staining with Annexin V and 7-AAD. The results are as follows Figure 4 As shown, Figure 4 A shows that the addition of microglial supernatant rich in inflammatory factors to the neural cell line PC12 can significantly reduce the survival rate of PC12 cells (mean±SD, n=3, P<0.05), while the addition of IL-12p70 protein at a final concentration of 600pg / mL significantly maintained the normal viability of the neural cell line PC12; Figure 4 As shown in B, the addition of microglial supernatant rich in inflammatory factors to the neural cell line PC12 can significantly increase the enrichment of the neural cell line PC12 in the upper right (7-AAD positive Annexin V positive) and lower right quadrants (7-AAD negative Annexin V positive) in flow cytometry detection, indicating that neuroinflammatory factors significantly induce neuronal cell death, and the addition of IL-12p70 protein can significantly rescue the death of PC12 cells.

[0080] The above results indicate that IL-12p70 protein has a neuroprotective effect in neuroinflammation-induced neural damage, and therefore this IL-12p70 protein has the potential to play a neuroprotective role in cognitive impairment-related diseases caused by neuroinflammation.

[0081] Example 5

[0082] 5. IL-12p70 protein plays a neuroprotective role in the glutamate-induced neuronal cell injury model. The specific experimental steps are as follows:

[0083] Based on the damaging effect of glutamate on nerves, a cell model of cognitive impairment-related diseases is simulated by glutamate:

[0084] First, the mouse-derived neural cell line PC12 was cultured in vitro, and then 13mM glutamate was added to the mouse-derived neural cell line PC12 to construct a neural cell injury model, and then 600pg / mL IL-12p70 protein was applied for treatment. After 24 hours of treatment, the CCK-8 kit was used to detect changes in cell viability, and the cell apoptosis was detected by flow cytometry.

[0085] like Figure 4 As shown in Figure C, the addition of 13 mM glutamate to the neural cell line PC12 can significantly reduce the survival rate of the neural cell line PC12 (mean ± SD, n = 3, P < 0.05), while the addition of IL-12p70 protein at a final concentration of 600 pg / mL significantly maintained the normal vitality of the neural cell line PC12; Figure 4 As shown in D, the addition of glutamate to the neural cell line PC12 can significantly increase the enrichment of the neural cell line PC12 in the upper right (7-AAD positive Annexin V positive) and lower right quadrants (7-AAD negative Annexin V positive) in flow cytometry detection, indicating that glutamate can significantly induce neuronal cell death, while the addition of IL-12p70 protein significantly rescued the death of the neural cell line PC12.

[0086] The above results indicate that IL-12p70 protein has a neuroprotective effect in glutamate-induced neural damage, which suggests that IL-12p70 protein has the potential to play a neuroprotective role in diseases related to cognitive impairment caused by neurotoxicity.

[0087] Example 6

[0088] 6. IL-12p70 protein plays a neuroprotective role in the hydrogen peroxide-induced neuronal cell injury model. The specific experimental steps are as follows:

[0089] Based on the damaging effect of hydrogen peroxide on nerves, a cell model of cognitive impairment-related diseases was simulated using hydrogen peroxide.

[0090] First, the mouse-derived neural cell line PC12 was cultured in vitro, and then 200 μM hydrogen peroxide was added to the mouse-derived neural cell line PC12 to construct a neural cell injury model, and then IL-12p70 protein was applied for treatment. After 24 hours of treatment, the CCK8 kit was used to detect changes in cell viability, and the cell apoptosis was detected by flow cytometry after double staining with Annexin V and 7-AAD.

[0091] like Figure 4 As shown in Figure E, the addition of hydrogen peroxide to the neural cell line PC12 can significantly reduce the survival rate of the neural cell line PC12 (mean±SD, n=3, P<0.05), while the addition of IL-12p70 protein at a final concentration of 600 pg / mL significantly maintained the normal viability of the neural cell line PC12; Figure 4 As shown in F, the addition of hydrogen peroxide to the neural cell line PC12 can significantly increase the enrichment of the neural cell line PC12 in the upper right (7-AAD positive Annexin V positive) and lower right quadrants (7-AAD negative Annexin V positive) in flow cytometry detection, indicating that hydrogen peroxide significantly induced neuronal cell death, while the addition of IL-12p70 protein significantly rescued the death of PC12 cells.

