Identification of tissue-specific extragenetic safe harbor for gene therapy methods

Abstract

Compositions and methods are provided for inserting a nucleic acid encoding a product of interest into a genome-safe harbor locus in a cell, population of cells, or subject or for expressing a nucleic acid encoding a product of interest from a genome-safe harbor locus in a cell, population of cells, or subject. Also provided are cells or populations of cells comprising a nucleic acid construct comprising a coding sequence for a product of interest inserted in a genomically safe harbor locus. Methods of identifying genomically safe harbor loci for specific cell or tissue types are also provided.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Application No. 63 / 336,663, filed on April 29, 2022, which is incorporated herein by reference in its entirety for all purposes.

[0003] Reference to sequence listings submitted as XML files via EFS WEB

[0004] The sequence listing written into file 591806SEQLIST.xml is 504 kilobytes, created on April 27, 2023, and is hereby incorporated by reference. Background Art

[0005] Current gene therapy methods rely on free expression of transgenics and / or insertion of specific genomic loci. Due to dilution or silencing, it has been shown that the free type method is limited to the liver. Integration in a specific locus allows for sustained expression of the transgenic. However, the method remains to be proven to be effective and safe in the human environment. Typical genomic safe harbor loci in humans (such as AAVS1, CCR5, and Rosa26) are all intragenic and less explored than mouse genomic safe harbor loci. In addition, different tissues have different chromatin states for the defined loci, so typical genomic safe harbors can be silenced in some tissues. Therefore, tissue-specific genomic safe harbor loci are needed. Summary of the invention

[0006] Provided are compositions and methods for inserting nucleic acids encoding products of interest into genomic safe harbor loci in cells, cell colonies, or subjects or for expressing nucleic acids encoding products of interest by genomic safe harbor loci in cells, cell colonies, or subjects. Also provided are cells or cell colonies comprising nucleic acid constructs comprising the coding sequence of the products of interest inserted into the genomic safe harbor loci. Also provided are methods for identifying genomic safe harbor loci for specific cells or tissue types.

[0007] In one aspect, methods of integrating a nucleic acid construct into a genomic safe harbor locus in a cell (e.g., a mammalian cell) such as a human cell, methods of expressing a product of interest from a genomic safe harbor locus in a cell (e.g., a mammalian cell) such as a human cell, methods of integrating a nucleic acid construct into a genomic safe harbor locus in a cell (e.g., a mammalian cell) of a subject (e.g., a mammalian subject) such as a human cell, and methods of expressing a product of interest from a genomic safe harbor locus in a cell (e.g., a mammalian cell) of a subject (e.g., a mammalian subject) such as a human cell of a human subject are provided.

[0008] Provided are methods for integrating a nucleic acid construct into a genomic safe harbor locus in a cell (e.g., a mammalian cell) such as a human cell. Such methods may include administering to a cell (e.g., a human cell): (a) a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target site in a genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site, and the nucleic acid construct is inserted into the genomic safe harbor locus. Also provided are methods of expressing a product of interest from a genomic safe harbor locus in a cell (eg, a mammalian cell), such as a human cell. Such methods may include administering to a cell (e.g., a human cell): (a) a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target site in a genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site, the nucleic acid construct is inserted into the genomic safe harbor locus to form a modified genomic safe harbor locus, and the product of interest is expressed by the modified genomic safe harbor locus. In some such methods, the cell (e.g., a human cell) is a liver cell. In some such methods, the cell (e.g., human cell) is a hepatocyte. In some such methods, the cell (e.g., human cell) is in vitro or ex vivo. In some such methods, the cell (e.g., human cell) is in a subject. Also provided is a method for integrating a nucleic acid construct into a genomic safe harbor locus in a cell (e.g., mammalian cell) of a subject (e.g., mammalian subject) such as a human subject's human cell.Such methods may include administering to a subject (e.g., a human subject): (a) a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target site in a genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site, and the nucleic acid construct is inserted into the genomic safe harbor locus. Also provided are methods of expressing a product of interest from a genomic safe harbor locus in a cell (e.g., a mammalian cell) of a subject (e.g., a mammalian subject), such as a human cell of a human subject. Such methods may include administering to a subject (e.g., a human subject): (a) a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target site in a genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site, the nucleic acid construct is inserted into the genomic safe harbor locus to form a modified genomic safe harbor locus, and the product of interest is expressed by the modified genomic safe harbor locus. In some such methods, the cell (e.g., a human cell) is a liver cell. In some such methods, the cell (eg, human cell) is a hepatocyte.

[0009] In some such methods, the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537; (ii) human chromosome 6, coordinates 170031084-170031382; and (iii) human chromosome 9, coordinates 25207412-25207703. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13. In some such methods, the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 39. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6. In some such methods, the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 40. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 25207412 to about 25207703 on human chromosome 9. In some such methods, the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 41.

[0010] In some such methods, the nuclease agent comprises: (a) a zinc finger nuclease (ZFN); (b) a transcription activator-like effector nuclease (TALEN); or (c) (i) a Cas protein or a nucleic acid encoding a Cas protein; and (ii) a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets the guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence.

[0011] In some such methods, the nuclease agent comprises: (a) a Cas protein or a nucleic acid encoding a Cas protein; and (b) a guide RNA or one or more DNAs encoding a guide RNA, wherein the guide RNA comprises a DNA targeting segment targeting a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence. In some such methods, the method comprises administering a guide RNA in the form of RNA. In some such methods, the guide RNA comprises at least one modification. In some such methods, the at least one modification comprises a 2'-O-methyl modified nucleotide. In some such methods, the at least one modification comprises a phosphorothioate bond between nucleotides. In some such methods, the guide RNA is a single guide RNA (sgRNA). In some such methods, the Cas protein is a Cas9 protein. In some such methods, the Cas protein is a CasX protein. In some such methods, the Cas protein is a CasΦ protein. In some such methods, the Cas protein is a Cpf1 protein. In some such methods, the Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein or Neisseria meningitidis Cas9 protein. In some such methods, the Cas protein is derived from Streptococcus pyogenes Cas9 protein. In some such methods, the nucleic acid encoding the Cas protein is codon optimized to be expressed in mammalian cells or human cells. In some such methods, the method includes administering a nucleic acid encoding the Cas protein, wherein the nucleic acid includes an mRNA encoding the Cas protein. In some such methods, the mRNA encoding the Cas protein includes at least one modification. In some such methods, the Cas protein or the nucleic acid encoding the Cas protein and the guide RNA or one or more DNA encoding the guide RNA are associated with lipid nanoparticles. In some such methods, the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537; (ii) human chromosome 6, coordinates 170031084-170031382; and (iii) human chromosome 9, coordinates 25207412-25207703. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13.In some such methods, the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, consists essentially of, or consists of a sequence as set forth in SEQ ID NO: 39. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in any one of SEQ ID NOs: 25, 45, and 228-256; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to a sequence as set forth in any one of SEQ ID NOs: 25, 45, and 228-256; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 25, 45, and 228-256; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 25, 45, and 228-256. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 25, 45, 235, 237, and 246; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 25, 45, 235, 237, and 246; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 25, 45, 235, 237, and 246; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 25, 45, 235, 237, and 246. In some such methods: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:25; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:25. In some such methods, the DNA targeting segment comprises SEQ ID NO:25. In some such methods, the DNA targeting segment consists of SEQ ID NO:25. In some such methods: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:45; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:45. In some such methods, the DNA targeting segment comprises SEQ ID NO:45. In some such methods, the DNA targeting segment consists of SEQ ID NO:45. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6.In some such methods, the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, consists essentially of, or consists of a sequence as set forth in SEQ ID NO: 40. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in any one of SEQ ID NOs: 26, 46, and 257-285; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to a sequence as set forth in any one of SEQ ID NOs: 26, 46, and 257-285; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 26, 46, and 257-285; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 26, 46, and 257-285. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 26, 46, 268, 271, and 280; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 26, 46, 268, 271, and 280; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 26, 46, 268, 271, and 280; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 26, 46, 268, 271, and 280. In some such methods: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:26; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:26. In some such methods, the DNA targeting segment comprises SEQ ID NO:26. In some such methods, the DNA targeting segment consists of SEQ ID NO:26. In some such methods: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:46; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:46. In some such methods, the DNA targeting segment comprises SEQ ID NO:46. In some such methods, the DNA targeting segment consists of SEQ ID NO:46. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 25207412 to about 25207703 on human chromosome 9.In some such methods, the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, consists essentially of, or consists of a sequence as set forth in SEQ ID NO: 41. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in any one of SEQ ID NOs: 27, 47, and 286-314; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to a sequence as set forth in any one of SEQ ID NOs: 27, 47, and 286-314; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 27, 47, and 286-314; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 27, 47, and 286-314. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence set forth in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310. In some such methods: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:27; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:27. In some such methods, the DNA targeting segment comprises SEQ ID NO:27. In some such methods, the DNA targeting segment consists of SEQ ID NO:27. In some such methods: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:47; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:47. In some such methods, the DNA targeting segment comprises SEQ ID NO:47. In some such methods, the DNA targeting segment consists of SEQ ID NO:47.

[0012] Also provided are methods for integrating a nucleic acid construct into a genomic safe harbor locus in a mouse cell. Some such methods include administering to a mouse cell: (a) a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target site in a genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site, and the nucleic acid construct is inserted into the genomic safe harbor locus. Also provided are methods for expressing a product of interest from a genomic safe harbor locus in mouse cells. Some such methods include administering to a mouse cell: (a) a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target site in a genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates from about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates from about 92,827,563 to about 92,828,592 on mouse chromosome 4; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site, the nucleic acid construct is inserted into the genomic safe harbor locus to form a modified genomic safe harbor locus, and the product of interest is expressed from the modified genomic safe harbor locus. In some such methods, the mouse cell is a liver cell. In some such methods, the mouse cell is a liver cell. In some such methods, the mouse cell is in vitro or ex vivo. In some such methods, the mouse cell is in a subject. Also provided is a method of integrating a nucleic acid construct into a genomic safe harbor locus in a mouse cell of a mouse subject.Some such methods include administering to a mouse subject: (a) a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target site in a genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site, and the nucleic acid construct is inserted into the genomic safe harbor locus. Also provided are methods of expressing a product of interest from a genomic safe harbor locus in a mouse cell of a mouse subject. Some such methods include administering to a mouse subject: (a) a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target site in a genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates from about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates from about 92,827,563 to about 92,828,592 on mouse chromosome 4; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site, the nucleic acid construct is inserted into the genomic safe harbor locus to form a modified genomic safe harbor locus, and the product of interest is expressed from the modified genomic safe harbor locus. In some such methods, the mouse cell is a liver cell. In some such methods, the mouse cell is a liver cell.

[0013] In some such methods, the genomic safe harbor locus is selected from the following genomic locations: (i) mouse chromosome 14, coordinates 103,450,397-103,451,396; (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386; and (iii) mouse chromosome 4, coordinates 92,827,563-92,828,592. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14. In some such methods, the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:405. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17. In some such methods, the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 406. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4. In some such methods, the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 407.

[0014] In some such methods, the nuclease agent comprises: (a) zinc finger nuclease (ZFN); (b) transcription activator-like effector nuclease (TALEN); or (c) (i) Cas protein or nucleic acid encoding Cas protein; and (ii) guide RNA or one or more DNA encoding guide RNA, wherein the guide RNA comprises a DNA targeting segment targeting the guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence. In some such methods, the nuclease agent comprises: (a) Cas protein or nucleic acid encoding Cas protein; and (b) guide RNA or one or more DNA encoding guide RNA, wherein the guide RNA comprises a DNA targeting segment targeting the guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence. In some such methods, the method includes administering a guide RNA in the form of RNA. In some such methods, the guide RNA comprises at least one modification. In some such methods, the at least one modification comprises nucleotides modified with 2'-O-methyl. In some such methods, the at least one modification comprises phosphorothioate bonds between nucleotides. In some such methods, the guide RNA is a single guide RNA (sgRNA). In some such methods, the Cas protein is a Cas9 protein. In some such methods, the Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein or Neisseria meningitidis Cas9 protein. In some such methods, the Cas protein is derived from Streptococcus pyogenes Cas9 protein. In some such methods, the nucleic acid encoding the Cas protein is codon optimized to be expressed in mammalian cells or mouse cells. In some such methods, the method includes administering a nucleic acid encoding a Cas protein, wherein the nucleic acid comprises an mRNA encoding a Cas protein. In some such methods, the mRNA encoding the Cas protein comprises at least one modification. In some such methods, a Cas protein or a nucleic acid encoding a Cas protein and a guide RNA or one or more DNAs encoding a guide RNA are associated with a lipid nanoparticle.In some such methods, the genomic safe harbor locus is selected from the following genomic locations: (i) mouse chromosome 14, coordinates 103,450,397-103,451,396; (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386; and (iii) mouse chromosome 4, coordinates 92,827,563-92,828,592. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14. In some such methods, the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:405. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 315-344; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 315-344; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 315-344; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 315-344. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 318, 320, 321, and 341; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 318, 320, 321, and 341; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 318, 320, 321, and 341; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 318, 320, 321, and 341. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17. In some such methods, the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:406.In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 345-374; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 345-374; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 345-374; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 345-374. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 347, 360, 369, and 370; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 347, 360, 369, and 370; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 347, 360, 369, and 370; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 347, 360, 369, and 370. In some such methods, the genomic safe harbor locus is the genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4. In some such methods, the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, consists essentially of, or consists of a sequence as set forth in SEQ ID NO: 407. In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in any one of SEQ ID NOs: 375-404; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to a sequence as set forth in any one of SEQ ID NOs: 375-404; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 375-404; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 375-404.In some such methods, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 379, 380, and 388; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 379, 380, and 388; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 379, 380, and 388; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 379, 380, and 388.

[0015] In some such methods, the nucleic acid construct is administered simultaneously with the nuclease agent or one or more nucleic acids encoding the nuclease agent. In some such methods, the nucleic acid construct is not administered simultaneously with the nuclease agent or one or more nucleic acids encoding the nuclease agent. In some such methods, the nucleic acid construct is administered before the nuclease agent or one or more nucleic acids encoding the nuclease agent. In some such methods, the nucleic acid construct is administered after the nuclease agent or one or more nucleic acids encoding the nuclease agent.

[0016] In some such methods, the product of interest is a polypeptide of interest. In some such methods, the polypeptide of interest includes a therapeutic polypeptide. In some such methods, the polypeptide of interest is a secreted polypeptide. In some such methods, the polypeptide of interest is an intracellular polypeptide.

[0017] In some such methods, the promoter is active in liver cells. In some such methods, the promoter is a tissue-specific promoter. In some such methods, the promoter is a constitutive promoter. In some such methods, the promoter is an inducible promoter.

[0018] In some such methods, the nucleic acid construct does not include homology arms. In some such methods, the nucleic acid construct is inserted into the target genome locus via non-homologous end joining. In some such methods, the nucleic acid construct includes homology arms. In some such methods, the nucleic acid construct is inserted into the target genome locus via homology directed repair. In some such methods, the nucleic acid construct is a single-stranded DNA or a double-stranded DNA. In some such methods, the nucleic acid construct is a single-stranded DNA.

[0019] In some such methods, the nucleic acid construct is in a nucleic acid vector or a lipid nanoparticle. In some such methods, the nucleic acid construct is in a nucleic acid vector. In some such methods, the nucleic acid vector is a viral vector. In some such methods, the nucleic acid vector is an adeno-associated virus (AAV) vector. In some such methods, the AAV vector is a single-stranded AAV (ssAAV) vector. In some such methods, the AAV vector is derived from an AAV8 vector, an AAV3B vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV9 vector, an AAVrh.74 vector, an AAV-DJ vector or an AAVhu.37 vector. In some such methods, the AAV vector is a recombinant AAV8 (rAAV8) vector. In some such methods, the AAV vector is a single-stranded rAAV8 vector.

[0020] In another aspect, cells (e.g., mammalian cells, such as human cells) prepared by any of the above methods are provided. In another aspect, cells (e.g., mammalian cells, such as human cells) comprising a nucleic acid construct integrated into a genomic safe harbor locus are provided. In some such cells, the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, and wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9. In some such cells, the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, and wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates from about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates from about 92,827,563 to about 92,828,592 on mouse chromosome 4.

[0021] In some such cells, the cell is a human cell. In some such cells, the cell is a mouse cell. In some such cells, the cell is a liver cell (e.g., a human liver cell). In some such cells, the cell is a hepatocyte (e.g., a human liver cell).

[0022] In some such cells, a product of interest is expressed. In some such cells, the product of interest is a polypeptide of interest. In some such cells, the polypeptide of interest includes a therapeutic polypeptide. In some such cells, the polypeptide of interest is a secreted polypeptide. In some such cells, the polypeptide of interest is an intracellular polypeptide. In some such cells, the promoter is active in liver cells. In some such cells, the promoter is a tissue-specific promoter. In some such cells, the promoter is a constitutive promoter. In some such cells, the promoter is an inducible promoter.

[0023] In some such cells, the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537; (ii) human chromosome 6, coordinates 170031084-170031382; and (iii) human chromosome 9, coordinates 25207412-25207703. In some such cells, the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13. In some such cells, the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 39. In some such cells, the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6. In some such cells, the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 40. In some such cells, the genomic safe harbor locus is genomic coordinates of about 25207412 to about 25207703 on human chromosome 9. In some such cells, the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 41.

[0024] In some such cells, the genomic safe harbor locus is selected from the following genomic locations: (i) mouse chromosome 14, coordinates 103,450,397-103,451,396; (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386; and (iii) mouse chromosome 4, coordinates 92,827,563-92,828,592. In some such cells, the genomic safe harbor locus is genomic coordinates from about 103,450,397 to about 103,451,396 on mouse chromosome 14. In some such cells, the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:405. In some such cells, the genomic safe harbor locus is the genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17. In some such cells, the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 406. In some such cells, the genomic safe harbor locus is the genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4. In some such cells, the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 407.

[0025] In another aspect, a composition comprising a guide RNA or a DNA encoding a guide RNA is provided, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in a genomic safe harbor locus and a protein binding segment that binds to a Cas protein, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates from about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates from about 25207412 to about 25207703 on human chromosome 9. In another aspect, a composition comprising a guide RNA or a DNA encoding a guide RNA is provided, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in a genomic safe harbor locus and a protein binding segment that binds to a Cas protein, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates from about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates from about 92,827,563 to about 92,828,592 on mouse chromosome 4.

[0026] In some such compositions, the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537; (ii) human chromosome 6, coordinates 170031084-170031382; and (iii) human chromosome 9, coordinates 25207412-25207703. In some such compositions, the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13. In some such compositions, the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 39. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 25, 45, and 228-256; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 25, 45, and 228-256; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 25, 45, and 228-256; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 25, 45, and 228-256. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 25, 45, 235, 237, and 246; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 25, 45, 235, 237, and 246; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 25, 45, 235, 237, and 246; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 25, 45, 235, 237, and 246. In some such compositions: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 25; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 25. In some such compositions, the DNA targeting segment comprises SEQ ID NO: 25. In some such compositions, the DNA targeting segment consists of SEQ ID NO: 25.In some such compositions: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:45; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:45. In some such compositions, the DNA targeting segment comprises SEQ ID NO:45. In some such compositions, the DNA targeting segment consists of SEQ ID NO:45. In some such compositions, the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6. In some such compositions, the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:40. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 26, 46, and 257-285; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 26, 46, and 257-285; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 26, 46, and 257-285; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 26, 46, and 257-285. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 26, 46, 268, 271, and 280; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 26, 46, 268, 271, and 280; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 26, 46, 268, 271, and 280; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 26, 46, 268, 271, and 280. In some such compositions: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 26; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 26. In some such compositions, the DNA targeting segment comprises SEQ ID NO: 26.In some such compositions, the DNA targeting segment consists of SEQ ID NO:26. In some such compositions: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:46; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:46. In some such compositions, the DNA targeting segment comprises SEQ ID NO:46. In some such compositions, the DNA targeting segment consists of SEQ ID NO:46. In some such compositions, the genomic safe harbor locus is the genomic coordinates of about 25207412 to about 25207703 on human chromosome 9. In some such compositions, the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:41. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 27, 47, and 286-314; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 27, 47, and 286-314; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 27, 47, and 286-314; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 27, 47, and 286-314. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence set forth in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310.In some such compositions: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:27; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:27. In some such compositions, the DNA targeting segment comprises SEQ ID NO:27. In some such compositions, the DNA targeting segment consists of SEQ ID NO:27. In some such compositions: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:47; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO:47. In some such compositions, the DNA targeting segment comprises SEQ ID NO:47. In some such compositions, the DNA targeting segment consists of SEQ ID NO:47.

[0027] In some such compositions, the genomic safe harbor locus is selected from the following genomic locations: (i) mouse chromosome 14, coordinates 103,450,397-103,451,396; (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386; and (iii) mouse chromosome 4, coordinates 92,827,563-92,828,592. In some such compositions, the genomic safe harbor locus is the genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14. In some such compositions, the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:405. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 315-344; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 315-344; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 315-344; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 315-344. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 318, 320, 321, and 341; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 318, 320, 321, and 341; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 318, 320, 321, and 341; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 318, 320, 321, and 341. In some such compositions, the genomic safe harbor locus is the genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17. In some such compositions, the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:406.In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 345-374; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 345-374; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 345-374; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 345-374. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 347, 360, 369, and 370; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 347, 360, 369, and 370; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 347, 360, 369, and 370; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 347, 360, 369, and 370. In some such compositions, the genomic safe harbor locus is the genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4. In some such compositions, the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, consists essentially of, or consists of a sequence as set forth in SEQ ID NO: 407. In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in any one of SEQ ID NOs: 375-404; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to a sequence as set forth in any one of SEQ ID NOs: 375-404; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 375-404; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 375-404.In some such compositions, (I) the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 379, 380, and 388; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 379, 380, and 388; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 379, 380, and 388; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 379, 380, and 388.

[0028] In some such compositions, the composition comprises DNA encoding guide RNA. In some such compositions, the DNA encoding guide RNA is in a nucleic acid vector. In some such compositions, the nucleic acid vector is a viral vector. In some such compositions, the nucleic acid vector is an adeno-associated virus (AAV) vector. In some such compositions, the AAV vector is a single-stranded AAV (ssAAV) vector. In some such compositions, the AAV vector is derived from an AAV8 vector, an AAV3B vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV9 vector, an AAVrh.74 vector, an AAV-DJ vector or an AAVhu.37 vector. In some such compositions, the AAV vector is a recombinant AAV8 (rAAV8) vector. In some such compositions, the AAV vector is a single-stranded rAAV8 vector. In some such compositions, the composition comprises a guide RNA in the form of RNA. In some such compositions, the guide RNA comprises at least one modification. In some such compositions, the at least one modification includes nucleotides modified with 2'-O-methyl. In some such compositions, the at least one modification comprises a phosphorothioate bond between nucleotides. In some such compositions, the guide RNA is a single guide RNA (sgRNA).

[0029] In some such compositions, the composition further comprises a Cas protein or a nucleic acid encoding the Cas protein. In some such compositions, the composition comprises a Cas protein. In some such compositions, the composition comprises a nucleic acid encoding a Cas protein. In some such compositions, the nucleic acid encoding the Cas protein is codon optimized for expression in mammalian cells or human cells. In some such compositions, the nucleic acid encoding the Cas protein comprises a DNA encoding the Cas protein. In some such compositions, the DNA encoding the guide RNA is in a nucleic acid vector. In some such compositions, the nucleic acid vector is a viral vector. In some such compositions, the nucleic acid vector is an adeno-associated virus (AAV) vector. In some such compositions, the AAV vector is a single-stranded AAV (ssAAV) vector. In some such compositions, the AAV vector is derived from an AAV8 vector, an AAV3B vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV9 vector, an AAVrh.74 vector, an AAV-DJ vector or an AAVhu.37 vector. In some such compositions, the AAV vector is a recombinant AAV8 (rAAV8) vector. In some such compositions, the AAV vector is a single-stranded rAAV8 vector. In some such compositions, the nucleic acid encoding the Cas protein comprises an mRNA encoding the Cas protein. In some such compositions, the mRNA encoding the Cas protein comprises at least one modification. In some such compositions, the Cas protein or the nucleic acid encoding the Cas protein and the guide RNA or one or more DNA encoding the guide RNA are associated with lipid nanoparticles. In some such compositions, the Cas protein is a Cas9 protein. In some such compositions, the Cas protein is a CasX protein. In some such compositions, the Cas protein is a CasΦ protein. In some such compositions, the Cas protein is a Cpf1 protein. In some such compositions, the Cas9 protein is derived from a Streptococcus pyogenes Cas9 protein, a Staphylococcus aureus Cas9 protein, a Campylobacter jejuni Cas9 protein, a Streptococcus thermophilus Cas9 protein, or a Neisseria meningitidis Cas9 protein. In some such compositions, the Cas protein is derived from a Streptococcus pyogenes Cas9 protein.

[0030] In some such compositions, the composition further comprises a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably connected to a promoter, wherein the nucleic acid encodes a product of interest. In some such compositions, the product of interest is a polypeptide of interest. In some such compositions, the polypeptide of interest includes a therapeutic polypeptide. In some such compositions, the polypeptide of interest is a secreted polypeptide. In some such compositions, the polypeptide of interest is an intracellular polypeptide. In some such compositions, the promoter is active in liver cells. In some such compositions, the promoter is a tissue-specific promoter. In some such compositions, the promoter is a constitutive promoter. In some such compositions, the promoter is an inducible promoter. In some such compositions, the nucleic acid construct does not include homology arms. In some such compositions, the nucleic acid construct includes homology arms. In some such compositions, the nucleic acid construct is a single-stranded DNA or a double-stranded DNA. In some such compositions, the nucleic acid construct is a single-stranded DNA.

[0031] In some such compositions, the nucleic acid construct is in a nucleic acid vector or a lipid nanoparticle. In some such compositions, the nucleic acid construct is in a nucleic acid vector. In some such compositions, the nucleic acid vector is a viral vector. In some such compositions, the nucleic acid vector is an adeno-associated virus (AAV) vector. In some such compositions, the AAV vector is a single-stranded AAV (ssAAV) vector. In some such compositions, the AAV vector is derived from an AAV8 vector, an AAV3B vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV9 vector, an AAVrh.74 vector, an AAV-DJ vector or an AAVhu.37 vector. In some such compositions, the AAV vector is a recombinant AAV8 (rAAV8) vector. In some such compositions, the AAV vector is a single-stranded rAAV8 vector.

[0032] In another aspect, a nucleic acid comprising a genomic safe harbor locus is provided, the genomic safe harbor locus comprising an integrated nucleic acid construct. In some such nucleic acids, the nucleic acid construct comprises a nucleic acid operably linked to a promoter, the nucleic acid encodes a product of interest, and the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9. In some such nucleic acids, the nucleic acid construct comprises a nucleic acid operably linked to a promoter, the nucleic acid encodes a product of interest, and the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates from about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates from about 92,827,563 to about 92,828,592 on mouse chromosome 4.

[0033] In some such nucleic acids, the product of interest is a polypeptide of interest. In some such nucleic acids, the polypeptide of interest includes a therapeutic polypeptide. In some such nucleic acids, the polypeptide of interest is a secreted polypeptide. In some such nucleic acids, the polypeptide of interest is an intracellular polypeptide. In some such nucleic acids, the promoter is active in liver cells. In some such nucleic acids, the promoter is a tissue-specific promoter. In some such nucleic acids, the promoter is a constitutive promoter. In some such nucleic acids, the promoter is an inducible promoter.

[0034] In some such nucleic acids, the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537; (ii) human chromosome 6, coordinates 170031084-170031382; and (iii) human chromosome 9, coordinates 25207412-25207703. In some such nucleic acids, the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13. In some such nucleic acids, the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 39. In some such nucleic acids, the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6. In some such nucleic acids, the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 40. In some such nucleic acids, the genomic safe harbor locus is genomic coordinates of about 25207412 to about 25207703 on human chromosome 9. In some such nucleic acids, the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 41.

[0035] In some such nucleic acids, the genomic safe harbor locus is selected from the following genomic locations: (i) mouse chromosome 14, coordinates 103,450,397-103,451,396; (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386; and (iii) mouse chromosome 4, coordinates 92,827,563-92,828,592. In some such nucleic acids, the genomic safe harbor locus is the genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14. In some such nucleic acids, the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:405. In some such nucleic acids, the genomic safe harbor locus is the genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17. In some such nucleic acids, the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 406. In some such nucleic acids, the genomic safe harbor locus is the genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4. In some such nucleic acids, the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 407.

[0036] On the other hand, a method for identifying one or more genomic safe harbor loci in a tissue or cell type of interest is provided. Some such methods include: (a) identifying accessible genomic loci in a tissue or cell type of interest; (b) selecting the genomic loci identified in step (a) based on safety criteria, functional silencing criteria, and / or structural accessibility criteria; and (c) selecting the genomic loci identified in step (b) based on guide RNA availability, efficacy, and specificity. In some such methods, step (a) includes identifying accessible genomic loci using a transposase accessible chromatin assay with high-throughput sequencing. In some such methods, step (a) includes identifying accessible genomic loci using DNase I hypersensitive site sequencing. In some such methods, step (a) includes identifying accessible genomic loci using a transposase accessible chromatin assay with high-throughput sequencing and DNase I hypersensitive site sequencing. In some such methods, step (a) includes identifying accessible genomic loci using a transposase accessible chromatin assay with high-throughput sequencing and DNase I hypersensitive site sequencing. In some such methods, step (b) includes selecting the genomic loci identified in step (a) based on safety criteria, functional silencing criteria, and structural accessibility criteria. In some such methods, the safety criteria in step (b) include selecting the genomic locus only when the genomic locus is more than 300kb from any cancer-related gene, more than 300kb from any miRNA or small RNA, and more than 50kb from the 5' end of any gene. In some such methods, the functional silencing criteria in step (b) include selecting the genomic locus only when the genomic locus is more than 50kb from any replication origin and more than 50kb from any ultra-conservative element. In some such methods, the structural accessibility criteria in step (b) include selecting the genomic locus only when the genomic locus is not in the copy number variable region. In some such methods, the efficacy in step (c) includes editing efficiency in the tissue or cell type of interest. In some such methods, the method also includes analyzing the markers in the chromatin environment of the genomic locus selected in step (c) to cancel the qualification of any genomic locus in the region predicted to be a regulatory region, a heterochromatin region, a region involved in the three-dimensional organization of chromatin, or a region of transcriptional active region. In some such methods, markers for regulatory regions include H3K4me1, H3K27ac, and H3K4me3. In some such methods, markers for heterochromatin regions include H3K9me3. In some such methods, markers for regions involved in the three-dimensional organization of chromatin include CTCF. In some such methods, markers for transcriptionally active regions include H3K36me3, PolR2A, RNASeq-, and RNASeq+.In some such methods, step (a) comprises identifying accessible genomic loci using a transposase-accessible chromatin assay with high-throughput sequencing and DNase I hypersensitive site sequencing, wherein step (b) comprises selecting the genomic loci identified in step (a) based on safety criteria, functional silencing criteria, and structural accessibility criteria, wherein the safety criteria in step (b) comprises selecting the genomic loci only if the genomic loci are more than 300 kb from any cancer-associated gene, more than 300 kb from any miRNA or small RNA, and more than 50 kb from the 5' end of any gene, wherein the functional silencing criteria in step (b) comprises selecting the genomic loci only if the genomic loci are more than 50 kb from any replication origin and more than 50 kb from any ultra-conserved element, and wherein the structural accessibility criteria in step (b) Including selecting the genomic locus only when it is not in a copy number variable region, and wherein the method further includes analyzing the markers in the chromatin environment of the genomic locus selected in step (c) to disqualify any genomic locus in a region predicted to be a regulatory region, a heterochromatin region, a region involved in the three-dimensional organization of chromatin, or a transcriptionally active region, wherein the markers for the regulatory region include H3K4me1, H3K27ac, and H3K4me3, wherein the markers for the heterochromatin region include H3K9me3, wherein the markers for the region involved in the three-dimensional organization of chromatin include CTCF, and wherein the markers for the transcriptionally active region include H3K36me3, PolR2A, RNASeq-, and RNASeq+. In some such methods, the method is used to identify one or more genomic safe harbor loci in a human tissue or cell type of interest. In some such methods, the tissue or cell type of interest is liver. In some such methods, the tissue or cell type of interest is hematopoietic cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 A systematic approach for identifying liver-specific extragenic genomic safe harbor loci is shown.

[0038] Figure 2 The editing efficiency of 33 gRNAs covering 20 loci after screening in primary human hepatocytes from three different donors is shown. The editing efficiency of control gRNAs targeting AAVS1, ROSA26 and CCR5 is also shown.

[0039] Figure 3A-Figure 3FManual curation of six potential liver-specific extragenic genomic safe harbor loci (L-SH4, L-SH11, L-SH17, L-SH5, L-SH18, and L-SH20, respectively) is shown to analyze chromatin marks in the chromatin context based on ChIP-Seq data, thereby disqualifying from the analysis any potential safe harbors that fell within regions predicted to be regulatory regions (H3K4me1, H3K27ac, H3K4me3), heterochromatin regions (H3K9me3), or involved in chromatin organization (CTCF signal).

[0040] Figure 4A and Figure 4B Figure 2 shows the expression of 100 ng Cas9 mRNA and 25 nM sgRNA at 96 hours after transfection. Figure 4A ) or 96 hours after administration of Cas9 mRNA and sgRNA via lipid nanoparticles (at a dose of 1 μg / mL) Figure 4B ), editing efficiency at the L-SH5, L-SH18, and L-SH20 genomic loci in primary human hepatocytes in 96-well plates. To assess editing efficiency, next-generation sequencing (NGS) was used to determine the percentage of cells with insertions / deletions (indels).

[0041] Figure 5 Editing efficiencies at the L-SH5, L-SH18, and L-SH20 genomic loci in HepG2 cells following LNP-mediated delivery of Cas9 mRNA and sgRNA and co-delivery of AAV-DJ containing the firefly luciferase (FLuc) coding sequence driven by the CMV promoter are shown. To assess editing efficiency, NGS was used to determine the percentage of cells with insertions / deletions (indels).

[0042] Figure 6 Shown is the FLuc signal in HepG2 cells after LNP-mediated delivery of Cas9 mRNA and sgRNA (targeting L-SH5, L-SH18 or L-SH20) and delivery of AAV-DJ carrying the FLuc coding sequence driven by the CMV promoter. Negative controls include untreated samples, AAV-DJ samples only (no integration), and samples where the sgRNA is a non-targeting sgRNA (no integration). After 23 passages, free AAV-DJ FLuc was diluted, and only the integrated AAV-DJ in the safe harbor remained.

[0043] Figure 7Editing efficiencies at the L-SH5, L-SH18, and L-SH20 genomic loci in primary human hepatocytes following delivery of AAV-DJ carrying the FLuc coding sequence driven by the CMV promoter and 1 μg / mL of LNPs containing Cas9 mRNA and sgRNA are shown. To assess editing efficiency, NGS was used to determine the percentage of cells with insertions / deletions (indels).

[0044] Figure 8 Shown in 10 3 , 10 4 or 10 5 Figure 2. FLuc signal in primary human hepatocytes after delivery of 1 μg / mL of LNPs containing Cas9 mRNA and sgRNA (targeting L-SH5, L-SH18, or L-SH20) and AAV-DJ carrying the FLuc coding sequence driven by the CMV promoter at a multiplicity of infection (MOI) of 1 μg / mL. Samples in which the sgRNA was a non-targeting sgRNA were used as controls. FLuc signal was evaluated 72 hours after delivery of CRISPR / Cas9 and FLuc nucleic acid constructs.

[0045] Fig. 9 Schematic diagram showing testing of sgRNAs targeting L-SH5, L-SH18, and L-SH20 for CRISPR / Cas9-mediated insertion of the CMV-FLuc donor in a humanized liver mouse model.

[0046] Fig.10 Shown is a CMV promoter-driven transgene (FLuc) inserted into human primary hepatocytes using an AAV-DJ vector.

[0047] Fig.11 Schematic representation of the safety profile of testing targeting potential safe harbor loci in a humanized liver mouse model is shown.

[0048] Fig.12 Shown are levels of human albumin (hAlb) detected by serum ELISA from immunodeficient FRG mice 25 weeks after implantation of primary human hepatocytes.

[0049] Fig.13 Long-term expression of FLuc in a humanized liver mouse model is shown. IVIS imaging was performed to determine FLuc expression in FRG mice 12 months after implantation of primary human hepatocytes. Nucleic acid constructs used to insert the FLuc transgene into potential safe harbor loci L-SH5, L-SH18, and L-SH20 were delivered to primary human hepatocytes using AAV-DJ vectors. Images were rearranged based on IVIS analysis.

[0050] Figure 14A-14EThe safety of targeting the safe harbor loci L-SH5, L-SH18, and L-SH20 in a humanized liver mouse model was shown. No significant liver enzyme dysregulation was observed in the serum of immunodeficient FRG mice after implantation of primary human hepatocytes. Liver marker ALT ( Fig.14A )、AST( Fig. 14B ) and ALP( Fig. 14C ) were consistent between treatment groups. Fig.14D ) decreased. Body weight remained consistent between treatment groups ( Fig.14E ).

[0051] Fig.15 Liver tissue of humanized liver mice stained for H&E, human FAH, human ASGR1, and Ki67 is shown. No significant staining was observed for H&E or Ki67 (a marker for liver proliferation), indicating no tumorigenesis or active oncogenic transformation. Staining for human FAH and human ASGR1 indicates a high degree of humanization of the mouse liver.

[0052] Fig.16 Shown is an alignment block between the human chromosome region containing the human safe harbor locus L-SH5 (indicated by arrows) and the corresponding mouse chromosome block with the same alignment order.

[0053] Fig.17 Shown is an alignment block between the human chromosome region containing the human safe harbor locus L-SH18 (indicated by arrows) and the corresponding mouse chromosome block with the same alignment order.

[0054] Fig.18 Shown is an alignment block between the human chromosome region containing the human safe harbor locus L-SH20 (indicated by arrows) and the corresponding mouse chromosome block with the same alignment order.

[0055] definition

[0056] The terms "protein", "polypeptide", and "peptide" used interchangeably herein include amino acids of any length in polymeric form, including coded amino acids and non-coded amino acids as well as chemically or biochemically modified amino acids or chemically or biochemically derivatized amino acids. These terms also include polymers that have been modified, such as polypeptides with modified peptide backbones. The term "domain" refers to any portion of a protein or polypeptide that has a specific function or structure.

[0057] Proteins are considered to have an "N-terminus" and a "C-terminus." The term "N-terminus" refers to the beginning of a protein or polypeptide, which terminates in an amino acid with a free amine group (-NH2). The term "C-terminus" refers to the end of an amino acid chain (protein or polypeptide), which terminates in a free carboxyl group (-COOH).

[0058] The terms "nucleic acid" and "polynucleotide", which are used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified forms thereof. These terms include single-stranded, double-stranded, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers containing purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derived nucleotide bases.

[0059] Nucleic acids are considered to have a "5' end" and a "3' end" because mononucleotides are reacted to form oligonucleotides in such a way that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its adjacent mononucleotide pentose ring in one direction via a phosphodiester bond. If the 5' phosphate of an oligonucleotide is not connected to the 3' oxygen of a mononucleotide pentose ring, then the end of the oligonucleotide is referred to as the "5' end". If the 3' oxygen of an oligonucleotide is not connected to the 5' phosphate of another mononucleotide pentose ring, then the end of the oligonucleotide is referred to as the "3' end". Even if a nucleic acid sequence is inside a larger oligonucleotide, the nucleic acid sequence can be considered to have a 5' end and a 3' end. In a linear or circular DNA molecule, a discrete element is referred to as "upstream" or 5' of the "downstream" or 3' element.

[0060] The term "genome-integrated" refers to a nucleic acid that has been introduced into a cell such that the nucleotide sequence is integrated into the genome of the cell. Any protocol can be used to stably incorporate a nucleic acid into the genome of a cell.

[0061] The term "viral vector" refers to a recombinant nucleic acid that contains at least one element of viral origin and contains elements sufficient or allowing packaging into viral vector particles. The vector and / or particle can be used for the purpose of transferring DNA, RNA or other nucleic acids into cells in vitro, ex vivo or in vivo. Various forms of viral vectors are known.

[0062] The term "isolated" with respect to cells, tissues (e.g., liver samples), proteins and nucleic acids includes cells, tissues (e.g., liver samples), proteins and nucleic acids that are relatively purified relative to other bacteria, viruses, cells or other components that may normally be present in situ, up to and including substantially pure preparations of cells, tissues (e.g., liver samples), proteins and nucleic acids. The term "isolated" also includes cells, tissues (e.g., liver samples), proteins and nucleic acids that do not have naturally occurring counterparts, have been chemically synthesized and are therefore substantially uncontaminated by other cells, tissues (e.g., liver samples), proteins and nucleic acids, or have been separated or purified from most other components (e.g., cellular components) with which they are naturally associated (e.g., other cellular proteins, polynucleotides or cellular components).