[0092] The above results indicate that IL-12p70 protein has a neuroprotective effect in hydrogen peroxide-induced neural damage, which suggests the potential of IL-12p70 protein to play a neuroprotective role in diseases related to cognitive impairment caused by oxidative stress.

[0093] Example 7

[0094] 7. IL-12p70 protein plays a neuroprotective role in the primary neuronal cell injury model induced by inflammatory factors. The specific experimental steps are as follows:

[0095] At present, hippocampal neuron damage has been considered an important cause of cognitive dysfunction. The neuroprotective effect of IL-12p70 protein was detected by isolating primary hippocampal neuron cells.

[0096] The neuronal cell injury model was constructed by adding microglial supernatant rich in inflammatory factors to the neuronal cells isolated from the hippocampus of newborn mice, and then IL-12p70 protein was applied for treatment. After 24 hours of treatment, TUNEL staining of neurons was used to detect the death of neuronal cells.

[0097] like Figure 5As shown in A, after adding microglial supernatant rich in inflammatory factors to primary hippocampal neuronal cells for culture, the nuclei of apoptotic cells were more stained, indicating that the inflammatory factors released by activated microglia led to severe neuronal cell damage (mean±SD, n=3, P<0.05), while the addition of IL-12p70 protein at a final concentration of 600 pg / mL significantly maintained the normal vitality of primary neuronal cells.

[0098] The above results indicate that IL-12p70 protein has a neuroprotective effect in primary neural injury induced by neuroinflammation, which suggests the potential of IL-12p70 protein to play a neuroprotective role in diseases related to cognitive impairment caused by neuroinflammation.

[0099] Example 8

[0100] 8. IL-12p70 protein plays a neuroprotective role in the glutamate-induced primary neuronal cell injury model. The specific experimental steps are as follows:

[0101] 13mM glutamate was added to the neurons isolated from the hippocampus of newborn mice to establish a neuronal cell injury model, and then IL-12p70 protein was applied for treatment. After 24 hours of treatment, TUNEL staining of neurons was used to detect neuronal cell death.

[0102] like Figure 5 As shown in B, after glutamate was added to the primary hippocampal neuronal cells for culture, the nuclei of apoptotic cells were more stained, indicating that the inflammatory factors released by activated microglia led to severe neuronal cell damage (mean±SD, n=3, P<0.05). The addition of IL-12p70 protein at a final concentration of 600 pg / mL significantly maintained the normal vitality of primary neuronal cells.

[0103] The above results indicate that IL-12p70 protein has a neuroprotective effect in primary neural injury induced by neuroinflammation, which suggests the potential of IL-12p70 to play a neuroprotective role in diseases related to glutamate-induced cognitive impairment.

[0104] Example 9

[0105] IX. IL-12p70 protein plays a neuroprotective role in the hydrogen peroxide-induced primary neuronal cell injury model. The specific experimental steps are as follows:

[0106] After adding 200 μM hydrogen peroxide to the neurons isolated from the hippocampus of newborn mice to establish a neuronal cell injury model, IL-12p70 protein was applied for treatment. After 24 hours of treatment, TUNEL staining neurons was used to detect neuronal cell death.

[0107] like Figure 5 As shown in C, after hydrogen peroxide was added to the primary hippocampal neurons for culture, the nuclei of apoptotic cells were more stained, indicating that the inflammatory factors released by activated microglia led to severe neuronal cell damage (mean±SD, n=3, P<0.05), while the addition of IL-12p70 protein at a final concentration of 600 pg / mL significantly maintained the normal vitality of primary neuronal cells.

[0108] The above results indicate that IL-12p70 protein has a neuroprotective effect in primary neural injury induced by neuroinflammation, which suggests the potential of IL-12p70 protein to play a neuroprotective role in diseases related to cognitive impairment caused by hydrogen peroxide.

[0109] Example 10

[0110] 10. IL-12p70 protein activates the PI3K / AKT / BCL2 signaling pathway in various nerve injury cell models to exert neuroprotective effects. The specific experimental steps are as follows:

[0111] Since the PI3K / AKT / BCL2 signaling pathway is an important pro-survival signal and has been found to enhance cell survival and inhibit apoptosis in a variety of diseases, the role of IL-12p70 protein in the PI3K / AKT / BCL2 signaling pathway was examined.