[0063] The term "wild-type" includes an entity having structure and / or activity as found in a normal (as compared to mutation, disease, alteration, etc.) state or condition. Wild-type genes and polypeptides typically exist in multiple different forms (eg, alleles).

[0064] The term "endogenous sequence" refers to a nucleic acid sequence naturally present in a cell or animal body. For example, the endogenous Rosa26 sequence of a human refers to a natural Rosa26 sequence naturally present at the Rosa26 locus in a human.

[0065] "Exogenous" molecules or sequences include molecules or sequences that are not usually present in the cell in the form described. Normal presence includes the presence of a specific developmental stage and environmental conditions of the cell. For example, an exogenous molecule or sequence may include a mutant form of a corresponding endogenous sequence in the cell (such as a humanized form of an endogenous sequence), or may include a sequence that corresponds to an endogenous sequence in the cell but is in a different form (i.e., not in a chromosome). In contrast, an endogenous molecule or sequence includes a molecule or sequence that is usually present in the form described in a specific cell at a specific developmental stage under specific environmental conditions.

[0066] When used in the context of a nucleic acid or protein, the term "heterologous" indicates that the nucleic acid or protein comprises at least two segments that are not naturally present together in the same molecule. For example, when used with respect to a nucleic acid segment or a protein segment, the term "heterologous" indicates that the nucleic acid or protein comprises two or more subsequences that are not found in the same relationship (e.g., linked together) to each other in nature. As an example, a "heterologous" region of a nucleic acid vector is a nucleic acid segment that is not found in nature in association with another nucleic acid molecule or attached to it. For example, a heterologous region of a nucleic acid vector may comprise a coding sequence flanked by a sequence that is not found in nature in association with a coding sequence. Similarly, a "heterologous" region of a protein is an amino acid segment that is not found in nature in association with another peptide molecule (e.g., a fusion protein or a protein with a tag) or attached to it. Similarly, a nucleic acid or protein may comprise a heterologous marker or a heterologous secretion or localization sequence.

[0067] "Codon optimization" (i.e., "codon-optimized" sequences) takes advantage of the degeneracy of codons, as demonstrated by the diversity of three-base pair codon combinations for a specified amino acid, and generally includes the process of modifying a nucleic acid sequence to enhance expression in a particular host cell by replacing at least one codon of the native sequence with a codon that is more frequently or most frequently used in the genes of the host cell while maintaining the native amino acid sequence. For example, a nucleic acid encoding a polypeptide of interest can be modified to replace codons that have a higher frequency of usage in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, or any other host cell, compared to the naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example at "codon usage databases". These tables can be modified in a variety of ways. See Nakamura et al., (2000) Nucleic Acids Res. 28(1):292, which is incorporated herein by reference in its entirety for all purposes. Computer algorithms are also available for codon optimization of a specific sequence for expression in a specific host (see, e.g., Gene Forge).

[0068] The term "locus" refers to a specific location of a gene (or significant sequence), a DNA sequence, a polypeptide coding sequence, or a location on a chromosome of a genome of an organism. For example, a "Rosa26 locus" may refer to a Rosa26 gene, a specific location of a Rosa26 DNA sequence, or a location of Rosa26 on a chromosome of a genome of an organism, which location has been identified as a location where such a sequence resides. A "Rosa26 locus" may include regulatory elements of a Rosa26 gene, including, for example, an enhancer, a promoter, a 5' and / or 3' untranslated region (UTR), or a combination thereof.

[0069] The term "gene" refers to a DNA sequence in a chromosome that, if naturally present, may contain at least one coding region and at least one non-coding region. The DNA sequence encoding a product (e.g., but not limited to, an RNA product and / or a polypeptide product) in a chromosome may include a coding region interrupted by a non-coding intron and a sequence (including 5' and 3' non-translated sequences) located adjacent to the coding region at both the 5' and 3' ends so that the gene corresponds to a full-length mRNA. In addition, other non-coding sequences including regulatory sequences (e.g., but not limited to, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences, and matrix attachment regions may be present in a gene. These sequences may be close to the coding region of a gene (e.g., but not limited to, within 10 kb) or located at a distant site, and these sequences may affect the transcription and translation levels or rates of the gene.

[0070] The term "allele" refers to a variant form of a gene. Some genes have multiple different forms that are located at the same position or genetic locus on a chromosome. Diploid organisms have two alleles at each locus. Each pair of alleles represents the genotype of a specific locus. If there are two identical alleles at a specific locus, the genotype is described as homozygous, and if the two alleles are different, the genotype is described as heterozygous.

[0071] "Promoter" is a regulatory region of DNA, which generally comprises a TATA box capable of guiding RNA polymerase II to initiate RNA synthesis at an appropriate transcription start site of a specific polynucleotide sequence. The promoter may also comprise other regions that affect the transcription initiation rate. The promoter sequence disclosed herein regulates the transcription of an operably linked polynucleotide. The promoter may be active in one or more cell types (e.g., human cells, human liver cells, or human liver hepatocytes) in the cell types disclosed herein. The promoter may be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a time-limited promoter (e.g., a promoter regulated by development) or a spatially limited promoter (e.g., a cell-specific or tissue-specific promoter). Examples of promoters may be present in, for example, WO 2013 / 176772, which is incorporated herein by reference in its entirety for all purposes.

[0072] "Operable linkage" or "operably linked" includes the juxtaposition of two or more components (e.g., a promoter and another sequence element) so that both components function normally and allow at least one component to mediate a function imposed on at least one other component. For example, a promoter can be operably linked to a coding sequence if it controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. Operable linkage can include such sequences that are adjacent to each other or act in trans (e.g., a regulatory sequence can act at a distance to control the transcription of a coding sequence).

[0073] The methods and compositions provided herein employ a variety of different components. Some components throughout the specification may have active variants and fragments. The term "functional" refers to the innate ability of a protein or nucleic acid (or its fragment or variant) to exhibit biological activity or function. Compared to the original molecule, the biological function of a functional fragment or variant may be the same or may actually be changed (e.g., with respect to its specificity or selectivity or efficacy) but retain the basic biological function of the molecule.

[0074] The term "variant" refers to a nucleotide sequence that differs from the most prevalent sequence in a population (eg, by one nucleotide) or a protein sequence that differs from the most prevalent sequence in a population (eg, by one amino acid).

[0075] When referring to protein, the term "fragment" means a protein shorter than the full-length protein or with fewer amino acids. When referring to nucleic acids, the term "fragment" means a nucleic acid shorter than the full-length nucleic acid or with fewer nucleotides. When referring to protein fragments, fragments can be, for example, N-terminal fragments (i.e., removing a part of the C-terminal of the protein), C-terminal fragments (i.e., removing a part of the N-terminal of the protein) or internal fragments (i.e., removing a part of each of the N-terminal and C-terminal of the protein). When referring to nucleic acid fragments, fragments can be, for example, 5' fragments (i.e., removing a part of the 3' end of the nucleic acid), 3' fragments (i.e., removing a part of the 5' end of the nucleic acid) or internal fragments (i.e., removing a part of each of the 5' end and 3' end of the nucleic acid).

[0076] In the context of two polynucleotides or polypeptide sequences, "sequence identity" or "identity" refers to the same residues in two sequences when compared for maximum correspondence in a specified comparison window. When the sequence identity percentage is used relative to a protein, the non-identical residue positions are usually different due to conservative amino acid substitutions, in which the amino acid residues are replaced by other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity), and therefore the functional properties of the molecule are not changed. When the conservative substitutions of the sequence are different, the sequence identity percentage can be adjusted upward to correct the conservative nature of the substitution. Sequences that differ due to such conservative substitutions are considered to have "sequence similarity" or "similarity". The means for making such adjustments are well known. Typically, this involves counting conservative substitutions as partial mismatches rather than complete mismatches, thereby increasing the percentage sequence identity. Therefore, for example, when the obtained score of the same amino acid is 1 and the obtained score of the non-conservative substitution is zero, the obtained score of the conservative substitution is between zero and 1. For example, the score of the conservative substitution is calculated, as implemented in the program PC / GENE (Intelligenetics, Mountain View, California).

[0077] "Percentage of sequence identity" includes the value determined by comparing two optimally aligned sequences in a comparison window (the maximum number of fully matched residues), wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) compared to the reference sequence (not including additions or deletions) to achieve optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base or amino acid residue appears in the two sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Unless otherwise specified (e.g., the shorter sequence comprises a linked heterologous sequence), the comparison window is the full length of the shorter of the two compared sequences.

[0078] Unless otherwise indicated, sequence identity / similarity values ​​include values ​​obtained using GAP version 10 using the following parameters: nucleotide sequence identity % and similarity % using a GAP weight of 50 and a length weight of 3 and the nwsgapdna.cmp scoring matrix; amino acid sequence identity % and similarity % using a GAP weight of 8 and a length weight of 2 and the BLOSUM62 scoring matrix; or any equivalent programs thereof. "Equivalent programs" include any sequence comparison program that generates an alignment with identical nucleotide or amino acid residue matches and identical percent sequence identity for any two sequences in question when compared to the corresponding alignment generated by GAP version 10.

[0079] The term "conservative amino acid substitution" refers to replacing an amino acid normally present in a sequence with a different amino acid having a similar size, charge or polarity. Examples of conservative substitutions include replacing another non-polar residue with a non-polar (hydrophobic) residue (such as isoleucine, valine or leucine). Similarly, examples of conservative substitutions include replacing another polar residue with a polar (hydrophilic) residue, such as a polar residue between arginine and lysine, a polar residue between glutamine and asparagine, or a polar residue between glycine and serine. In addition, replacing another basic residue with a basic residue (such as lysine, arginine or histidine) or replacing another acidic residue with an acidic residue (such as aspartic acid or glutamic acid) is an additional example of conservative substitution. Examples of non-conservative substitutions include replacing a polar (hydrophilic) residue (such as cysteine, glutamine, glutamic acid or lysine) with a non-polar (hydrophobic) amino acid residue (such as isoleucine, valine, leucine, alanine or methionine) and / or replacing a non-polar residue with a polar residue. Typical amino acid classifications are summarized below.

[0080] Table 1. Amino acid classification .

[0081]

[0082] "Homologous" sequences (e.g., nucleic acid sequences) include sequences that are identical or substantially similar to a known reference sequence, such that they are, for example, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to a known reference sequence. Homologous sequences can include, for example, orthologous sequences and paralogous sequences. For example, homologous genes are usually produced from a common ancestral DNA sequence by speciation events (orthologous genes) or genetic duplication events (paralogous genes). "Orthologous" genes include genes in different species that evolved from a common ancestor by speciation. Orthologs usually retain the same function during evolution. "Paralogous" genes include genes associated with replication within the genome. Paralogs can evolve new functions during evolution.

[0083] The term "in vitro" includes artificial environments and processes or reactions that occur within artificial environments (e.g., test tubes or isolated cells or cell lines). The term "in vivo" includes natural environments (e.g., cells, organisms, or the body) and processes or reactions that occur within natural environments. The term "ex vivo" includes cells that have been removed from an individual's body and processes or reactions that occur within such cells.

[0084] A composition or method that “comprises” or “includes” one or more of the recited elements may include other elements not specifically recited. For example, a composition that “comprises” or “includes” a protein may contain the protein alone or in combination with other ingredients. The transition phrase “consisting essentially of” means that the scope of the claim should be interpreted to encompass the specified elements recited in the claim as well as those elements that do not materially affect the basic and novel characteristics of the claimed invention. Therefore, when used in the claims of the present invention, the term “consisting essentially of” should not be interpreted as being equivalent to “comprising.”

[0085] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur and that the description includes instances where said event or circumstance occurs and instances where it does not occur.

[0086] The designation of a numerical range includes all integers within or defining the range and all subranges defined by the integers within the range. For example, 5-10 nucleotides is understood to be 5, 6, 7, 8, 9 or 10 nucleotides, and 5%-10% is understood to include 5% and all possible values ​​up to 10%.

[0087] At least 17 nucleotides in a 20 nucleotide sequence are understood to include 17, 18, 19 or 20 nucleotides in the sequence provided, thereby providing an upper limit, even if an upper limit is not clearly provided as will be clearly understood. Similarly, at most 3 nucleotides will be understood to cover 0, 1, 2 or 3 nucleotides, thereby providing a lower limit, even if a lower limit is not clearly provided. When "at least", "at most" or other similar language modifies a number, it can be understood to modify each number in the series.

[0088] As used herein, "no more than" or "less than" is understood to mean the value adjacent to the phrase and any logically lower value or integer to zero that is reasonable from the context. For example, a duplex region of "no more than 2 nucleotide base pairs" has 2, 1, or 0 nucleotide base pairs. When "no more than" or "less than" is preceded by a series of numbers or ranges, it is understood that each number in the series or range is modified.

[0089] As used herein, it is understood that when the maximum amount of a value is represented by 100% (eg, 100% inhibition), the value is limited by the detection method. For example, 100% inhibition is understood to be inhibition to a level below the detection level of the assay.

[0090] Unless the context indicates otherwise, the term "about" encompasses values ​​of ±5% of the stated value. In certain embodiments, the term "about" should be understood to encompass variations or errors that are tolerated in the art, such as 2 standard deviations from the mean or the sensitivity of the method used to make the measurement, or a percentage of a value that is tolerated in the art, such as changes with age. When "about" is present before the first value in a series, it can be understood to modify each value in the series.

[0091] The term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items as well as the lack of a combination when interpreted in the alternative ("or").

[0092] The term "or" refers to any one member of a particular list and also includes any combination of members of that list.

[0093] As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a protein" or "at least one protein" may include a plurality of proteins, including mixtures thereof.

[0094] Statistically significant means p≤0.05.

[0095] In the event of a conflict between a sequence in this application and a designated accession number or position in an accession number, the sequence in this application controls. DETAILED DESCRIPTION

[0096] I. Overview

[0097] Current gene therapy methods rely on free expression of transgenes and / or insertion of specific genomic loci. Due to dilution or silencing, it has been shown that the free type method is limited to the liver. Integration in a specific locus allows for sustained expression of the transgene. However, the method remains to be proven to be effective and safe in the human environment. Typical genomic safe harbor loci in humans (such as AAVS1, CCR5, and Rosa26) are all intragenic and less explored than mouse genomic safe harbor loci. In addition, different tissues have different chromatin states for the defined loci, so typical genomic safe harbors can be silenced in some tissues. Typical genomic safe harbor loci in humans all have additional shortcomings. Methylation mechanisms can silence transgenes in the AAVS1 locus in some cell lineages, and knockout of CCR5 can lead to increased susceptibility to infection with West Nile virus and Japanese encephalitis, and the human Rosa26 locus is less explored than mouse orthologs. Therefore, tissue-specific genomic safe harbor loci are needed.

[0098] Provided are compositions and methods for inserting nucleic acids encoding products of interest into genomic safe harbor loci in cells, cell colonies, or subjects (e.g., subjects in need) or for expressing nucleic acids encoding products of interest by genomic safe harbor loci in cells, cell colonies, or subjects (e.g., subjects in need). Also provided are cells or cell colonies or subjects comprising nucleic acid constructs comprising the coding sequence of the product of interest inserted into the genomic safe harbor loci. Also provided herein are methods for identifying genomic safe harbor loci (e.g., extragenic genomic safe harbor loci) for specific cells or tissue types.

[0099] II. Methods for inserting nucleic acid constructs into genomic safe harbor loci and for expressing nucleic acid constructs from genes in cells and subjects Composition of sgRNA safe harbor loci expressing the product of interest

[0100] Provided herein are nucleic acid constructs and compositions that allow the coding sequence of a product of interest to be inserted into a genomic safe harbor locus and / or to be expressed by a genomic safe harbor locus. Nucleic acid constructs and compositions can be used in methods for being integrated into a genomic safe harbor locus and / or expressed by a genomic safe harbor locus in a cell or subject. Also provided are nuclease agents (e.g., targeting genomic safe harbor locus) or nucleic acids encoding nuclease agents to promote the integration of nucleic acid constructs into genomic safe harbor locus. Also provided are nuclease agents near or inside the targeting genomic safe harbor locus or nucleic acids encoding nuclease agents to promote the integration of nucleic acid constructs into genomic safe harbor locus.

[0101] A. Genomic Safe Harbor Loci Methods for Identifying Genomic Safe Harbor Loci

[0102] Interactions between integrated exogenous DNA and the host genome can limit the reliability and safety of integration and may result in apparent phenotypic effects that are not due to targeted gene modification but rather to unintended effects of integration on surrounding endogenous genes. For example, randomly inserted transgenes may be subject to position effects and silencing, making their expression unreliable and unpredictable. Similarly, integration of exogenous DNA into chromosomal loci can affect surrounding endogenous genes and chromatin, thereby altering cellular behavior and phenotype.

[0103] The target genome locus used herein can be a genome safe harbor locus. The genome safe harbor locus includes a chromosomal locus, in which a transgenic or other exogenous nucleic acid insert can be stably and reliably expressed in a tissue of interest without significantly changing cell behavior or phenotype (i.e., without any harmful effects on the host cell). For example, a genome safe harbor locus can be a locus in which the expression of an inserted gene sequence is not disturbed by any read-through expression from an adjacent gene. For example, a genome safe harbor locus can include a chromosomal locus, in which exogenous DNA can be integrated and play a role in a predictable manner without adversely affecting endogenous gene structure or expression. The genome safe harbor locus can be efficiently targeted, and the safe harbor locus can be broken without an obvious phenotype. The genome safe harbor locus can include a gene ectoregion or a gene intermolecular region, such as a locus in a gene that is not essential, dispensable, or can be broken without an obvious phenotypic result.

[0104] The genomic safe harbor locus described herein can be a genomic locus that does not cause functional changes in the liver when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause alanine aminotransferase (alanine transaminase or ALT) level changes when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause aspartate aminotransferase (AST) level changes when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause alkaline phosphatase (ALP) level changes when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause weight changes when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause proliferation (such as in a target organ such as the liver) changes (e.g., as assessed by Ki67 staining) when targeted integration into a subject. A genomic safe harbor locus described herein can be a genomic locus that does not cause oncogenic transformation (such as in a target organ such as the liver) (e.g., as assessed by H&E staining) when targeted for integration into a subject.

[0105] The genomic safe harbor locus described herein can be a genomic locus with an open chromatin configuration in the liver, so that the exogenous nucleic acid insert can be stably and reliably expressed in the liver. Alternatively, the genomic safe harbor locus can be a genomic locus with an open chromatin configuration in another tissue or cell type (e.g., hematopoietic cells, such as hematopoietic stem cells, T cells, B cells and / or macrophages), so that the exogenous nucleic acid insert can be stably and reliably expressed in the tissue or cell type.

[0106] The genomic safe harbor loci described herein can be extragenic genomic safe harbor loci (ie, occurring outside a gene). In a specific example, the genomic safe harbor loci described herein are extragenic genomic safe harbor loci with an open chromatin configuration in the liver.

[0107] In a specific example, a genomic safe harbor locus can be a locus that is more than 300 kb from any cancer-related gene (e.g., to prevent insertional tumorigenesis), more than 300 kb from any miRNA or small RNA (e.g., to maintain regulation of gene expression and cell development), more than 50 kb from the 5' end of any gene (e.g., to avoid interfering with endogenous gene expression), more than 50 kb from any replication origin, more than 50 kb from any ultra-conserved element (e.g., a non-coding intragenic or intergenic region that is completely conserved in the human, mouse, and rat genomes), outside a copy number variable region, and in open chromatin (as determined, for example, by ATAC-Seq analysis (e.g., in a human liver biopsy sample)). In addition, a genomic safe harbor locus can be a locus that does not overlap with a region predicted to be a regulatory region (e.g., H3K4me1, H3K27ac, and / or H3K4me3 marker), a heterochromatin region (e.g., an H3K9me3 marker), or a region involved in chromatin organization (e.g., a CTCF signal).

[0108] For example, a method for identifying a genomic safe harbor locus (e.g., an extragenic genomic safe harbor locus) may include: (a) identifying accessible genomic loci (i.e., chromatin sites) in a tissue or cell type of interest (e.g., relying on an ATAC-Seq dataset); (b) filtering out the loci identified in step (a) based on safety criteria, functional silencing criteria, and / or structural accessibility criteria; and (c) filtering out the loci identified in step (b) based on gRNA availability, efficacy (editing efficiency), and specificity (off-target analysis). Such methods may also include analyzing chromatin markers in the chromatin environment, thereby disqualifying from the analysis any potential safe harbors that fall into regions predicted to be regulatory regions (e.g., H3K4me1, H3K27ac, and / or H3K4me3), heterochromatin regions (e.g., H3K9me3), or regions involved in the three-dimensional organization of chromatin (e.g., CTCF signals).

[0109] Eukaryotic chromatin is tightly packed into nucleosome arrays, and each nucleosome is composed of a histone octamer core wrapped around DNA and separated by a linker DNA. The nucleosome core is composed of histones, which can be post-translationally changed or replaced by histone variants by covalent modification. The positioning of nucleosomes in the entire genome has significant regulatory functions by changing the in vivo availability of binding sites for transcription factors and general transcription machinery and thus affecting DNA-dependent processes such as transcription, DNA repair, replication and recombination. Accessible genomic loci are open chromatin regions. Open chromatin regions are regions where nucleosomes are depleted, which can be bound by protein factors and can play various roles in DNA replication, nuclear organization and gene transcription. Step (a) may include, for example, using transposase-accessible chromatin assays (such as ATAC-Seq analysis) to identify accessible genomic loci. ATAC-Seq represents transposase-accessible chromatin assays with high-throughput sequencing. See, for example, Buenrostro et al., (2013) Nat. Methods 10 (12): 1213-1218 and Buenrostro et al., (2015) Curr. Protoc. Mol. Biol. 109: 21.29.1-21.29.9, each of which is incorporated herein by reference in its entirety for all purposes. The ATAC-Seq method relies on the construction of a next-generation sequencing (NGS) library using the ultra-high activity transposase Tn5. The NGS adapter is loaded onto the transposase, which allows simultaneous fragmentation of chromatin and integration of those adapters into open chromatin regions. The resulting library can be sequenced by NGS, and bioinformatics is used to analyze regions of the genome with open or accessible chromatin. As a first step, cells are harvested. After harvesting, the cells are lysed with a non-ionic detergent to obtain pure nuclei. The resulting chromatin is then fragmented and simultaneously labeled with sequencing adapters using the Tn5 transposase to produce an ATAC-Seq library. After purification, the library can be amplified by PCR using barcode primers. The resulting library can then be analyzed by qPCR or next-generation sequencing. ATAC-seq identifies accessible DNA regions by probing open chromatin with a hyperactive mutant Tn5 transposase, which inserts sequencing adapters into open regions of the genome. Although naturally occurring transposases have low levels of activity, ATAC-seq uses mutated hyperactive transposases. In a process called labeling, Tn5 transposase cuts double-stranded DNA and tags double-stranded DNA with sequencing adapters. The labeled DNA fragments are then purified, PCR amplified, and sequenced using next-generation sequencing. Then, sequencing reads can be used to infer regions with increased accessibility and to map regions of transcription factor binding sites and nucleosome positions. At single nucleotide resolution, the number of reads in a region is related to the openness of chromatin.

[0110] Step (a) may also include, for example, identifying accessible genomic loci using DNase I hypersensitive site sequencing (DNase-Seq). DNase-seq is a method for identifying the position of regulatory regions based on whole genome sequencing of regions sensitive to DNase I cutting. The method utilizes DNase I to selectively digest DNA depleted of nucleosomes, while DNA regions tightly wrapped in nucleosomes and higher order structures are more resistant. High throughput methods identify DNase I hypersensitive sites in the entire genome by capturing fragments digested by DNase and sequencing them by high throughput next generation sequencing.

[0111] In step (b), the safety criteria may include selecting the genomic locus only when the genomic locus is more than 300 kb from any cancer-related gene (e.g., to prevent insertional tumorigenesis), more than 300 kb from any miRNA or microRNA (e.g., to maintain regulation of gene expression and cell development), and / or more than 50 kb from the 5' end of any gene (e.g., to avoid interfering with endogenous gene expression). The functional silencing criteria may include selecting the genomic locus only when the genomic locus is more than 50 kb from any replication origin and / or more than 50 kb from any ultra-conserved element (e.g., in non-coding intragenic or intergenic regions that are completely conserved in human, mouse, and rat genomes). The structural accessibility criteria may include selecting the genomic locus only when the genomic locus is not in a copy number variable region.

[0112] In step (c), the locus can be filtered based on gRNA availability, efficacy (editing efficiency) and specificity (off-target analysis). gRNA availability means that there is a suitable target sequence for guide RNA in view of the need for PAM. Efficacy means the editing efficiency of gRNA in the tissue or cell type of interest. Any suitable editing efficiency threshold can be set. For example, if the editing efficiency is at least about 10%, at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19% or at least about 20%, then the locus or gRNA can be selected. In one example, gRNA efficacy is measured in primary cells (e.g., primary hepatocytes). In another example, gRNA efficacy is measured in tissues of interest in vivo. In a specific example, gRNA efficacy is measured in primary cells from multiple different donors (e.g., primary hepatocytes from multiple different donors (such as two or three different donors)). Any suitable gRNA specificity threshold can be used. For example, if there are no other sequences in the genome that completely match the guide RNA target sequence or have only one mismatch, then the guide RNA can be selected. In another example, if there are no other sequences in the genome that completely match the guide RNA target sequence or have only one or two mismatches, then the guide RNA can be selected.

[0113] Such methods may also include analyzing markers (e.g., signals or chromatin markers) in the chromatin environment, thereby eliminating from the analysis any potential safe harbors that fall into regions predicted to be regulatory regions (e.g., H3K4me1, H3K27ac, and / or H3K4me3), heterochromatin regions (e.g., H3K9me3), regions involved in chromatin organization (e.g., CTCF signals), or regions with transcriptional activity (e.g., H3K36me3, PolR2A, RNASeq- and RNASeq+). For example, ChIP-Seq data on transcription factor binding, genome-wide DNA methylation, promoter / enhancer features inferred from histone markers, and chromatin accessibility can be used. Post-translational modifications on histone tails are closely related to transcriptional states. For example, trimethylation of histone H3 lysine 4 (H3K4me3) marks active gene promoters. Monomethylation (H3K4me1) on lysine 4 of histone 3 is a marker that has been connected to an enhancer. Identifying regions that are enriched in H3K4me1 and depleted in H3K4me3 or regions that are enriched in both H3K4me1 and H3K27ac has proven to be a viable approach to discovering enhancers. H3K27ac is an activation marker that distinguishes active enhancers from those in the state of being primed. H3K9me3 marks regions that are subject to long-term repression. The main role of CTCF is thought to be regulating the 3D structure of chromatin. CTCF binds DNA strands together, thereby forming chromatin loops, and anchors DNA to cellular structures such as the nuclear lamina. It also defines the boundary between active DNA and heterochromatic DNA. Because the three-dimensional structure of DNA affects gene regulation, the activity of CTCF affects gene expression. CTCF is thought to be primarily responsible for insulator activity, which is a sequence that blocks the interaction between enhancers and promoters. CTCF binding has also been shown to promote and repress gene expression. It is not clear whether CTCF affects gene expression only through its looping activity, or whether it has some other unknown activity. H3K36me3 indicates the gene body, which experimentally indicates that no transcription unit is disturbed. PolR2A indicates transcriptional activity and is used to show that there are no transcripts from that region. RNASeq- indicates transcriptional activity on the negative strand of DNA, and RNASeq+ indicates transcriptional activity on the positive strand of DNA, and both are used to show that there are no transcripts from that region. RNA-Seq (RNA sequencing) is a sequencing technology that uses next-generation sequencing (NGS) to reveal the presence and amount of RNA in a biological sample. mRNA is extracted from the sample, fragmented and copied into stable ds-cDNA. The ds-cDNA is sequenced using a high-throughput, short-read sequencing method. These sequences can then be compared to a reference genome sequence to reconstruct the genomic region that is being transcribed.

[0114] In some embodiments, integration of a nucleic acid construct into a genomic safe harbor locus as described herein does not cause liver toxicity. In some embodiments, integration of a nucleic acid construct into a genomic safe harbor locus as described herein does not alter the expression of adjacent genes. In some embodiments, integration of a nucleic acid construct into a genomic safe harbor locus as described herein does not cause liver toxicity and does not alter the expression of adjacent genes.

[0115] In a specific example, the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537 (referred to herein as L-SH5) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate) or rodent (such as a rat or mouse); (ii) human chromosome 6, coordinates 170031084-170031382 (referred to herein as L- SH18) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse); and (iii) human chromosome 9, coordinates 25207412-25207703 (herein referred to as L-SH20) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). Throughout this application, the genomic coordinates of reference are based on the genomic annotations in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium, available on the website of the National Center for Biotechnology Information. Exemplary sequences of L-SH5, L-SH18, and L-SH20 based on the genomic annotation in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium are shown in SEQ ID NOs: 39, 40, and 41, respectively. Tools and methods for converting genomic coordinates between one assembly and another assembly are known in the art, and can be used to convert the genomic coordinates provided herein into corresponding coordinates in another assembly of the human genome, including conversion to earlier assemblies produced by the same institution or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversion of assemblies produced by different institutions or algorithms (e.g., from GRCh38 to NCBI33, produced by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, NCBI Genome RemappingService available at the National Center for Biotechnology Information website, UCSC LiftOver available at the UCSC Genome Brower website, and Assembly Converter available at the Ensembl.org website.

[0116] In one specific example, the genomic safe harbor locus is selected from the following genomic coordinates: (i) about 77460242 to about 77460537 on human chromosome 13 (corresponding to L-SH5) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate), or a rodent (such as a rat or mouse); (ii) about 170031084 to about 170031382 on human chromosome 6 (corresponding to L- (iii) about 25207412 to about 25207703 on human chromosome 9 (corresponding to L-SH20) or a corresponding region (e.g., orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). When referring to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above coordinates. When referring to genomic coordinates, the term "close to" means ± 5kb, ± 4kb, ± 3kb, ± 2kb, ± 1kb, ± 0.5kb, ± 0.4kb, ± 0.3kb, ± 0.2kb or ± 0.1kb.

[0117] In a specific example, the genomic safe harbor locus is human L-SH5 (chromosome 13, coordinates 77460242-77460537) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). For example, the genomic safe harbor locus may include a sequence shown in SEQ ID NO: 39 or a variant thereof, which is located at the same position or genetic locus on a human chromosome or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). Syntenic regions are derived from a single ancestral genomic region. For example, syntenic regions can come from different organisms and are derived from species formation.

[0118] In another specific example, the genomic safe harbor locus is human L-SH18 (chromosome 6, coordinates 170031084-170031382) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). For example, the genomic safe harbor locus may include a sequence shown in SEQ ID NO: 40 or a variant thereof, which is located at the same position or genetic locus on a human chromosome or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse).

[0119] In another specific example, the genomic safe harbor locus is human L-SH20 (chromosome 9, coordinates 25207412-25207703) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). For example, the genomic safe harbor locus may include a sequence shown in SEQ ID NO: 41 or a variant thereof, which is located at the same position or genetic locus on a human chromosome or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse).

[0120] In a specific example, the genomic safe harbor locus corresponds to human L-SH5 (coordinates from about 77460242 to about 77460537 on chromosome 13) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse) or a variant thereof, which is located at the same position or genetic locus on a human chromosome or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). When referring to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0121] In another specific example, the genomic safe harbor locus corresponds to human L-SH18 (coordinates from about 170031084 to about 170031382 on chromosome 6) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse) or a variant thereof, which is located at the same position or genetic locus on a human chromosome or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). When it comes to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0122] In another specific example, the genomic safe harbor locus corresponds to human L-SH20 (coordinates from about 25207412 to about 25207703 on chromosome 9) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse) or a variant thereof, which is located at the same position or genetic locus on a human chromosome or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). When referring to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0123] In a specific example, the genomic safe harbor locus is selected from the following genomic locations: (i) mouse chromosome 14, coordinates 103,450,397-103,451,396 (referred to herein as mouse L-SH5) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate), or rodent (such as rat); (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386 (referred to herein as (iii) mouse chromosome 4, coordinates 92,827,563-92,828,592 (herein referred to as mouse L-SH20) or a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat) in a corresponding region (e.g., an orthologous or syntenic region). Throughout this application, the genomic coordinates of reference are based on the genomic annotations in the GRCm38 (also referred to as mm10) assembly of the mouse genome from the Genome Reference Consortium, which can be obtained on the website of the National Center for Biotechnology Information. Exemplary sequences of L-SH5, L-SH18 and L-SH20 based on the genomic annotations in the GRCm38 (also referred to as mm10) assembly of the mouse genome from the Genome Reference Consortium are shown in SEQ ID NOs: 405, 406 and 407, respectively. The tools and methods for converting genomic coordinates between one assembly and another assembly are known in the art, and can be used to convert the genomic coordinates provided herein into corresponding coordinates in another assembly of the mouse genome, including conversion into earlier assemblies produced by the same mechanism or using the same algorithm, and conversion of assemblies produced by different mechanisms or algorithms. Available methods and tools known in the art include, but are not limited to, the NCBI Genome Remapping Service available at the National Center for Biotechnology Information website, the UCSC LiftOver available at the UCSC Genome Brower website, and the Assembly Converter available at the Ensembl.org website.

[0124] In one specific example, the genomic safe harbor locus is selected from the following genomic coordinates: (i) about 103,450,397 to about 103,451,396 on mouse chromosome 14 (corresponding to mouse L-SH5) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate), or rodent (such as rat); (ii) about 15,226,387 to about 15,227,386 on mouse chromosome 17 (corresponding to (e.g., mouse L-SH18) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat); and (iii) about 92,827,563 to about 92,828,592 on mouse chromosome 4 (corresponding to mouse L-SH20) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). When referring to genomic coordinates, the term "about" means ±20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above coordinates. When referring to genomic coordinates, the term "close to" means ±5kb, ±4kb, ±3kb, ±2kb, ±1kb, ±0.5kb, ±0.4kb, ±0.3kb, ±0.2kb or ±0.1kb.

[0125] In a specific example, the genomic safe harbor locus is a corresponding region (e.g., orthologous or syntenic region) in mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) or in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). For example, the genomic safe harbor locus may include a sequence shown in SEQ ID NO:405 or a variant thereof, which is located at the same position or genetic locus on the chromosome of a mouse or an orthologous or syntenic region in a human or non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). Syntenic regions are derived from a single ancestral genomic region. For example, syntenic regions can come from different organisms and are derived from species formation.

[0126] In another specific example, the genomic safe harbor locus is mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). For example, the genomic safe harbor locus may include a sequence shown in SEQ ID NO: 406 or a variant thereof, which is located at the same position or genetic locus on a chromosome of a mouse or an orthologous or syntenic region in a human or non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat).

[0127] In another specific example, the genomic safe harbor locus is mouse L-SH20 (chromosome 4, coordinates 92,827,563-92,828,592) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). For example, the genomic safe harbor locus may include a sequence shown in SEQ ID NO: 407 or a variant thereof, which is located at the same position or genetic locus on a chromosome of a mouse or an orthologous or syntenic region in a human or non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat).

[0128] In a specific example, the genomic safe harbor locus corresponds to mouse L-SH5 (coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat) or a variant thereof, which is located at the same position or genetic locus on the chromosome of the mouse or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). When it comes to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0129] In another specific example, the genomic safe harbor locus corresponds to mouse L-SH18 (coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat) or a variant thereof, which is located at the same position on the chromosome of the mouse or a genetic locus or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). When it comes to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0130] In another specific example, the genomic safe harbor locus corresponds to mouse L-SH20 (coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat) or a variant thereof, which is located at the same position or genetic locus on the chromosome of the mouse or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). When it comes to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0131] B. Nucleic Acid Constructs Encoding Products of Interest

[0132] Compositions and methods described herein include the use of nucleic acid constructs comprising a coding sequence of a product of interest (e.g., a polypeptide of interest) operably connected to a promoter. Such nucleic acid constructs can be used for insertion into a target genomic locus (e.g., a genomic safe harbor locus as described elsewhere herein) or into a cleavage site formed by a nuclease agent or CRISPR / Cas system as disclosed elsewhere herein. The term cleavage site includes a DNA sequence in which a nick or double-strand break is formed by a nuclease agent (e.g., a Cas9 protein compounded with a guide RNA). In some embodiments, a double-strand break is formed by a Cas9 protein compounded with a guide RNA, for example, a SpCas9 protein compounded with a SpCas9 guide RNA.

[0133] The length of nucleic acid construct disclosed herein can vary.Construct can be, for example, about 1kb to about 5kb, such as about 1kb to about 4.5kb or about 1kb to about 4kb.The length of exemplary nucleic acid construct is between about 1kb to about 5kb or between about 1kb to about 4kb.Alternatively, the length of nucleic acid construct can be between about 1kb to about 1.5kb, about 1.5kb to about 2kb, about 2kb to about 2.5kb, about 2.5kb to about 3kb, about 3kb to about 3.5kb, about 3.5kb to about 4kb, about 4kb to about 4.5kb or about 4.5kb to about 5kb.Alternatively, the length of nucleic acid construct can be, for example, no more than 5kb, no more than 4.5kb, no more than 4kb, no more than 3.5kb, no more than 3kb or no more than 2.5kb.

[0134] Constructs can include deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), can be single-stranded, double-stranded or partially single-stranded and partially double-stranded, and can be introduced into host cells in linear or circular (e.g., mini-circle) form. See, for example, US2010 / 0047805, US 2011 / 0281361, and US2011 / 0207221, each of which is incorporated herein by reference in its entirety for all purposes. If introduced in linear form, the ends of the constructs can be protected by known methods (e.g., from exonucleolytic degradation). For example, one or more dideoxynucleotide residues can be added to the 3' end of a linear molecule and / or a self-complementary oligonucleotide can be connected to one or both ends. See, for example, Chang et al., (1987) Proc. Natl. Acad. Sci. USA 84: 4959-4963 and Nehls et al., (1996) Science 272: 886-889, each of which is incorporated herein by reference in its entirety for all purposes. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, adding terminal amino groups and using modified internucleotide bonds, such as phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues. The construct can be introduced into the cell as part of a vector molecule having additional sequences, such as an origin of replication, a promoter, and genes encoding antibiotic resistance. The construct can omit viral elements. In addition, the construct can be introduced as a naked nucleic acid, can be introduced as a nucleic acid compounded with an agent such as a liposome or poloxamer, or can be delivered by a virus (e.g., adenovirus, adeno-associated virus (AAV), herpes virus, retrovirus, or lentivirus).

[0135] Constructs disclosed herein can be modified at one or both ends to include one or more suitable structural features and / or confer one or more functional beneficial effects as required. For example, structural modifications can vary according to the method for delivering constructs disclosed herein to host cells (e.g., using viral vectors for delivery or packaging into lipid nanoparticles for delivery). Such modifications include, for example, terminal structures such as inverted terminal repeats (ITRs), hairpins, rings, and other structures such as torus. For example, constructs disclosed herein can include one, two, or three ITRs, or can include no more than two ITRs. A variety of structural modification methods are known.

[0136] The construct comprises a promoter and / or enhancer for driving the expression of the product of interest, such as a constitutive promoter or an inducible or tissue-specific (e.g., liver-specific) promoter for driving the expression of the product of interest in a free body or when integrated. Non-limiting examples of constitutive promoters include cytomegalovirus immediate early promoter (CMV), simian virus (SV40) promoter, adenovirus major late (MLP) promoter, Rous sarcoma virus (RSV) promoter, mouse mammary tumor virus (MMTV) promoter, phosphoglycerate kinase (PGK) promoter, elongation factor alpha (EF1a) promoter, ubiquitin promoter, actin promoter, tubulin promoter, immunoglobulin promoter, their functional fragments or any combination of the foregoing substances. For example, the promoter can be a CMV promoter or a truncated CMV promoter. For another example, the promoter can be an EF1a promoter. Promoters suitable for liver may include, for example, albumin (ALB) promoter or transthyretin (TTR) promoter. Enhancers suitable for liver may include, for example, SERPINA1 enhancers. Non-limiting exemplary inducible promoters include those that can be induced by heat shock, light, chemicals, peptides, metals, steroids, antibiotics or alcohols. An inducible promoter can be a promoter with a low basal (non-induced) expression level, such as Promoter (Clontech).