[0112] In vitro cultured mouse-derived neural cell line PC12 or primary hippocampal neurons were treated with microglial supernatant rich in inflammatory factors, glutamate or hydrogen peroxide to construct a neural cell injury model. Then 600 pg / mL of IL-12p70 protein was applied for treatment. After 24 hours of treatment, the total PI3K and phosphorylated PI3K, total AKT and phosphorylated AKT, BCL2, Ac-caspase-3 and GAPDH protein levels in the cells were detected by immunoblotting.

[0113] like Figure 6 As shown in A, when total PI3K, total AKT and internal reference GAPDH are basically the same, microglial supernatant rich in inflammatory factors, 13mM glutamate or 200μM hydrogen peroxide can significantly reduce the expression of phosphorylated PI3K, phosphorylated AKT and BCL2 in the neural cell line PC12, but enhance the expression of apoptosis marker Ac-caspase-3. 600pg / mL IL-12p70 protein can significantly restore the expression of phosphorylated PI3K, phosphorylated AKT and BCL2, and IL-12p70 protein can downregulate the expression of apoptosis marker Ac-caspase-3.

[0114] like Figure 6As shown in B, when total PI3K, total AKT and internal reference GAPDH are basically the same, microglial supernatant rich in inflammatory factors, 13mM glutamate or 200μM hydrogen peroxide can significantly reduce the expression of phosphorylated PI3K, phosphorylated AKT and BCL2 in primary hippocampal cells, but enhance the expression of apoptosis marker Ac-caspase-3. 600pg / mL IL-12p70 protein can significantly restore the expression of phosphorylated PI3K, phosphorylated AKT and BCL2, and downregulate the expression of apoptosis marker Ac-caspase-3.

[0115] Then, the hippocampal tissues of the mice with postoperative cognitive impairment and the mice treated with electroacupuncture in Example 1 were isolated, and the total PI3K and phosphorylated PI3K, total AKT and phosphorylated AKT, BCL2, Ac-caspase-3 and GAPDH protein levels in the cells were detected by immunoblotting. Figure 6 C and Figure 6 As shown in Figure D, when total PI3K, total AKT and internal reference GAPDH were basically the same, the expression of phosphorylated PI3K, phosphorylated AKT and BCL2 in mice with postoperative cognitive impairment was downregulated compared with normal mice, but the expression of apoptosis marker Ac-caspase-3 was upregulated. In addition, after electroacupuncture treatment, the expression of phosphorylated PI3K, phosphorylated AKT and BCL2 was upregulated, but the expression of apoptosis marker Ac-caspase-3 was downregulated.

[0116] The above results indicate that IL-12p70 protein exerts neuroprotective effects in neural cell lines and isolated primary hippocampal cells by activating the PI3K / AKT / BCL2 signaling pathway, against a variety of common neuro-damaging factors. At the same time, surgical anesthesia damages the PI3K / AKT / BCL2 signaling pathway in the hippocampus of mice, and electroacupuncture treatment can restore the activity of this signaling pathway. Therefore, the PI3K / AKT / BCL2 signaling pathway is the common molecular mechanism of IL-12p70 protein-induced neuroprotection and electroacupuncture treatment of postoperative cognitive impairment. This consistency in molecular mechanism further suggests that IL-12p70 protein is involved in electroacupuncture treatment of postoperative cognitive impairment.

[0117] Embodiment 11

[0118] XI. Inhibition of PI3K / AKT / BCL2 signaling pathway can weaken the neuroprotective effect of IL-12p70 protein. The specific experimental steps are as follows:

[0119] First, microglial supernatant rich in inflammatory factors, glutamate or hydrogen peroxide were added to the mouse-derived neural cell line PC12 cultured in vitro to construct a neural cell injury model. Then 600pg / mL of IL-12p70 protein treatment was applied, and finally gradient concentrations of PI3K inhibitor LY294002 or AKT inhibitor MK2206 were added. After 24 hours, the total PI3K and phosphorylated PI3K, total AKT and phosphorylated AKT, BCL2, Ac-caspase-3 and GAPDH protein levels in the cells were detected by immunoblotting, and the changes in cell viability were detected by CCK8 kit.