[0137] In some examples, nucleic acid constructs work in the homology-independent insertion of nucleic acids encoding products of interest (e.g., polypeptides of interest). Such nucleic acid constructs can work in, for example, non-dividing cells (e.g., cells where non-homologous end joining (NHEJ), non-homologous recombination (HR) are the primary mechanisms for repairing double-stranded DNA breaks) or dividing cells (e.g., active dividing cells). Such constructs can be, for example, homology-independent donor constructs. In preferred embodiments, promoters and other regulatory sequences are suitable for people, such as recognized by regulatory factors in human cells (e.g., human liver cells), and are accepted by regulatory agencies for use in people.

[0138] Constructs disclosed herein may be modified to include or exclude any suitable structural features required for any particular purpose and / or to confer one or more desired functions. For example, some constructs disclosed herein do not include homology arms. Some constructs disclosed herein can be inserted into the cleavage site of the target genomic locus or the target DNA sequence of the nuclease agent by non-homologous end joining (for example, can be inserted into the genome safe harbor locus). For example, such constructs can be inserted into the flat-ended double-stranded break after cutting with a nuclease agent (such as CRISPR / Cas system, such as SpyCas9 CRISPR / Cas system) as disclosed herein. In a specific example, the construct can be delivered via AAV and can be inserted by non-homologous end joining (for example, the nucleic acid construct does not include homology arms).

[0139] In a specific example, the construct can be inserted via homology-independent targeted integration. For example, the nucleic acid construct or the product coding sequence of interest (e.g., a polypeptide coding sequence of interest) and the promoter in the construct can be flanked on each side by a target site of a nuclease agent (e.g., a target site identical to the target site for targeted insertion in the target DNA sequence (e.g., in a genomic safe harbor locus), and the same nuclease agent is used to cut the target DNA sequence for targeted insertion). The nuclease agent can then cut the flanking target site. In a specific example, the construct is delivered by AAV-mediated delivery, and the cutting of the flanking target site can remove the reverse terminal repeats (ITRs) of AAV. In some cases, if the product coding sequence of interest (e.g., a polypeptide coding sequence of interest) and the promoter are inserted into the cleavage site or target DNA sequence in one orientation, the target DNA sequence for targeted insertion (e.g., a target DNA sequence in a genomic safe harbor locus, such as a gRNA target sequence comprising flanking protospacer-adjacent motifs) no longer exists, but if the product coding sequence of interest (e.g., a polypeptide coding sequence of interest) and the promoter are inserted into the cleavage site or target DNA sequence in the opposite orientation, the target DNA sequence is reformed.

[0140] The construct disclosed herein may include a polyadenylation sequence or a polyadenylation tail sequence (e.g., located downstream or 3' of the product coding sequence of interest). The method of designing a suitable polyadenylation tail sequence is well known. The polyadenylation tail sequence can be encoded as a "poly-A" segment, for example, located downstream of the product coding sequence of interest. The poly-A tail can include, for example, at least 20, 30, 40, 50, 60, 70, 80, 90 or 100 adenines, and optionally up to 300 adenines. In a specific example, the poly-A tail can include 95, 96, 97, 98, 99 or 100 adenine nucleotides. The method of designing a suitable polyadenylation tail sequence and / or polyadenylation signal sequence is well known. For example, the polyadenylation signal sequence AAUAAA is commonly used in mammalian systems, but variants such as UAUAAA or AU / GUAAA have been identified. See, e.g., Proudfoot (2011) Genes & Dev. 25 (17): 1770-82, which is incorporated herein by reference in its entirety for all purposes. The term polyadenylation signal sequence refers to any sequence that directs transcription termination and adds a poly-A tail to an mRNA transcript. In eukaryotes, transcription terminators are recognized by protein factors, and polyadenylation is the process of adding a poly (A) tail to an mRNA transcript in the presence of a poly (A) polymerase. Mammalian poly (A) signals typically consist of a core sequence of about 45 nucleotides in length, which may be flanked by different auxiliary sequences for enhancing cleavage and polyadenylation efficiency. The core sequence consists of the following: an upstream element (AATAAA or AAUAAA) that is highly conserved in mRNA, which is called the poly A recognition motif or poly A recognition sequence, which is recognized by the cleavage and polyadenylation specific factor (CPSF); and a poorly defined downstream region (enriched in Us or Gs and Us) that is constrained by the cleavage stimulating factor (CstF). Examples of transcription terminators that can be used include, for example, human growth hormone (HGH) polyadenylation signal, simian virus 40 (SV40) late polyadenylation signal, rabbit β-globin polyadenylation signal, bovine growth hormone (BGH) polyadenylation signal, phosphoglycerate kinase (PGK) polyadenylation signal, AOX1 transcription termination sequence, CYC1 transcription termination sequence, or any transcription termination sequence known to be suitable for regulating gene expression in eukaryotic cells. In one example, the polyadenylation signal is the simian virus 40 (SV40) late polyadenylation signal. In another example, the polyadenylation signal is a bovine growth hormone (BGH) polyadenylation signal.

[0141] (1) Products of interest and peptides of interest

[0142] Any product of interest can be encoded by the nucleic acid construct disclosed herein. For example, the product of interest can be a therapeutic product of interest, such as a therapeutic RNA or a therapeutic polypeptide.

[0143] In one example, the product of interest is an RNA of interest, such as a miRNA, an antisense oligonucleotide, an RNAi agent, or a guide RNA for a CRISPR / Cas system. For example, the RNA of interest can be a therapeutic RNA.

[0144] "RNAi agent" is a composition comprising a small double-stranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can promote the degradation or inhibition of the translation of target RNAs such as messenger RNA (mRNA) in a sequence-specific manner. The oligonucleotide in the RNAi agent is a polymer of linked nucleosides, each of which can be independently modified or unmodified. The RNAi agent works through an RNA interference mechanism (i.e., by interacting with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) of mammalian cells to induce RNA interference). Although the term RNAi agent as used herein is considered to work primarily through an RNA interference mechanism, the disclosed RNAi agent is not subject to the constraints or limitations of any particular pathway or mechanism of action. The RNAi agent disclosed herein includes a sense strand and an antisense strand, and includes but is not limited to short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA) and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to a sequence (ie, consecutive or ordered nucleobases or nucleotides, described by consecutive letters using standard nomenclature) in a target RNA.

[0145] Single-stranded ASO and RNA interference (RNAi) share the basic principle that oligonucleotides bind to target RNA through Watson-Crick base pairing. Without wishing to be bound by theory, during RNAi, small RNA duplexes (RNAi agents) are associated with RNA-induced silencing complexes (RISC), one strand (follower strand) is lost, and the remaining strand (guide strand) cooperates with RISC to bind complementary RNA. Then, the catalytic component of RISC, Argonaute 2 (Ago2), cuts the target RNA. The guide strand is always associated with a complementary sense strand or protein (RISC). In contrast, ASOs must survive and function as single strands. ASOs bind to target RNA and block ribosomes or other factors such as splicing factors from binding to RNA or recruiting proteins such as nucleases. Different modifications and target regions are selected for ASOs according to the desired mechanism of action. Gapmer is an ASO oligonucleotide containing 2-5 chemically modified nucleotides (e.g., LNA or 2'-MOE) flanking the central 8-10 base vacancies of DNA at each end. After binding to the target RNA, the DNA-RNA hybrid acts as a substrate for RNase H.

[0146] In another example, the product of interest is a polypeptide of interest. In one example, the polypeptide of interest is a therapeutic polypeptide. For example, a therapeutic polypeptide can be a polypeptide that is absent or deficient in a subject. In one example, the polypeptide of interest is an enzyme.

[0147] In one example, the polypeptide of interest is an antibody or an antigen binding protein. In another example, the polypeptide of interest is an exogenous T cell receptor or a chimeric antigen receptor (CAR). In another example, the polypeptide of interest is a Cas protein (e.g., Cas9) for a CRISPR / Cas system.

[0148] As disclosed herein, "antigen binding proteins" include any protein that binds to an antigen. Examples of antigen binding proteins include antibodies, antigen-binding fragments of antibodies, multispecific antibodies (e.g., bispecific antibodies), scFv, bi-scFv, diabodies, triabodies, tetrabodies, V-NARs, VHHs, VLs, F(ab), F(ab)2, DVD (dual variable domain antigen binding protein), SVD (single variable domain antigen binding protein), bispecific T cell engager (BiTE) or Davisbody (U.S. Pat. No. 8,586,713, which is incorporated herein by reference in its entirety for all purposes).

[0149] The term "antibody" includes immunoglobulin molecules comprising four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain includes a heavy chain variable domain and a heavy chain constant region (C HThe heavy chain constant region consists of three domains: C H 1. C H 2 and C H 3. Each light chain includes a light chain variable domain and a light chain constant region (C L ). The heavy and light chain variable domains can be further subdivided into hypervariable regions called complementarity determining regions (CDRs) interspersed with more conserved regions called framework regions (FRs). Each heavy and light chain variable domain includes three CDRs and four FRs, which are arranged in the following order from amino terminus to carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (heavy chain CDRs can be abbreviated as HCDR1, HCDR2, and HCDR3; light chain CDRs can be abbreviated as LCDR1, LCDR2, and LCDR3). The term "high affinity" antibody refers to an antibody that has a high affinity for its target epitope K. D About 10 -9 M or less (e.g., about 1×10 -9 M, 1×10 -10 M, 1×10 -11 M or about 1×10 -12 In one embodiment, K D By surface plasmon resonance, such as BIACORE TM to measure; in another embodiment, K D Measured by ELISA.

[0150] Antigen binding proteins or antibodies can be, for example, neutralizing antigen binding proteins or antibodies or broadly neutralizing antigen binding proteins or antibodies. Neutralizing antibodies are antibodies that protect cells from antigens or infectious bodies by neutralizing the biological effects of cells. Broadly neutralizing antibodies (bNAbs) can affect multiple strains of specific bacteria or viruses. For example, broadly neutralizing antibodies can focus on conservative functional targets, thereby stimulating vulnerable sites on conservative bacterial or viral proteins (e.g., vulnerable sites on influenza virus protein hemagglutinin). Antibodies produced by the immune system after infection or vaccination tend to focus on easily accessible loops on the surface of bacteria or viruses, which generally have large sequence and conformational variability. There are two reasons for this problem: bacterial or viral populations can quickly evade these antibodies, and these antibodies can stimulate parts of proteins that are not important for function. Broadly neutralizing antibodies—called "broad" because they stimulate many strains of bacteria or viruses, and "neutralization" because they stimulate key functional sites of bacteria or viruses and prevent infection—can overcome these problems. Unfortunately, however, these antibodies usually appear too late to provide effective disease protection.

[0151] The antigen binding proteins disclosed herein can target any antigen. The term "antigen" refers to a substance, whether a whole molecule or a domain within a molecule, that is capable of eliciting the production of antibodies with binding specificity to the substance. The term antigen also encompasses substances that do not elicit antibody production by self-recognition in wild-type host organisms but can elicit such a response in host animals to break immune tolerance through appropriate genetic engineering.

[0152] As an example, the targeted antigen can be a disease-associated antigen. The term "disease-associated antigen" refers to an antigen whose presence is associated with the occurrence or progression of a specific disease. For example, an antigen can be in a disease-associated protein (i.e., a protein whose expression is associated with the occurrence or progression of a disease). Optionally, a disease-associated protein can be a protein that is expressed in a specific type of disease but is not usually expressed in healthy adult tissues (i.e., a protein with disease-specific expression or disease-restricted expression). However, a disease-associated protein does not necessarily have disease-specific or disease-restricted expression.

[0153] As an example, a disease-associated antigen can be a cancer-associated antigen. The term "cancer-associated antigen" refers to an antigen that is present in the occurrence or progression of one or more cancers. For example, an antigen can be in a cancer-associated protein (i.e., a protein that is expressed in the occurrence or progression of one or more cancers). For example, a cancer-associated protein can be an oncoprotein (i.e., a protein with an activity that may contribute to cancer progression, such as a protein that regulates cell growth), or it can be a tumor suppressor protein (i.e., a protein that is commonly used to reduce the possibility of cancer formation, such as by negative regulation of the cell cycle or by promoting apoptosis). Optionally, a cancer-associated protein can be a protein that is expressed in a specific type of cancer but is not usually expressed in healthy adult tissues (i.e., a protein with cancer-specific expression, cancer-restricted expression, tumor-specific expression, or tumor-restricted expression). However, a cancer-associated protein does not have to have cancer-specific, cancer-restricted, tumor-specific, or tumor-restricted expression. An example of a protein that is considered to have cancer-specific or cancer-restricted is a cancer-testis antigen or a carcinoembryonic antigen. Cancer-testis antigens (CTAs) are a large family of tumor-associated antigens that are expressed in human tumors of different histological origins but not in normal tissues other than male germ cells. In cancer, these developmental antigens can be re-expressed and can serve as immune activation loci. Oncofetal antigens (OFAs) are proteins that are normally present only during fetal development but are found in adults with certain types of cancer.

[0154] As another example, a disease-associated antigen can be an infectious disease-associated antigen. The term "infectious disease-associated antigen" refers to an antigen whose presence is associated with the occurrence or progression of a specific infectious disease. For example, an antigen can be in an infectious disease-associated protein (i.e., a protein whose expression is associated with the occurrence or progression of an infectious disease). Optionally, an infectious disease-associated protein can be a protein (i.e., a protein with infectious disease-specific expression or infectious disease-restricted expression) that is expressed in a specific type of infectious disease but is not usually expressed in healthy adult tissues. However, infectious disease-associated proteins do not necessarily have infectious disease-specific or infectious disease-restricted expression. For example, an antigen can be a viral antigen or a bacterial antigen. Such antigens include, for example, a molecular structure on the surface of a virus or bacterium (e.g., a viral protein or a bacterial protein) that is recognized by the immune system and can trigger an immune response.

[0155] The term "epitope" refers to a site on an antigen that is bound to an antigen-binding protein (e.g., an antibody). An epitope can be formed by continuous amino acids or by non-continuous amino acids juxtaposed by the tertiary folding of one or more proteins. An epitope formed by continuous amino acids (also referred to as a linear epitope) is usually retained when exposed to a denaturing solvent, while an epitope formed by the tertiary folding (also referred to as a conformational epitope) is usually lost when treated with a denaturing solvent. In a unique spatial conformation, an epitope typically comprises at least 3 (and more commonly, at least 5 or 8-10) amino acids. Methods for determining the spatial conformation of an epitope include, for example, X-ray crystallography and 2-dimensional nuclear magnetic resonance. See, for example, Epitope Mapping Protocols (1996), edited by Glenn E. Morris, in Methods in Molecular Biology (Methods in Molecular Biology) Vol. 66, which is incorporated herein by reference as a whole for all purposes.

[0156] The term "heavy chain" or "immunoglobulin heavy chain" includes immunoglobulin heavy chain sequences from any organism, including immunoglobulin heavy chain constant region sequences. Unless otherwise specified, the heavy chain variable domain includes three heavy chain CDRs and four FR regions. Fragments of a heavy chain include CDRs, CDRs and FRs, and combinations thereof. A typical heavy chain has CDRs after the variable domain (from N-terminus to C-terminus). H 1 domain, hinge, C H 2 domains and C H The functional fragment of the heavy chain comprises a domain that can specifically recognize an epitope (e.g., a domain with a K in the micromolar, nanomolar or picomolar range). D The heavy chain variable domain is encoded by a variable region nucleotide sequence, which generally includes a V domain derived from a germline. H , DH and J H Segment Library V H , D H and J H Segments. The sequences, locations, and nomenclature of the V, D, and J heavy chain segments of various organisms can be found in the IMGT database, which is accessible via the Internet on the World Wide Web (www) at the URL "imgt.org."

[0157] The term "light chain" includes immunoglobulin light chain sequences from any organism, and unless otherwise specified, includes human kappa (κ) and lambda (λ) light chains and VpreB, as well as alternative light chains. Unless otherwise specified, the light chain variable domain generally includes three light chain CDRs and four framework (FR) regions. Typically, the full-length light chain includes variable domains and light chain constant region amino acid sequences including FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 from amino-terminal to carboxyl-terminal. The light chain variable domain is encoded by a light chain variable region nucleotide sequence, which generally includes a light chain V derived from a light chain V and J gene segment library present in the germline. L and light chain J L Gene segments. The sequences, locations, and nomenclature of the light chain V and J gene segments of various organisms can be found in the IMGT database, which can be accessed via the Internet on the World Wide Web (www) at the URL "imgt.org." Light chains include, for example, those that do not selectively bind to a first epitope or a second epitope, which is selectively bound by an epitope-binding protein in which it is located. Light chains also include those that bind to and recognize or assist the heavy chain in binding to and recognizing one or more epitopes, which are selectively bound by an epitope-binding protein in which it is located.

[0158] As used herein, the term "complementarity determining region" or "CDR" comprises an amino acid sequence encoded by the nucleic acid sequence of an organism's immunoglobulin gene, which is usually (i.e., in wild-type animals) present between two framework regions in the light chain or heavy chain variable region of an immunoglobulin molecule (e.g., an antibody or a T cell receptor). CDR can be encoded by, for example, a germline sequence or a rearranged sequence and, for example, by an initial or mature B cell or T cell. CDR can be somatically mutated (e.g., different from the sequence encoded in the animal germline), humanized and / or modified with amino acid substitutions, additions or deletions. In some cases (e.g., for CDR3), CDR can be encoded by two or more sequences (e.g., germline sequences), which are discontinuous (e.g., in unrearranged nucleic acid sequences) but are continuous in B cell nucleic acid sequences, for example, due to splicing or connection sequences (e.g., VDJ recombination to form heavy chain CDR3).

[0159] The term "unrearranged" encompasses a state of the immunoglobulin locus in which the V gene segments and the J gene segments (and, for the heavy chain, the D gene segments) remain separate but are capable of joining to form a rearranged V(D)J gene comprising a single V, (D), J in the V(D)J repertoire. The term "rearranged" encompasses a configuration of a heavy or light chain immunoglobulin locus in which the V segments encode substantially the entire V(D)J repertoire, respectively. H or V L The domain is positioned adjacent to the DJ or J segment in the conformation.

[0160] The antigen binding protein can be a single-chain antigen binding protein, such as scFv. Alternatively, the antigen binding protein is not a single-chain antigen binding protein. For example, the antigen binding protein can include a separate light chain and a heavy chain. The heavy chain coding sequence can be located upstream of the light chain coding sequence, or the light chain coding sequence can be located upstream of the heavy chain coding sequence. In a specific example, the heavy chain coding sequence is located upstream of the light chain coding sequence. For example, the heavy chain coding sequence can include V H , D H and J H segment, and the light chain encoding sequence may include a light chain V L and light chain J L Gene segment. The antigen binding protein coding sequence can be operably linked to an exogenous promoter in the nucleic acid construct. Similarly, the antigen binding protein coding sequence in the nucleic acid construct can include an exogenous signal sequence for secretion. In a specific example, the antigen binding protein comprises a separate light chain and a heavy chain, and each chain is operably linked to a separate exogenous signal sequence.

[0161] The signal sequence (i.e., N-terminal signal sequence) mediates the targeting of nascent secretory proteins and membrane proteins to the endoplasmic reticulum (ER) in a signal recognition particle (SRP)-dependent manner. Typically, the signal sequence is co-translationally cut off to produce a signal peptide and a mature protein. Examples of exogenous signal sequences or signal peptides that can be used include, for example, signal sequences / peptides from mouse albumin, human albumin, mouse ROR1, human ROR1, human azurocidin, gray hamster (Cricetulus griseus) Igκ chain VIII region MOPC 63 analogs, and human Igκ chain VIII region VG. Any other known signal sequence / peptide may also be used. In a specific example, the ROR1 signal sequence is used.

[0162] One or more nucleic acids in the nucleic acid in the antigen binding protein coding sequence (e.g., heavy chain coding sequence and light chain coding sequence) can be together in a polycistronic expression construct. For example, the nucleic acid encoding the heavy chain and the light chain can be together in a bicistronic expression construct. The polycistronic expression vector simultaneously expresses two or more separate proteins from the same mRNA (i.e., transcripts produced by the same promoter). Suitable strategies for protein polycistronic expression include, for example, using 2A peptides and using internal ribosome entry sites (IRES). As an example, such polycistronic vectors can use one or more internal ribosome entry sites (IRES) to allow translation to be initiated from the internal region of the mRNA. As another example, such polycistronic vectors can use one or more 2A peptides. These peptides are small "self-cleaving" peptides of 18-22 amino acids in length, and multiple genes of equal molar levels are produced from the same mRNA. The ribosome skips the synthesis of the glycyl-prolyl peptide bond at the C-terminus of the 2A peptide, thereby causing "cleavage" between the 2A peptide and its direct downstream peptide. See, e.g., Kim et al., (2011) PLoS One 6(4):e18556, which is incorporated herein by reference in its entirety for all purposes. "Cleavage" occurs between the glycine and proline residues present on the C-terminus, meaning that the upstream cistron will add some additional residues at the end, while the downstream cistron will start with a proline. Thus, the "cut" downstream peptide has a proline at its N-terminus. 2A-mediated cleavage is a universal phenomenon in all eukaryotic cells. 2A peptides have been identified from picornaviruses, insect viruses, and type C rotaviruses. See, e.g., Szymczak et al., (2005) Expert Opin Biol Ther 5:627-638, which is incorporated herein by reference in its entirety for all purposes. Examples of 2A peptides that can be used include Thoseaasigna virus 2A (T2A); Porcine Teschovirus-1 2A (P2A); Equine Rhinitis A Virus (ERAV) 2A (E2A); and FMDV 2A (F2A). Exemplary T2A, P2A, E2A, and F2A sequences include the following: T2A (EGRGSLLTCGDVEENPGP; SEQ ID NO: 31); P2A (ATNFSLLKQAGDVEENPGP; SEQ ID NO: 32); E2A (QCTNYALLKLAGDVESNPGP; SEQ ID NO: 33); and F2A (VKQTLNFDLLKLAGDVESNPGP; SEQ ID NO: 34). A GSG residue can be added to the 5' end of any of these peptides to improve cleavage efficiency.

[0163] In some nucleic acid constructs, the nucleic acid encoding the furin cleavage site is included between the light chain coding sequence and the heavy chain coding sequence. In some nucleic acid constructs, the nucleic acid encoding a joint (e.g., GSG) is included between the light chain coding sequence and the heavy chain coding sequence (e.g., directly located in the upstream of the 2A peptide coding sequence). For example, the furin cleavage site can be included in the upstream of the 2A peptide, wherein both the furin cleavage site and the 2A peptide are positioned between the light chain and the heavy chain (i.e., upstream chain-furin cleavage site-2A peptide-downstream chain). During translation, the first cleavage event will occur at the 2A peptide sequence. However, most of the 2A peptides will be connected to the C-terminal of the upstream chain as residue (e.g., if the light chain is located in the upstream of the heavy chain, it is the light chain, if the heavy chain is located in the upstream of the light chain, it is the heavy chain), wherein one of the amino acids is added to the N-terminal of the downstream chain (or the N-terminal of the signal sequence, if the signal sequence is included in the upstream of the downstream chain). The second cleavage event caused at the furin cleavage site produces an upstream chain without 2A residues, so as to obtain a more natural heavy chain or light chain by post-translational processing.

[0164] The term "chimeric antigen receptor" (CAR) refers to a molecule that combines a binding domain for a component present on a target cell (e.g., an antibody-based specificity for a desired antigen) with a T cell receptor activating intracellular domain to produce a chimeric protein that exhibits specific anti-target cell immune activity. For example, a CAR may comprise an extracellular single-chain antibody binding domain (scFv) fused to an intracellular signaling domain of a T cell antigen receptor complex ζ chain, and has the ability to redirect antigen recognition based on the specificity of a monoclonal antibody when expressed in a T cell.

[0165] The polypeptide of interest can be a secreted polypeptide (e.g., a protein that is secreted by a cell and / or has functional activity as a soluble extracellular protein). Alternatively, the polypeptide of interest can be an intracellular polypeptide (e.g., a protein that is not secreted by a cell and has functional activity within the cell, including a soluble cytoplasmic polypeptide).

[0166] The polypeptide of interest can be a wild-type polypeptide. Alternatively, the polypeptide of interest can be a variant or mutant polypeptide.

[0167] In one example, the polypeptide of interest is a liver protein (e.g., a protein produced endogenously in the liver and / or functionally active in the liver). In another example, the polypeptide of interest may be a circulating protein produced by the liver. In another example, the polypeptide of interest may be a non-liver protein.

[0168] The polypeptide of interest can be an exogenous polypeptide. An "exogenous" polypeptide coding sequence can refer to a coding sequence of a site introduced into the host cell genome from an exogenous source (e.g., at a genomic locus such as a genomic safe harbor locus as described herein). That is, an exogenous polypeptide coding sequence is exogenous relative to its insertion site, and the polypeptide of interest expressed by such an exogenous coding sequence is referred to as an exogenous polypeptide. An exogenous coding sequence can be naturally occurring or engineered, and can be a wild type or a variant. An exogenous coding sequence can include a nucleotide sequence different from a sequence encoding an exogenous polypeptide (e.g., an internal ribosome entry site). An exogenous coding sequence can be a coding sequence naturally occurring in the host genome, such as a wild type or a variant (e.g., a mutant). For example, although a host cell contains a coding sequence of interest (as a wild type or as a variant), the same coding sequence or its variant can be introduced as an exogenous source (e.g., for expression at a highly expressed locus). An exogenous coding sequence can also be a coding sequence that is not naturally occurring in the host genome, or a coding sequence that expresses an exogenous polypeptide that is not naturally occurring in the host genome. An exogenous coding sequence can include an exogenous nucleic acid sequence (eg, a nucleic acid sequence that is not endogenous to the recipient cell) or can be exogenous with respect to its site of insertion and / or with respect to its recipient cell.

[0169] The coding sequence of the polypeptide of interest can be codon optimized for expression in a host cell. For example, the coding sequence can be codon optimized, or one or more alternative codons can be used for one or more amino acids of the polypeptide of interest (i.e., the same amino acid sequence). Alternative codons as used herein refer to changes in the codon usage of a given amino acid, and may or may not be preferred or optimized codons (codon optimized) for a given expression system. Preferred codon usage or codons well tolerated in a given expression system are known.

[0170] (2) Carrier

[0171] The nucleic acid constructs disclosed herein can be provided in a vector for expression or integration into a target genomic locus (e.g., a genomic safe harbor locus) and from a target genomic locus (e.g., a genomic safe harbor locus). The vector may include additional sequences, such as replication origins, promoters, and genes encoding antibiotic resistance. The vector may also include a nuclease agent component as disclosed elsewhere herein. For example, the vector may include a nucleic acid construct encoding a product of interest (e.g., a polypeptide of interest), a CRISPR / Cas system (nucleic acids encoding Cas proteins and gRNA), one or more components in the CRISPR / Cas system, or a combination thereof (e.g., a nucleic acid construct and gRNA). In some cases, the vector comprising a nucleic acid construct encoding a product of interest (e.g., a polypeptide of interest) does not include any component of a nuclease agent described herein (e.g., does not include nucleic acids encoding Cas proteins and does not include nucleic acids encoding gRNA). Some such vectors include homology arms corresponding to the target site in the target genomic locus. Other such vectors do not include any homology arms.

[0172] Some vectors can be circular. Alternatively, the vector can be linear. The vector can be packaged for delivery via lipid nanoparticles, liposomes, non-lipid nanoparticles or viral capsids. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors and expression vectors.

[0173] The vector can be, for example, a viral vector, such as an adeno-associated virus (AAV) vector. AAV can be any suitable serotype and can be a single-stranded AAV (ssAAV) or a self-complementary AAV (scAAV). Other exemplary viruses / viral vectors include retroviruses, slow viruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses. The virus can infect dividing cells, non-dividing cells, or both dividing cells and non-dividing cells. The virus can be integrated into the host genome, or alternatively not integrated into the host genome. Such viruses can also be engineered to have reduced immunity. The virus may have replication ability or may have replication defects (for example, defects in one or more genes necessary for replication and / or packaging of other rounds of virions). The virus can cause transient expression or more persistent expression. The viral vector can be genetically modified from their wild-type counterparts. For example, the viral vector may include the insertion, deletion, or substitution of one or more nucleotides to promote cloning or to change one or more characteristics of the vector. Such characteristics may include packaging ability, transduction efficiency, immunogenicity, genome integration, replication, transcription, and translation. In some examples, a part of the viral genome can be deleted so that the virus can package an exogenous sequence with a larger size. In some examples, the viral vector may have an enhanced transduction efficiency. In some examples, the immune response induced by the virus in the host can be reduced. In some examples, the viral gene (such as integrase) that promotes the integration of the viral sequence into the host genome can be mutated so that the virus becomes non-integrated. In some examples, the viral vector can be replication-deficient. In some examples, the viral vector may include an exogenous transcription or translation control sequence to drive the expression of the coding sequence on the vector. In some examples, the virus can be auxiliary-dependent. For example, the virus may need one or more auxiliary components to provide the amplification vector and the viral components (such as viral proteins) required for the vector to be packaged into the viral particles. In this case, one or more auxiliary components (including one or more vectors encoding viral components) can be introduced into the host cell or host cell population together with the vector system described herein. In other examples, the virus can be without auxiliary components. For example, the virus can amplify and package the vector without an auxiliary virus. In some examples, the vector system described herein can also encode the viral components required for viral amplification and packaging.

[0174] Exemplary viral titers (e.g., AAV titers) include about 10 12 vg / mL to about 10 16 vg / mL. Other exemplary viral titers (e.g., AAV titers) include about 10 12 vg / kg body weight to about 10 16 vg / kg body weight.

[0175] Adeno-associated virus (AAV) is endemic in multiple species including humans and non-human primates (NHPs). To date, at least 12 natural serotypes and hundreds of natural variants have been isolated and characterized. See, for example, Li et al., (2020) Nat. Rev. Genet. 21: 255-272, which is incorporated herein by reference in its entirety for all purposes. AAV particles are naturally composed of non-enveloped icosahedral protein capsids containing a single-stranded DNA (ssDNA) genome. The DNA genome is flanked by two inverted terminal repeats (ITRs), which serve as viral replication origins and packaging signals. The rep gene encodes four proteins required for viral replication and packaging, while the cap gene encodes three structural capsid subunits that determine the AAV serotype and an assembly activation protein (AAP) that promotes virion assembly in some serotypes.

[0176] Recombinant AAV (rAAV) is one of the most commonly used viral vectors in gene therapy today, treating human diseases by delivering therapeutic transgenes to target cells in vivo. rAAV vectors consist of an icosahedral capsid similar to native AAV, but rAAV virions do not encapsulate AAV protein coding sequences or AAV replication sequences. These viral vectors are non-replicating. The only viral sequences required in rAAV vectors are two ITRs, which are required to direct genome replication and packaging during rAAV vector manufacturing. The rAAV genome lacks the AAV rep and cap genes, making them non-replicative in vivo. rAAV vectors are produced by trans-expressing the rep and cap genes, as well as additional viral accessory proteins, in combination with the intended transgene cassette flanked by AAV ITRs.

[0177] In the rAAV genome, the gene expression cassette can be placed between ITR sequences. Typically, the rAAV genome cassette contains a promoter that drives the expression of the transgene, followed by a polyadenylation sequence. The ITRs flanking the rAAV expression cassette are usually derived from AAV2, the first serotype to be isolated and converted into a recombinant viral vector. Since then, most rAAV preparation methods have relied on a packaging system based on AAV2Rep. See, for example, Colella et al., (2017) Mol. Ther. Methods Clin. Dev. 8: 87-104, which is incorporated herein by reference in its entirety for all purposes.

[0178] The specific serotype of the recombinant AAV vector affects its in vivo tropism for specific tissues. The AAV capsid protein is responsible for mediating attachment and entry into target cells, followed by endosome escape and transport to the nucleus. Therefore, when developing rAAV vectors, the choice of serotype will affect the cell types and tissues that the vector is most likely to bind and transduce when injected in vivo. When delivered systemically in mice, NHPs, and humans, several rAAV serotypes (including rAAV8) are able to transduce the liver. See, for example, Li et al., (2020) Nat. Rev. Genet. 21: 255-272, which is incorporated herein by reference in its entirety for all purposes.

[0179] Once in the nucleus, the ssDNA genome is released from the virion, and a complementary DNA strand is synthesized to generate a double-stranded DNA (dsDNA) molecule. The double-stranded AAV genome is naturally cyclized via its ITR and becomes an episome, which will persist in the nucleus outside the chromosome. Therefore, for free gene therapy procedures, the rAAV episome delivered by rAAV provides long-term, promoter-driven gene expression in non-dividing cells. However, the free DNA delivered by this rAAV is diluted as the cell divides. In contrast, the gene therapy described herein is based on gene insertion to allow long-term gene expression.

[0180] The ssDNA AAV genome consists of two open reading frames, Rep and Cap, flanked by two reverse terminal repeats that allow synthesis of complementary DNA chains. When constructing the AAV transfer plasmid, the transgene is placed between the two ITRs, and Rep and Cap can be provided in trans. In addition to Rep and Cap, AAV may also require an auxiliary plasmid containing adenovirus genes. These genes (E4, E2a and VA) mediate AAV replication. For example, transfer plasmids, Rep / Cap and auxiliary plasmids can be transfected into HEK293 cells containing adenovirus gene E1+ to produce infectious AAV particles. Alternatively, Rep, Cap and adenovirus auxiliary genes can be combined into a single plasmid. Similar packaging cells and methods can be used for other viruses, such as retroviruses.

[0181] AAV has been identified in various serotypes. These serotypes are different in the cell types (i.e., their tropism) that they infect, allowing preferential transduction of specific cell types. The term AAV includes, for example, AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10 and their hybrids, avian AAV, cattle AAV, dog AAV, horse AAV, primate AAV, non-primate AAV and sheep AAV. The genome sequences of the various serotypes of AAV and the sequences of natural terminal repeats (TR), Rep proteins and capsid subunits are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. As used herein, "AAV vector" refers to an AAV vector comprising a heterologous sequence of non-AAV origin (i.e., a nucleic acid sequence heterologous to AAV), typically comprising a sequence encoding an exogenous polypeptide of interest. The construct may comprise AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10 and hybrids thereof, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV and ovine AAV capsid sequences. In general, the heterologous nucleotide sequence (transgene) is flanked by at least one, usually two, AAV inverted terminal repeats (ITRs). AAV vectors can be single-stranded (ssAAV) or self-complementary (scAAV). Examples of serotypes of liver tissue include AAV3B, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.74, AAV-DJ, and AAVhu.37, and specifically AAV8. In a specific example, the AAV vector comprising the nucleic acid construct can be a recombinant AAV8 (rAAV8). The rAAV8 vector as described herein is a vector in which the capsid is from AAV8. For example, an AAV vector using the ITR from AAV2 and the capsid of AAV8 is considered to be a rAAV8 vector herein.

[0182] Tropism can be further refined by pseudotypes, which are mixtures of capsids and genomes from different viral serotypes. For example, AAV2 / 5 indicates a virus containing a serotype 2 genome packaged in a capsid from serotype 5. The use of pseudotyped viruses can improve transduction efficiency as well as alter tropism. Hybrid capsids derived from different serotypes can also be used to alter viral tropism. For example, AAV-DJ contains hybrid capsids from eight serotypes and exhibits high infectivity in a wide range of in vivo cell types. AAV-DJ8 is another example showing the properties of AAV-DJ, but with enhanced brain uptake. AAV serotypes can also be modified by mutations. Examples of AAV2 mutation modifications include Y444F, Y500F, Y730F, and S662V. Examples of AAV3 mutation modifications include Y705F, Y731F, and T492V. Examples of AAV6 mutation modifications include S663V and T492V. Other pseudotyped / modified AAV variants include AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, AAV8.2, and AAV / SASTG.

[0183] To accelerate transgene expression, self-complementary AAV (scAAV) variants can be used. Since AAV relies on the cell's DNA replication machinery to synthesize the complementary strand of the AAV single-stranded DNA genome, transgene expression may be delayed. To address this delay, scAAV containing complementary sequences that can spontaneously anneal after infection can be used, thereby eliminating the need for host cell DNA synthesis. However, single-stranded AAV (ssAAV) vectors can also be used.

[0184] To increase packaging capacity, a longer transgene can be split between two AAV transfer plasmids, the first with a 3' splice donor and the second with a 5' splice acceptor. Upon co-infection of the cells, these viruses form concatemers, splice together, and the full-length transgene can be expressed. While this allows for expression of longer transgenes, the expression efficiency is low. A similar approach for increasing capacity utilizes homologous recombination. For example, a transgene can be split between two transfer plasmids but with a large amount of sequence overlap so that co-expression induces homologous recombination and expression of the full-length transgene.

[0185] C. Nuclease Agents and CRISPR / Cas Systems

[0186] Methods and compositions disclosed herein can utilize nuclease agents such as clustered regularly spaced short palindromic repeats (CRISPR) / CRISPR-related (Cas) systems, zinc finger nuclease (ZFN) systems or transcription activator-like effector nuclease (TALEN) systems or components of such systems to modify the target genomic locus (such as genomic safe harbor locus) in the target locus to insert a nucleic acid construct as disclosed herein. Generally, nuclease agents involve the use of engineered cutting systems to induce double-strand breaks or nicks (i.e., single-strand breaks) in the nuclease target site. Cutting or nicking can occur by using specific nucleases such as engineered ZFN, TALEN or CRISPR / Cas systems, and the specific nuclease has an engineered guide RNA to guide the specific cutting or nicking of the nuclease target site. Any nuclease agent that induces nicks or double-strand breaks at the desired target sequence can be used in the methods and compositions disclosed herein. Nuclease agents can be used to form an insertion site at the desired locus (genomic safe harbor locus) in the host genome, and a nucleic acid construct is inserted at the site to express a product of interest (e.g., a polypeptide of interest). The product of interest (e.g., polypeptide of interest) can be exogenous relative to its insertion site or locus, such as an extragenic genomic safe harbor locus where the product of interest (e.g., polypeptide of interest) is not normally expressed.

[0187] In one example, the nuclease agent is a CRISPR / Cas system. In another example, the nuclease agent includes one or more ZFNs. In another example, the nuclease agent includes one or more TALENs. In a specific example, the CRISPR / Cas system or a component of such a system targets a genome safe harbor locus as described elsewhere herein in a cell. In a more specific example, the CRISPR / Cas system or a component of such a system targets a L-SH5, L-SH18 or L-SH20 genome safe harbor locus as described herein in a cell (e.g., a human L-SH5, L-SH18 or L-SH20 genome safe harbor locus). In a more specific example, the CRISPR / Cas system or a component of such a system targets a human L-SH5, L-SH18 or L-SH20 genome safe harbor locus as described herein in a cell. In a more specific example, the CRISPR / Cas system or a component of such a system targets a mouse L-SH5, L-SH18 or L-SH20 genome safe harbor locus as described herein in a cell.

[0188] The CRISPR / Cas system includes transcripts and other elements related to Cas gene expression or guiding its activity. The CRISPR / Cas system can be, for example, a type I, type II, type III system or a type V system (e.g., VA subtype or VB subtype). The methods and compositions disclosed herein can be used for site-specific binding or cutting of nucleic acids using a CRISPR complex (including a guide RNA (gRNA) complexed with a Cas protein) to employ a CRISPR / Cas system. The CRISPR / Cas system targeting a genomic safe harbor locus includes a Cas protein (or a nucleic acid encoding a Cas protein) and one or more guide RNAs (or DNA encoding one or more guide RNAs), wherein each of the one or more guide RNAs targets a different guide RNA target sequence in a target genomic locus.

[0189] The CRISPR / Cas systems used in the compositions and methods disclosed herein can be non-naturally occurring. A "non-naturally occurring" system includes anything that indicates artificiality, such as one or more components of the system being altered or mutated from their naturally occurring state, being at least substantially free of at least one other component with which it is naturally associated in nature, or being associated with at least one other component with which it is not naturally associated. For example, some CRISPR / Cas systems employ non-naturally occurring CRISPR complexes including gRNA and Cas proteins that do not occur together naturally, employ non-naturally occurring Cas proteins, or employ non-naturally occurring gRNAs.

[0190] (1) Target genomic loci

[0191] Any target genomic locus capable of expressing a gene can be used, such as a genomic safe harbor locus as described elsewhere herein. The target genomic locus used herein can be a genomic safe harbor locus. The genomic safe harbor locus includes a chromosomal locus, in which a transgenic or other exogenous nucleic acid insert can be stably and reliably expressed in a tissue of interest without significantly changing cell behavior or phenotype (i.e., without any harmful effects on the host cell). For example, a genomic safe harbor locus can be a locus in which the expression of an inserted gene sequence is not disturbed by any read-through expression from an adjacent gene. For example, a genomic safe harbor locus can include a chromosomal locus, in which an exogenous DNA can be integrated and play a role in a predictable manner without adversely affecting endogenous gene structure or expression. The genomic safe harbor locus can be efficiently targeted, and the safe harbor locus can be broken without an obvious phenotype. The genomic safe harbor locus can include a gene extraregion or a gene intraregion, such as a locus in a gene that is not essential, dispensable, or can be broken without an obvious phenotypic result.