[0120] like Figure 7 As shown in A, when the total PI3K, total AKT and internal reference GAPDH are basically the same, the microglial supernatant rich in inflammatory factors, 13mM glutamate or 200μM hydrogen peroxide significantly reduce the expression of phosphorylated PI3K, phosphorylated AKT and BCL2 in the neural cell line PC12, but enhance the expression of the apoptosis marker Ac-caspase-3. The addition of 600pg / mL IL-12p70 protein can significantly restore the expression of phosphorylated PI3K, phosphorylated AKT and BCL2, and downregulate the expression of the apoptosis marker Ac-caspase-3. Then, after adding LY294002, an inhibitor of PI3K with a concentration gradient of 10mM, 20mM, and 30mM, the restorative effect of IL-12p70 protein on the expression of the above molecules gradually disappeared with the increase of the inhibitor concentration. Consistently, as Figure 7 As shown in B, microglial supernatant rich in inflammatory factors, 13mM glutamate or 200μM hydrogen peroxide can significantly reduce the survival of the neural cell line PC12, while the intake of 600pg / mL IL-12p70 protein can significantly restore the survival of the neural cell line PC12. However, after adding 20mM PI3K inhibitor LY294002, the protective effect of IL-12p70 protein on the survival of the neural cell line PC12 gradually disappeared.

[0121] like Figure 7As shown in C, when the total PI3K, total AKT and internal reference GAPDH were basically the same, the microglial supernatant rich in inflammatory factors, 13mM glutamate or 200μM hydrogen peroxide significantly reduced the expression of phosphorylated PI3K, phosphorylated AKT and BCL2 in the neural cell line PC12, but enhanced the expression of the apoptosis marker Ac-caspase-3. The addition of 600pg / mL IL-12p70 protein can significantly restore the expression of phosphorylated PI3K, phosphorylated AKT and BCL2, and can also downregulate the expression of the apoptosis marker Ac-caspase-3. However, after adding AKT inhibitor MK-2206 with gradient concentrations of 5mM, 10mM, and 20mM, the restorative effect of IL-12p70 protein on the expression of the above molecules gradually disappeared with the increase of the inhibitor concentration. Consistently, as shown in Figure 7 As shown in D, microglial supernatant rich in inflammatory factors, 13mM glutamate or 200μM hydrogen peroxide significantly reduced the survival of the neural cell line PC12, while the addition of 600pg / mL IL-12p70 protein could significantly restore the survival of the neural cell line PC12. However, after the addition of 10mM AKT inhibitor MK-2206, the protective effect of IL-12p70 protein on the survival of the neural cell line PC12 disappeared.

[0122] The above results show that after inhibiting the PI3K / AKT / BCL2 signaling pathway, the neuroprotective effect of IL-12p70 protein on neurons against microglial supernatant rich in inflammatory factors, glutamate or hydrogen peroxide is weakened. This indicates that IL-12p70 protein depends on the PI3K / AKT / BCL2 signaling pathway to exert its neuroprotective effect.

[0123] Example 12

[0124] 12. IL-12p70 protein eliminates cognitive impairment-like behaviors induced by surgical anesthesia in mice. The specific experimental steps are as follows:

[0125] In order to verify the significance of IL-12p70 protein in the treatment of postoperative cognitive impairment in vivo, Figure 8As shown in A, according to the method in Example 1, 19-month-old C57 mice were anesthetized with sevoflurane at a mass concentration of 2% and underwent laparotomy to construct a mouse model of postoperative cognitive impairment, and then electroacupuncture was used for treatment, and the nasal drop volume was 10 μL and the concentration was 1 mg / mL. The nasal drop of AAV5-shIL-12p70 adenovirus was used for treatment. AAV5-shIL-12p70 adenovirus is a neurotropic adenovirus carrying a short hairpin RNA sequence targeting mouse IL-12p70 protein (adenovirus type: AAV5, targeting sequence: AACCUGCUGAAGACCACAGAU). Then a water maze was performed to detect the cognitive behavior of mice, and finally the mouse brain tissue was collected and immunofluorescence staining was performed using brain slices. NeuN staining marked neuronal nuclei, p-AKT and BCL2 staining showed PI3K / AKT / BCL2 signaling pathway activity, and Ac-caspase-3 staining showed cell viability.