[0192] The genomic safe harbor locus described herein can be a genomic locus that does not cause functional changes in the liver when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause alanine aminotransferase (alanine transaminase or ALT) level changes when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause aspartate aminotransferase (AST) level changes when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause alkaline phosphatase (ALP) level changes when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause weight changes when targeted integration into a subject. The genomic safe harbor locus described herein can be a genomic locus that does not cause proliferation (such as in a target organ such as the liver) changes (e.g., as assessed by Ki67 staining) when targeted integration into a subject. A genomic safe harbor locus described herein can be a genomic locus that does not cause oncogenic transformation (such as in a target organ such as the liver) (e.g., as assessed by H&E staining) when targeted for integration into a subject.

[0193] The genomic safe harbor locus described herein can be a genomic locus with an open chromatin configuration in the liver, so that the exogenous nucleic acid insert can be stably and reliably expressed in the liver. Alternatively, the genomic safe harbor locus can be a genomic locus with an open chromatin configuration in another tissue or cell type (e.g., hematopoietic cells, such as hematopoietic stem cells, T cells, B cells and / or macrophages), so that the exogenous nucleic acid insert can be stably and reliably expressed in the tissue or cell type.

[0194] The genomic safe harbor loci described herein can be extragenic genomic safe harbor loci (ie, occurring outside a gene). In a specific example, the genomic safe harbor loci described herein are extragenic genomic safe harbor loci with an open chromatin configuration in the liver.

[0195] In a specific example, a genomic safe harbor locus can be a locus that is more than 300 kb from any cancer-related gene (e.g., to prevent insertional tumorigenesis), more than 300 kb from any miRNA or small RNA (e.g., to maintain regulation of gene expression and cell development), more than 50 kb from the 5' end of any gene (e.g., to avoid interfering with endogenous gene expression), more than 50 kb from any replication origin, more than 50 kb from any ultra-conserved element (e.g., a non-coding intragenic or intergenic region that is completely conserved in the human, mouse, and rat genomes), outside a copy number variable region, and in open chromatin (as determined, for example, by ATAC-Seq analysis (e.g., in a human liver biopsy sample)). In addition, a genomic safe harbor locus can be a locus that does not overlap with a region predicted to be a regulatory region (e.g., H3K4me1, H3K27ac, and / or H3K4me3 marker), a heterochromatin region (e.g., an H3K9me3 marker), or a region involved in chromatin organization (e.g., a CTCF signal).

[0196] In a specific example, the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537 (referred to herein as L-SH5) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate) or rodent (such as a rat or mouse); (ii) human chromosome 6, coordinates 170031084-170031382 (referred to herein as L- SH18) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse); and (iii) human chromosome 9, coordinates 25207412-25207703 (referred to herein as L-SH20) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse).

[0197] In one specific example, the genomic safe harbor locus is selected from the following genomic coordinates: (i) about 77460242 to about 77460537 on human chromosome 13 (corresponding to L-SH5) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate), or a rodent (such as a rat or mouse); (ii) about 170031084 to about 170031382 on human chromosome 6 (corresponding to L- (iii) about 25207412 to about 25207703 on human chromosome 9 (corresponding to L-SH20) or a corresponding region (e.g., orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). When referring to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above coordinates. When referring to genomic coordinates, the term "close to" means ± 5kb, ± 4kb, ± 3kb, ± 2kb, ± 1kb, ± 0.5kb, ± 0.4kb, ± 0.3kb, ± 0.2kb or ± 0.1kb.

[0198] In a specific example, the genomic safe harbor locus is human L-SH5 (chromosome 13, coordinates 77460242-77460537) or a corresponding region (e.g., orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., non-human primate) or rodent (such as rat or mouse). Syntenic regions are derived from a single ancestral genomic region. For example, syntenic regions can come from different organisms and are derived from species formation.

[0199] In another specific example, the genomic safe harbor locus is human L-SH18 (chromosome 6, coordinates 170031084-170031382) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate), or rodent (such as a rat or mouse).

[0200] In another specific example, the genomic safe harbor locus is human L-SH20 (chromosome 9, coordinates 25207412-25207703) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate), or rodent (such as a rat or mouse).

[0201] In a specific example, the genomic safe harbor locus corresponds to human L-SH5 (coordinates from about 77460242 to about 77460537 on chromosome 13) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse) or a variant thereof, which is located at the same position or genetic locus on a human chromosome or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). When referring to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0202] In another specific example, the genomic safe harbor locus corresponds to human L-SH18 (coordinates from about 170031084 to about 170031382 on chromosome 6) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse) or a variant thereof, which is located at the same position or genetic locus on a human chromosome or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). When it comes to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0203] In another specific example, the genomic safe harbor locus corresponds to human L-SH20 (coordinates from about 25207412 to about 25207703 on chromosome 9) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse) or a variant thereof, which is located at the same position or genetic locus on a human chromosome or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat or a mouse). When referring to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0204] In a specific example, the genomic safe harbor locus is selected from the following genomic locations: (i) mouse chromosome 14, coordinates 103,450,397-103,451,396 (referred to herein as mouse L-SH5) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate), or rodent (such as rat); (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386 (referred to herein as for mouse L-SH18) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat); and (iii) mouse chromosome 4, coordinates 92,827,563-92,828,592 (referred to herein as mouse L-SH20) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat).

[0205] In one specific example, the genomic safe harbor locus is selected from the following genomic coordinates: (i) about 103,450,397 to about 103,451,396 on mouse chromosome 14 (corresponding to mouse L-SH5) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate), or rodent (such as rat); (ii) about 15,226,387 to about 15,227,386 on mouse chromosome 17 (corresponding to (e.g., mouse L-SH18) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat); and (iii) about 92,827,563 to about 92,828,592 on mouse chromosome 4 (corresponding to mouse L-SH20) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). When referring to genomic coordinates, the term "about" means ±20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above coordinates. When referring to genomic coordinates, the term "close to" means ±5kb, ±4kb, ±3kb, ±2kb, ±1kb, ±0.5kb, ±0.4kb, ±0.3kb, ±0.2kb or ±0.1kb.

[0206] In a specific example, the genomic safe harbor locus is a corresponding region (e.g., orthologous or syntenic region) in mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) or a non-human animal, non-human mammal (e.g., non-human primate) or rodent (such as rat). Syntenic regions are derived from a single ancestral genomic region. For example, syntenic regions can come from different organisms and are derived from species formation.

[0207] In another specific example, the genomic safe harbor locus is mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate), or rodent (such as a rat).

[0208] In another specific example, the genomic safe harbor locus is mouse L-SH20 (chromosome 4, coordinates 92,827,563-92,828,592) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, non-human mammal (e.g., a non-human primate), or rodent (such as a rat).

[0209] In a specific example, the genomic safe harbor locus corresponds to mouse L-SH5 (coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat) or a variant thereof, which is located at the same position or genetic locus on the chromosome of the mouse or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). When it comes to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0210] In another specific example, the genomic safe harbor locus corresponds to mouse L-SH18 (coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat) or a variant thereof, which is located at the same position on the chromosome of the mouse or a genetic locus or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). When it comes to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0211] In another specific example, the genomic safe harbor locus corresponds to mouse L-SH20 (coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4) or a corresponding region (e.g., an orthologous or syntenic region) in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat) or a variant thereof, which is located at the same position or genetic locus on the chromosome of the mouse or an orthologous or syntenic region in a non-human animal, a non-human mammal (e.g., a non-human primate) or a rodent (such as a rat). When it comes to genomic coordinates, the term "about" means ± 20 base pairs. In other examples, the genomic safe harbor locus is close to the region identified by the above-mentioned coordinates. The term "near" when referring to genomic coordinates means ±5 kb, ±4 kb, ±3 kb, ±2 kb, ±1 kb, ±0.5 kb, ±0.4 kb, ±0.3 kb, ±0.2 kb or ±0.1 kb.

[0212] (2) Cas proteins

[0213] Cas proteins generally include at least one RNA recognition or binding domain that can interact with guide RNA. Cas proteins can also include nuclease domains (e.g., DNase domains or RNase domains), DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains and other domains. Some such domains (e.g., DNase domains) can be from natural Cas proteins. Other such domains can be added to prepare modified Cas proteins. The nuclease domain has catalytic activity for nucleic acid cutting, which comprises the breaking of covalent bonds of nucleic acid molecules. Cutting can produce blunt ends or staggered ends, and cutting can be single-stranded or double-stranded. For example, wild-type Cas9 proteins usually form blunt-end cutting products. Alternatively, wild-type Cpf1 proteins (e.g., FnCpf1) can obtain cutting products with 5-nucleotide 5' overhangs, wherein cutting occurs after the 18th base pair of the PAM sequence on the non-targeting chain and after the 23rd base on the targeting chain. The Cas protein can have full cleavage activity to form double-strand breaks (e.g., double-strand breaks with blunt ends) at the target genomic locus, or it can be a nickase that forms single-strand breaks at the target genomic locus.

[0214] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (Csn1), and Csx2. asE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and Cu1966, and homologs or modified versions thereof.

[0215] An exemplary Cas protein is a Cas9 protein or a protein derived from a Cas9 protein. The Cas9 protein is from a type II CRISPR / Cas system and generally shares four key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is a HNH motif. Exemplary Cas9 proteins are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, delbrueckii), Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaerawatsonii, Cyanotheces p., Microcystis aeruginosa, Synechococcus sp.), Acetohalobiumarabaticum, Ammonifexdegensii, Caldicelulosiruptorbecscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculumthermopropionicum, Acidithiobacilluscaldus, Acidithiobacillusferrooxidans, Allochromatiumvinosum, Marinobacter sp.), Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas shaloplanktis, Ktedonobacterracemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleuschthonoplastes, Oscillatoria sp.), Petrotogamobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of Cas9 family members are described in WO 2014 / 131833, which is incorporated herein by reference in its entirety for all purposes. Cas9 (SpCas9) from Streptococcus pyogenes (e.g., the assigned UniProt accession number is Q99ZW2) is an exemplary Cas9 protein. An exemplary SpCas9 protein sequence is shown in SEQ ID NO: 1 (encoded by the DNA sequence shown in SEQ ID NO: 2). Smaller Cas9 proteins (e.g., Cas9 proteins whose coding sequences are compatible with maximum AAV packaging capacity when combined with guide RNA coding sequences and regulatory elements of Cas9 and guide RNA, such as SaCas9 and CjCas9 and Nme2Cas9) are other exemplary Cas9 proteins. For example, Cas9 (SaCas9) from Staphylococcus aureus (assigned UniProt accession number J7RUA5) is another exemplary Cas9 protein. Similarly, Cas9 (CjCas9) from Campylobacter jejuni (e.g., assigned UniProt accession number Q0P897) is another exemplary Cas9 protein. See, e.g., Kim et al., (2017) Nat. Commun. 8: 14500, which is incorporated herein by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Cas9 (Nme2Cas9) from Neisseria meningitidis is another exemplary Cas9 protein. See, e.g., Edraki et al., (2019) Mol.Cell 73 (4): 714-726, which is incorporated herein by reference in its entirety for all purposes. Cas9 proteins from thermophilic streptococci (e.g., thermophilic streptococci LMD-9Cas9 (St1Cas9) encoded by the CRISPR1 locus or thermophilic streptococci Cas9 (St3Cas9) from the CRISPR3 locus) are other exemplary Cas9 proteins. Cas9 (FnCas9) from Francisella novicida or RHA Francisella novicida Cas9 variants that recognize alternative PAMs (E1369R / E1449H / R1556A substitutions) are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are reviewed in, for example, Cebrian-Serrano and Davies (2017) Mamm. Genome 28 (7): 247-261, which is incorporated herein by reference in its entirety for all purposes. Examples of Cas9 coding sequences, Cas9 mRNAs, and Cas9 protein sequences are provided in WO 2013 / 176772, WO 2014 / 065596, WO 2016 / 106121, WO 2019 / 067910, WO 2020 / 082042, US2020 / 0270617, WO 2020 / 082041, US2020 / 0268906, WO 2020 / 082046, and US2020 / 0289628, each of which is incorporated herein by reference in its entirety for all purposes. Specific examples of ORFs and Cas9 amino acid sequences are provided in Table 30 of paragraph

[0449] of WO 2019 / 067910, and specific examples of Cas9 mRNAs and ORFs are provided in paragraphs

[0214] -

[0234] of WO 2019 / 067910. See also WO 2020 / 082046 A2 (pp. 84-85) and Table 24 in WO 2020 / 069296, each of which is incorporated herein by reference in its entirety for all purposes. .

[0216] Another example of a Cas protein is the Cpf1 (CRISPR from Prevotella and Francisella 1; Cas12a) protein. Cpf1 is a large protein (about 1300 amino acids) containing a RuvC-like nuclease domain homologous to the corresponding domain of Cas9 and a counterpart to the characteristic arginine-rich Cas9 cluster. However, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and the RuvC-like domain is continuous in the Cpf1 sequence, unlike Cas9, which contains a long insert containing the HNH domain. See, e.g., Zetsche et al., (2015) Cell 163(3):759-771, which is incorporated herein by reference in its entirety for all purposes. Exemplary Cpf1 proteins are from Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp.) BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae.Cpf1 from Francisella novicida U112 (FnCpf1; assigned UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.

[0217] Another example of a Cas protein is CasX (Cas12e). CasX is an RNA-guided DNA endonuclease that generates staggered double-strand breaks in DNA. The size of CasX is less than 1000 amino acids. Exemplary CasX proteins are from Deltaproteobacteria (DpbCasX or DpbCas12e) and Planctomycetes (PlmCasX or PlmCas12e). Similar to Cpf1, CasX uses a single RuvC active site for DNA cutting. See, for example, Liu et al., (2019) Nature 566(7743): 218-223, which is incorporated herein by reference in its entirety for all purposes.

[0218] Another example of a Cas protein is CasΦ (CasPhi or Cas12j), which is uniquely present in bacteriophages. The size of CasΦ is less than 1000 amino acids (e.g., 700-800 amino acids). CasΦ cleavage generates staggered 5' overhangs. The single RuvC active site in CasΦ enables crRNA processing and DNA cleavage. See, e.g., Pausch et al., (2020) Science 369(6501):333-337, which is incorporated herein by reference in its entirety for all purposes.

[0219] The Cas protein can be a wild-type protein (i.e., those proteins present in nature), a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein. In terms of the catalytic activity of a wild-type or modified Cas protein, the Cas protein can also be an active variant or fragment. In terms of catalytic activity, an active variant or fragment may include at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with a wild-type or modified Cas protein or a portion thereof, wherein the active variant retains the ability to cut at the desired cleavage site, and thus retains nick induction or double-strand break induction activity. Assays for nick induction or double-strand break induction activity are known, and the overall activity and specificity of the Cas protein for a DNA substrate containing a cleavage site are generally measured.

[0220] An example of a modified Cas protein is a modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 with changes (N497A / R661A / Q695A / Q926A) designed to reduce non-specific DNA contacts. See, e.g., Kleinstiver et al., (2016) Nature 529(7587):490-495, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas protein is a modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, e.g., Slaymaker et al., (2016) Science 351(6268):84-88, which is incorporated herein by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are reviewed in, for example, Cebrian-Serrano and Davies (2017) Mamm. Genome 28 (7): 247-261, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas9 protein is xCas9, which is a SpCas9 variant that can recognize an expanded range of PAM sequences. See, for example, Hu et al., (2018) Nature 556: 57-63, which is incorporated herein by reference in its entirety for all purposes.

[0221] The Cas protein can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. The Cas protein can also be modified to change any other activity or property of the protein, such as stability. For example, one or more nuclease domains of the Cas protein can be modified, deleted, or inactivated, or the Cas protein can be truncated to remove domains that are unnecessary for protein function or to optimize (e.g., enhance or reduce) the activity or property of the Cas protein.

[0222] Cas proteins can include at least one nuclease domain, such as a DNase domain. For example, wild-type Cpf1 proteins typically include a RuvC-like domain that cuts two chains of target DNA, which may be in a dimer configuration. Similarly, CasX and CasΦ typically include a single RuvC-like domain that cuts two chains of target DNA. Cas proteins can also include at least two nuclease domains, such as DNase domains. For example, wild-type Cas9 proteins typically include a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC domain and the HNH domain can each cut different chains of double-stranded DNA to form double-strand breaks in DNA. See, for example, Jinek et al., (2012) Science 337 (6096): 816-821, which is incorporated herein by reference in its entirety for all purposes.

[0223] One or more nuclease domains in the nuclease domain can be missing or mutated so that it no longer has function or has reduced nuclease activity. For example, if one of the nuclease domains in the Cas9 protein is missing or mutated, the resulting Cas9 protein can be referred to as a nickase, and single-strand breaks can be generated in double-stranded target DNA but double-strand breaks will not be generated (i.e., it can cut complementary strands or non-complementary strands, but cannot cut both at the same time). If there is no missing or mutation of any nuclease domain in the Cas9 protein, the Cas9 protein will retain double-strand break inducing activity. The example of a mutation that converts Cas9 into a nickase is a D10A (aspartic acid to alanine at position 10 of Cas9) mutation in the RuvC domain of Cas9 from Streptococcus pyogenes. Similarly, H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840), or N863A (asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from Streptococcus pyogenes can convert Cas9 into a nickase. Other examples of mutations that convert Cas9 into a nickase include corresponding mutations of Cas9 from Streptococcus thermophilus. See, for example, Sapranauskas et al., (2011) Nucleic Acids Res. 39 (21): 9275-9282 and WO 2013 / 141680, each of which is incorporated herein by reference in its entirety for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Examples of other mutations that form nickases can be found, for example, in WO 2013 / 176772 and WO 2013 / 142578, each of which is incorporated herein by reference in its entirety for all purposes.

[0224] Examples of inactivating mutations in the catalytic domain of xCas9 are the same as those described above for SpCas9. Examples of inactivating mutations in the catalytic domain of Staphylococcus aureus Cas9 protein are also known. For example, Staphylococcus aureus Cas9 enzyme (SaCas9) may include a substitution at position N580 (e.g., N580A substitution) and a substitution at position D10 (e.g., D10A substitution) to generate a Cas nickase. See, for example, WO 2016 / 106236, which is incorporated herein by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domain of Nme2Cas9 are also known (e.g., D16A or H588A). Examples of inactivating mutations in the catalytic domain of St1Cas9 are also known (e.g., D9A, D598A, H599A or N622A). Examples of inactivating mutations in the catalytic domain of St3Cas9 are also known (e.g., D10A or N870A). Examples of inactivating mutations in the catalytic domain of CjCas9 are also known (e.g., a combination of D8A or H559A). Examples of inactivating mutations in the catalytic domain of FnCas9 and RHA FnCas9 are also known (e.g., N995A).

[0225] Examples of inactivating mutations in the catalytic domain of Cpf1 proteins are also known. With reference to Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Lachnospiraceae sp. ND2006 (LbCpf1), and Moraxella bovis 237 (MbCpf1 Cpf1), such mutations may include mutations at positions 908, 993, or 1263 of AsCpf1, or at corresponding positions in Cpf1 orthologs, or at positions 832, 925, 947, or 1180 of LbCpf1, or at corresponding positions in Cpf1 orthologs. Such mutations may include, for example, one or more of the mutations D908A, E993A, and D1263A of AsCpf1 or corresponding mutations in Cpf1 orthologs, or D832A, E925A, D947A, and D1180A of LbCpf1 or corresponding mutations in Cpf1 orthologs. See, for example, US2016 / 0208243, which is incorporated herein by reference in its entirety for all purposes.

[0226] Examples of inactivating mutations in the catalytic domain of CasX proteins are also known. With reference to CasX proteins from deltaproteobacteria, D672A, E769A and D935A (alone or in combination) or corresponding positions in other CasX orthologs are inactivated. See, for example, Liu et al., (2019) Nature 566(7743): 218-223, which is incorporated herein by reference in its entirety for all purposes.

[0227] Examples of inactivating mutations in the catalytic domain of CasΦ proteins are also known. For example, D371A and D394A, alone or in combination, are inactivating mutations. See, for example, Pausch et al., (2020) Science 369(6501):333-337, which is incorporated herein by reference in its entirety for all purposes.

[0228] The Cas protein can also be operably linked to a heterologous polypeptide as a fusion protein. For example, the Cas protein can be fused to a cleavage domain. See WO 2014 / 089290, which is incorporated herein by reference in its entirety for all purposes. The Cas protein can also be fused to a heterologous polypeptide to provide increased or decreased stability. The fusion domain or heterologous polypeptide can be located at the N-terminus, C-terminus, or inside the Cas protein.