[0126] like Figure 8 B. Figure 8 C and Figure 8 As shown in D, compared with normal mice, the latency of the mice in the surgical group to find the hidden platform during the water maze training period was longer, the swimming trajectory was scattered and without a target during the test period, the time required to reach the original platform position was longer, the number of platform crossings was less, and the movement time in the target quadrant was shorter, which indicated that the mice in the surgical group had cognitive impairment behaviors, and the postoperative cognitive impairment mouse model was successfully established. At the same time, electroacupuncture treatment and IL-12p70 protein (volume 10μL, mass concentration 1mg / mL) nasal drop treatment can significantly shorten the latency of the surgical mice to find the hidden platform during the training period, make the swimming trajectory more concentrated during the test period, shorten the time required to reach the original platform position, increase the number of platform crossings, and increase the movement time in the target quadrant, which indicates that electroacupuncture treatment or IL-12p70 protein nasal drop treatment alone can effectively improve the symptoms of postoperative cognitive impairment. However, when electroacupuncture was applied while the AAV5-shIL-12p70 adenovirus could reduce the expression of IL-12p70 protein, compared with the electroacupuncture alone treatment group, the combined treatment mice had a longer latency period to find the hidden platform during the water maze training period, a scattered swimming track without a target during the test period, a longer time to reach the original platform position, fewer platform crossings, and a shorter movement time in the target quadrant, indicating that the combined treatment mice had severe symptoms of postoperative cognitive impairment, and knocking down the expression of IL-12p70 protein significantly abolished the therapeutic effect of electroacupuncture on postoperative cognitive impairment. Figure 8 As shown in E, the above treatments did not change the motor ability of mice.

[0127] The above results show that the application of IL-12p70 protein alone to treat postoperative cognitive impairment can achieve similar therapeutic effects as electroacupuncture, which shows that IL-12p70 protein has the potential to treat postoperative cognitive impairment. In addition, knockout of IL-12p70 protein can abolish the therapeutic effect of electroacupuncture on postoperative cognitive impairment, further indicating the importance of IL-12p70 protein in the treatment of postoperative cognitive impairment.

[0128] Embodiment 13

[0129] 13. IL-12p70 protein activates the PI3K / AKT / BCL2 signaling pathway in the neurons of the mouse hippocampus to exert neuroprotective effects. The specific experimental steps are as follows:

[0130] The brain tissues of mice in the control group, postoperative cognitive impairment group, electroacupuncture treatment group, IL-12p70 treatment group, and electroacupuncture treatment combined with IL-12p70 knockdown treatment group of Example 12 were separated to obtain brain tissue sections, and the brain tissue sections were used for immunofluorescence staining, NeuN staining was used to mark neuronal nuclei, p-AKT and BCL2 staining showed the activity of the PI3K / AKT / BCL2 signaling pathway, and Ac-caspase-3 staining showed cell viability.

[0131] The results of immunofluorescence staining were used to analyze the dentate gyrus (DG), CA1, and CA3 regions of the hippocampus, which play a key role in cognition. Fig. 9 As shown in A, compared with the control group, surgical anesthesia significantly increased the expression of Ac-caspase-3 in neuronal cells that could be labeled by NeuN staining, indicating that the hippocampal neurons in the surgical group were severely damaged. On the contrary, the expression of Ac-caspase-3 in the hippocampus of mice treated with either electroacupuncture or IL-12p70 protein was reduced, indicating that both treatments can effectively protect hippocampal neurons from surgical anesthesia-induced damage. In addition, knocking down the expression of IL-12p70 protein using adenovirus-delivered shRNA targeting IL-12p70 protein significantly weakened the neuroprotective effect of electroacupuncture. In addition, Fig. 9 As shown in B, electroacupuncture and IL-12p70 protein treatment can restore the downregulation of phosphorylated AKT and BCL2 expression induced by surgical anesthesia. Fig. 9 B. Fig. 9 C and Fig. 9 As shown in D, after IL-12p70 protein knockdown, the restorative effect of electroacupuncture on the activity of the PI3K-AKT-BCL2 signaling axis in the hippocampal neurons of operated mice disappeared.

[0132] Taken together, these results indicate that IL-12p70 protein protects hippocampal neurons by activating the PI3K-AKT-BCL2 signaling axis, thereby mediating the therapeutic effect of electroacupuncture on postoperative cognitive impairment.

[0133] In summary, the embodiment of the present application provides a biomarker for cognitive impairment. In a neuronal cell injury model induced by multiple damaging factors, the IL-12p70 protein as a biomarker can activate the PI3K-AKT-BCL2 signaling pathway to enhance the survival rate of neurons, thereby protecting neurons from the influence of damaging factors; in addition, the expression level of IL-12p70 protein in the serum of elderly clinical patients who are prone to postoperative cognitive impairment after surgery is significantly decreased compared with that before surgery, while the expression level of IL-12p70 protein in the serum of young clinical patients who are not prone to postoperative cognitive impairment before and after surgery is not much different; in addition, the expression level of IL-12p70 protein in the serum of mice with postoperative cognitive impairment model is significantly lower than that of normal mice, while electroacupuncture treatment can increase the expression level of IL-12p70 protein in serum. The expression level of L-12p70 protein can be reduced and the learning and memory ability of mice can be improved; the recombinant knockdown adenovirus (AAV-shIL-12p70) that specifically targets IL-12p70 protein is used to treat young mice by nasal drops. By specifically inhibiting the expression of IL-12p70 protein, the body's cognitive level can be reduced, thereby causing cognitive impairment; in addition, the nasal drops of surgically anesthetized mice treated with IL-12p70 protein can effectively restore the mice's learning and memory ability and alleviate cognitive impairment; and the nasal drops of recombinant knockdown adenovirus (AAV-shIL-12p70) that specifically targets IL-12p70 protein can specifically inhibit the expression of IL-12p70 protein, thereby hindering the recovery of cognitive level.

[0134] In addition, a biological fragment for treating cognitive impairment provided in an embodiment of the present application has demonstrated for the first time that IL-12p70 protein can activate the PI3K / AKT / BCL2 pro-survival signaling pathway, which has a protective effect on hippocampal neuronal cell death caused by various factors, thereby significantly improving the symptoms of cognitive impairment, thereby obtaining a means of preventing and treating diseases related to cognitive impairment.

[0135] In addition, an embodiment of the present application provides a combination drug for treating cognitive impairment, which contains IL-12p70 protein or a vector expressing IL-12p70 protein, and can be used to treat cognitive impairment-related diseases and has excellent prospects; in addition, based on the correlation between IL-12p70 protein content and cognitive level, IL-12p70 protein is used as a diagnostic marker in a cognitive impairment diagnostic kit, which can evaluate the onset and progression of cognitive impairment.

[0136] The above description is only a specific implementation of the present application, so that those skilled in the art can understand or implement the present application. It will be apparent to those skilled in the art that various modifications to these embodiments are possible, and the general principles defined in the present application can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to the embodiments shown in the present application, but will conform to the widest range consistent with the principles and novel features applied for by the present application.

Claims

1. A biomarker for cognitive impairment, wherein the IL-12p70 protein with expression level lower than the normal level is used as a biomarker for cognitive impairment.

2. The biomarker according to claim 1, wherein the expression level of the IL-12p70 protein is less than 0.7 times the expression level of the normal IL-12p70 protein. 3 . The biomarker according to claim 1 , wherein the expression level of the IL-12p70 protein is positively correlated with the degree of the cognitive impairment disease.

4. A detection reagent for cognitive impairment diseases for non-diagnosis and treatment purposes, the detection reagent comprising a reagent for detecting IL-12p70 gene transcription level, translation level and / or IL-12p70 protein expression level.

5. The detection reagent according to claim 4, wherein the detection reagent comprises at least one of the following: An oligonucleotide fragment complementary to the mRNA of the IL-12p70 gene, a primer specifically binding to the mRNA of the IL-12p70 gene, a probe specifically binding to the mRNA of the IL-12p70 gene, and an antibody specifically binding to the IL-12p70 protein.

6. A biological fragment for treating cognitive impairment, the biological fragment comprising a gene fragment that regulates the expression level of IL-12p70 protein.

7. The biological fragment according to claim 6, wherein the gene fragment comprises a gene fragment encoding an IL-12p35 subunit.

8. A genetic engineering vector for treating cognitive impairment, the genetic engineering vector comprising a vector and a gene fragment encoding an IL-12p35 subunit carried on the vector.

9. A combination drug for treating cognitive impairment, the combination drug comprising at least one of the following: IL-12p70 protein, agents that regulate the expression level of IL-12p70 protein, and agents that regulate the expression level of IL-12p35 subunit. 10 . The combination drug according to claim 9 , further comprising the biological fragment according to claim 6 or 7 and / or the genetic engineering vector according to claim 8 .

Images