[0229] As an example, the Cas protein can be fused to one or more heterologous polypeptides that provide subcellular localization. Such heterologous polypeptides may include, for example, one or more nuclear localization signals (NLS), such as a single-point SV40 NLS for targeting the nucleus and / or a double-point α-import protein NLS, a mitochondrial localization signal for targeting mitochondria, an ER retention signal, etc. See, for example, Lange et al., (2007) J. Biol. Chem. 282 (8): 5101-5105, which is incorporated herein by reference in its entirety for all purposes. Such subcellular localization signals may be located at any position within the N-terminus, C-terminus, or Cas protein. The NLS may include a basic amino acid segment and may be a single-point sequence or a double-point sequence. Optionally, the Cas protein may include two or more NLSs, including an NLS at the N-terminus (e.g., an α-import protein NLS or a single-point NLS) and an NLS at the C-terminus (e.g., an SV40 NLS or a double-point NLS). The Cas protein may also include two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.

[0230] For example, the Cas protein can be fused with 1-10 NLSs (e.g., fused with 1-5 NLSs or fused with one NLS). In the case of using one NLS, the NLS can be connected to the N-terminus or C-terminus of the Cas protein sequence. It can also be inserted into the Cas protein sequence. Alternatively, the Cas protein can be fused with more than one NLS. For example, the Cas protein can be fused with 2, 3, 4 or 5 NLSs. In a specific example, the Cas protein can be fused with two NLSs. In some cases, the two NLSs can be the same (e.g., two SV40 NLSs) or different. For example, the Cas protein can be fused with two SV40 NLS sequences connected at the carboxyl termini. Alternatively, the Cas protein can be fused with two NLSs, one connected to the N-terminus, and one connected to the C-terminus. In other examples, the Cas protein can be fused with 3 NLSs or not fused with NLSs. NLS can be a monopartite sequence, such as SV40NLS, PKKKRKV (SEQ ID NO: 3) or PKKKRRV (SEQ ID NO: 4). The NLS can be a bipartite sequence, such as the NLS of the nucleoplasmic protein, KRPAATKKAGQAKKKK (SEQ ID NO: 5). In a specific example, a single PKKKRKV (SEQ ID NO: 3) NLS can be attached to the C-terminus of the Cas protein. One or more linkers are optionally included at the fusion site.

[0231] Cas protein can also be operably connected to a cell penetration domain or a protein transduction domain. For example, the cell penetration domain can be derived from HIV-1TAT protein, TLM cell penetration motif from human hepatitis B virus, MPG, Pep-1, VP22, cell penetration peptides or polyarginine peptide sequences from herpes simplex virus. See, for example, WO 2014 / 089290 and WO2013 / 176772, each of which is incorporated herein by reference in its entirety for all purposes. The cell penetration domain can be located at any position within the N-terminus, C-terminus or Cas protein.

[0232] Cas proteins can also be operably linked to heterologous polypeptides for tracking or purification, such as fluorescent proteins, purification tags or epitope tags. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, emerald, Azami green, monomeric Azami green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, lemon yellow, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, azurite, mKalamal, GFPuv, sky blue, T-sky blue (T-sapphire)), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-expressed, DsRed2, DsRed-monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0233] Cas proteins can also be tethered to labeled nucleic acids. This tethering (i.e., physical connection) can be achieved through covalent interactions or non-covalent interactions, and the tethering can be direct (e.g., by direct fusion or chemical conjugation, which can be achieved by modification of cysteine ​​or lysine residues on the protein or intron modification), or can be achieved through one or more intermediate joints or adapter molecules such as streptavidin or aptamers. See, e.g., Pierce et al., (2005) Mini Rev. Med. Chem. 5(1):41-55; Duckworth et al., (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822; Schaeffer and Dixon, (2009) Australian J. Chem. 62(10):1328-1332, Goodman et al., (2009) Chembiochem. 10(9):1551-1557; and Khatwani et al., (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is incorporated herein by reference in its entirety for all purposes. Non-covalent strategies for synthesizing protein-nucleic acid conjugates include biotin-streptavidin and nickel-histidine methods. Covalent protein-nucleic acid conjugates can be synthesized by connecting appropriately functionalized nucleic acids and proteins using a variety of chemical reactions. Some of these chemical reactions involve attaching oligonucleotides directly to amino acid residues (e.g., lysine amines or cysteine ​​thiols) on the surface of proteins, while other more complex schemes require the participation of post-translational modifications of proteins or catalytic or reactive protein domains. Methods for covalently linking proteins to nucleic acids may include, for example, chemical crosslinking of oligonucleotides with protein lysine or cysteine ​​residues, expressed protein connections, chemoenzymatic methods, and the use of photoaptamers. Labeled nucleic acids can be tethered to the C-terminal, N-terminal, or internal regions in Cas proteins. In one example, labeled nucleic acids are tethered to the C-terminal or N-terminal of Cas proteins. Similarly, Cas proteins can be tethered to the 5' end, 3' end, or internal regions in labeled nucleic acids. That is, labeled nucleic acids can be tethered in any orientation and polarity. For example, Cas proteins can be tethered to the 5' end or 3' end of labeled nucleic acids.

[0234] Cas protein can be provided in any form. For example, Cas protein can be provided in the form of protein, such as Cas protein complexed with gRNA. Alternatively, Cas protein can be provided in the form of nucleic acid encoding Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding Cas protein can be codon optimized to be effectively translated into protein in a specific cell or organism. For example, compared with the naturally occurring polynucleotide sequence, the nucleic acid encoding Cas protein can be modified to replace codons with higher usage frequencies in bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells or any other host cells of interest. When the nucleic acid encoding Cas protein is introduced into a cell, the Cas protein can be expressed transiently, conditionally or constitutively in the cell.

[0235] The nucleic acid encoding the Cas protein can be stably integrated into the genome of the cell and operably connected to a promoter active in the cell. Alternatively, the nucleic acid encoding the Cas protein can be operably connected to a promoter in an expression construct. The expression construct comprises any nucleic acid construct capable of guiding the expression of a gene or other nucleic acid sequence of interest (e.g., Cas gene) and can transfer such nucleic acid sequence of interest to a target cell. For example, the nucleic acid encoding the Cas protein can be in a vector including a DNA encoding a gRNA. Alternatively, it can be in a vector or plasmid separated from a vector comprising a DNA encoding a gRNA. The promoter that can be used for the expression construct includes, for example, a promoter active in human cells, human liver cells, or human liver cells. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter can be a bidirectional promoter that drives the expression of the Cas protein in one direction and drives the expression of the guide RNA in another direction. Such bidirectional promoters may consist of: (1) a complete, conventional unidirectional Pol III promoter containing three external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box; and (2) a second basic Pol III promoter comprising a PSE and a TATA box fused to the 5' end of the DSE in the opposite orientation. For example, in the H1 promoter, the DSE is adjacent to the PSE and the TATA box, and the promoter can be bidirectionalized by forming a hybrid promoter, in which reverse transcription is controlled by an additional PSE and a TATA box derived from the U6 promoter. See, for example, US2016 / 0074535, which is incorporated herein by reference in its entirety for all purposes. The use of a bidirectional promoter to simultaneously express genes encoding Cas proteins and guide RNAs allows the generation of compact expression cassettes to facilitate delivery. In a preferred embodiment, the promoter is accepted by regulatory agencies for use in humans. In certain embodiments, the promoter drives expression in liver cells.

[0236] Different promoters can be used to drive Cas expression or Cas9 expression. In some methods, a small promoter is used so that the Cas or Cas9 coding sequence can be adapted to an AAV construct. For example, Cas or Cas9 and one or more gRNAs (e.g., 1 gRNA or 2 gRNAs or 3 gRNAs or 4 gRNAs) can be delivered via LNP-mediated delivery (e.g., in the form of RNA) or adeno-associated virus (AAV)-mediated delivery (e.g., AAV8-mediated delivery). For example, a nuclease agent can be CRISPR / Cas9, and Cas9 mRNA and gRNA (e.g., as described herein, targeting human L-SH5, L-SH18 or L-SH20 genome safe harbor loci) can be delivered via LNP-mediated delivery or AAV-mediated delivery. For example, the nuclease agent can be CRISPR / Cas9, and Cas9 mRNA and gRNA (e.g., as described herein, targeting mouse L-SH5, L-SH18 or L-SH20 genomic safe harbor loci) can be delivered via LNP-mediated delivery or AAV-mediated delivery. Cas or Cas9 and gRNA can be delivered in a single AAV or via two separate AAVs. For example, the first AAV can carry a Cas or Cas9 expression cassette, and the second AAV can carry a gRNA expression cassette. Similarly, the first AAV can carry a Cas or Cas9 expression cassette, and the second AAV can carry two or more gRNA expression cassettes. Alternatively, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably connected to a promoter) and a gRNA expression cassette (e.g., a gRNA coding sequence operably connected to a promoter). Similarly, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably linked to a promoter) and two or more gRNA expression cassettes (e.g., a gRNA coding sequence operably linked to a promoter). Different promoters can be used to drive the expression of gRNA, such as the U6 promoter or a small tRNA Gln. Similarly, different promoters can be used to drive Cas9 expression. For example, a small promoter is used so that the Cas9 coding sequence can be adapted to the AAV construct. Similarly, a small Cas9 protein (e.g., SaCas9 or CjCas9 is used to maximize AAV packaging capacity).

[0237] The Cas protein provided as mRNA can be modified to improve stability and / or immunogenic properties. One or more nucleosides in the mRNA can be modified. The mRNA encoding the Cas protein can also be capped. The Cas mRNA can further include an adenylated (poly-A or poly(A) or poly-adenine) tail. For example, the Cas mRNA can include modifications to one or more nucleosides in the mRNA, the Cas mRNA can be capped, and the Cas mRNA can include a poly(A) tail.

[0238] (3) Guide RNA

[0239] "Guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., Cas9 protein) and targets the Cas protein to a specific location within the target DNA. A guide RNA may include two segments: a "DNA targeting segment" (also called a "guide sequence") and a "protein binding segment". A "segment" includes a segment or region of a molecule, such as a continuous nucleotide segment in an RNA. Some gRNAs, such as those of Cas9, may include two separate RNA molecules: an "activator RNA" (e.g., tracrRNA) and a "targeting factor RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides), which may also be referred to as "single molecule gRNA", "single guide RNA" or "sgRNA". See, for example, WO 2013 / 176772, WO 2014 / 065596, WO2014 / 089290, WO 2014 / 093622, WO 2014 / 099750, WO 2013 / 142578, and WO 2014 / 131833, each of which is incorporated herein by reference in its entirety for all purposes. Guide RNA may refer to a combination of CRISPR RNA (crRNA) or crRNA and trans-activating CRISPR RNA (tracrRNA). CrRNA and tracrRNA may be associated as a single RNA molecule (single guide RNA or sgRNA) or in two separate RNA molecules (dual guide RNA or dgRNA). For example, for Cas9, a single guide RNA may include (e.g., via a linker) a crRNA fused to tracrRNA. For example, for Cpf1 and CasΦ, only crRNA is required to achieve binding to the target sequence. The terms "guide RNA" and "gRNA" include both bimolecular (ie, modular) gRNAs and unimolecular gRNAs. In some methods and compositions disclosed herein, the gRNA is a Streptococcus pyogenes Cas9 gRNA or its equivalent. In some methods and compositions disclosed herein, the gRNA is a Staphylococcus aureus Cas9 gRNA or its equivalent.

[0240] An exemplary bimolecular gRNA comprises a crRNA-like ("CRISPR RNA" or "targeting factor RNA" or "crRNA" or "crRNA repeats") molecule and a corresponding tracrRNA-like ("trans-activating CRISPR RNA" or "activating factor RNA" or "tracrRNA") molecule. The crRNA comprises a DNA targeting segment (single strand) of the gRNA and a nucleotide segment that forms half of the dsRNA duplex of the protein binding segment of the gRNA. Examples of crRNA tails (e.g., for Streptococcus pyogenes Cas9) located downstream (3') of the DNA targeting segment include, essentially consisting of, or consisting of GUUUUAGAGCUAUGCU (SEQ ID NO: 6) or GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 7). Any DNA targeting segment disclosed herein can be joined to the 5' end of SEQ ID NO: 6 or 7 to form a crRNA.

[0241] The corresponding tracrRNA (activator RNA) contains the nucleotide segment of the other half of the dsRNA duplex that forms the protein binding segment of the gRNA. The nucleotide segment of the crRNA is complementary to the nucleotide segment of the tracrRNA and hybridizes with it to form the dsRNA duplex of the protein binding domain of the gRNA. Therefore, each crRNA can be regarded as having a corresponding tracrRNA. Examples of tracrRNA sequences (e.g., for S. pyogenes Cas9) include, consist essentially of, or consist of any of AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU (SEQ ID NO: 8), AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 9), or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 10).

[0242] In a system where both crRNA and tracrRNA are needed, crRNA and corresponding tracrRNA hybridize to form gRNA. In a system where only crRNA is needed, crRNA can be gRNA. CrRNA also provides a single-stranded DNA targeting segment hybridized with the complementary strand of the target DNA. If used for intracellular modification, the exact sequence of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecule will be used. See, e.g., Mali et al., (2013) Science 339(6121):823-826; Jinek et al., (2012) Science 337(6096):816-821; Hwang et al., (2013) Nat. Biotechnol. 31(3):227-229; Jiang et al., (2013) Nat. Biotechnol. 31(3):233-239; and Cong et al., (2013) Science 339(6121):819-823, each of which is incorporated herein by reference in its entirety for all purposes.

[0243] The DNA targeting segment (crRNA) of a given gRNA comprises a nucleotide sequence complementary to the sequence on the complementary strand of the target DNA, as described in more detail below. The DNA targeting segment of gRNA interacts with the target DNA in a sequence-specific manner via hybridization (i.e., base pairing). Therefore, the nucleotide sequence of the DNA targeting segment can be different, and the position in the target DNA with which the gRNA and the target DNA interact is determined. The DNA targeting segment of the subject's gRNA can be modified to hybridize with any desired sequence in the target DNA. Naturally occurring crRNA is different from CRISPR / Cas systems and organisms, but generally contains a targeting segment with a length between 21 and 72 nucleotides, which is flanked by two direct repeats (DR) with a length between 21 and 46 nucleotides (see, for example, WO 2014 / 131833, which is incorporated herein by reference in its entirety for all purposes). For Streptococcus pyogenes, the length of DR is 36 nucleotides, and the length of the targeting segment is 30 nucleotides. The DR located at the 3' position is complementary to and hybridizes with the corresponding tracrRNA, which in turn binds to the Cas protein.

[0244] The length of the DNA targeting segment can be, for example, at least about 12, at least about 15, at least about 17, at least about 18, at least about 19, at least about 20, at least about 25, at least about 30, at least about 35, or at least about 40 nucleotides. The length of such DNA targeting segments can be, for example, about 12 to about 100, about 12 to about 80, about 12 to about 50, about 12 to about 40, about 12 to about 30, about 12 to about 25, or about 12 to about 20 nucleotides. For example, the DNA targeting segment can be about 15 to about 25 nucleotides (e.g., about 17 to about 20 nucleotides or about 17, 18, 19, or 20 nucleotides). See, for example, US2016 / 0024523, which is incorporated herein by reference in its entirety for all purposes. For Cas9 from S. pyogenes, a typical DNA targeting segment is between 16 and 20 nucleotides or between 17 and 20 nucleotides in length. For Cas9 from S. aureus, a typical DNA targeting segment is between 21 and 23 nucleotides in length. For Cpf1, a typical DNA targeting segment is at least 16 nucleotides or at least 18 nucleotides in length.

[0245] In one example, the length of the DNA targeting segment can be about 20 nucleotides. However, shorter and longer sequences can also be used for the targeting segment (e.g., a length of 15-25 nucleotides, such as a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides). The degree of identity between the DNA targeting segment and the corresponding guide RNA target sequence (or the degree of complementarity between the DNA targeting segment and the other strand of the guide RNA target sequence) can be, for example, about 75%, about 80%, about 85%, about 90%, about 95% or about 100%. The DNA targeting segment and the corresponding guide RNA target sequence can include one or more mismatches. For example, the DNA targeting segment of the guide RNA and the corresponding guide RNA target sequence can contain 1-4, 1-3, 1-2, 1, 2, 3 or 4 mismatches (e.g., wherein the total length of the guide RNA target sequence is at least 17, at least 18, at least 19 or at least 20 or more nucleotides). For example, the DNA targeting segment of the guide RNA and the corresponding guide RNA target sequence can contain 1-4, 1-3, 1-2, 1, 2, 3, or 4 mismatches, wherein the total length of the guide RNA target sequence is 20 nucleotides.

[0246] As an example, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 25-27, 45-47, and 228-314 (DNA targeting segment). Alternatively, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 25-27, 45-47, and 228-314 (DNA targeting segment). Alternatively, the guide RNA targeting the genomic safe harbor loci described herein may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 25-27, 45-47, and 228-314. Alternatively, the guide RNA targeting the genomic safe harbor loci described herein may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 25-27, 45-47, and 228-314. Alternatively, the guide RNA targeting the genomic safe harbor locus described herein may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25-27, 45-47 and 228-314 (DNA targeting segment). Alternatively, the guide RNA targeting the genomic safe harbor locus described herein may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25-27, 45-47 and 228-314 (DNA targeting segment). Alternatively, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 25-27, 45-47, and 228-314 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides.Alternatively, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25-27, 45-47, and 228-314 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0247] As an example, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence (DNA targeting segment) as set forth in any one of SEQ ID NOs: 315-404. Alternatively, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence (DNA targeting segment) as set forth in any one of SEQ ID NOs: 315-404. Alternatively, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence (DNA targeting segment) as set forth in any one of SEQ ID NOs: 315-404. Alternatively, the guide RNA targeting the genomic safe harbor loci described herein may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 315-404. Alternatively, the guide RNA targeting the genomic safe harbor loci described herein may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 315-404. Alternatively, the guide RNA targeting the genomic safe harbor loci described herein may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 315-404. Alternatively, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from any one of SEQ ID NOs: 315-404 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from any one of SEQ ID NOs: 315-404 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides.

[0248] As an example, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 25-27 and 45-47 (DNA targeting segment). As an example, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 25-27 (DNA targeting segment). Alternatively, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in any one of SEQ ID NOs: 25-27 and 45-47 (DNA targeting segment). Alternatively, the guide RNA targeting the genomic safe harbor loci described herein may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 25-27 and 45-47. Alternatively, the guide RNA targeting the genomic safe harbor loci described herein may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 25-27 and 45-47. Alternatively, the guide RNA targeting the genomic safe harbor loci described herein may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 25-27 and 45-47. Alternatively, the guide RNA targeting the genomic safe harbor locus described herein may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25-27 and 45-47 (DNA targeting segment). Alternatively, the guide RNA targeting the genomic safe harbor locus described herein may comprise a DNA targeting segment that comprises, consists essentially of, or consists of a sequence that differs from any one of SEQ ID NOs: 25-27 and 45-47 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.Alternatively, a guide RNA targeting a genomic safe harbor locus described herein may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25-27 and 45-47 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0249] As another example, a guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence as shown in any one of SEQ ID NOs: 25, 45, and 228-256 (DNA targeting segment). Alternatively, a guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may include a DNA targeting segment that includes, consists essentially of, or consists of a sequence as shown in any one of SEQ ID NOs: 25, 45, and 228-256 (DNA targeting segment). 17, at least 18, at least 19, or at least 20 consecutive nucleotides. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 25, 45 and 228-256. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 25, 45 and 228-256. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25, 45 and 228-256 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25, 45 and 228-256 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 25, 45, and 228-256 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides.Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25, 45, and 228-256 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0250] As another example, a guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 25, 45, 235, 237, and 246. Alternatively, a guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 25, 45, 235, 237, and 246. 17, at least 18, at least 19, or at least 20 consecutive nucleotides. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 25, 45, 235, 237 and 246. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 25, 45, 235, 237 and 246. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 25, 45, 235, 237 and 246. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 25, 45, 235, 237 and 246.Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from any one of SEQ ID NOs: 25, 45, 235, 237, and 246 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from any one of SEQ ID NOs: 25, 45, 235, 237, and 246 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides.

[0251] As another example, a guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as set forth in SEQ ID NO: 25 or 45. As another example, a guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as set forth in SEQ ID NO: 25. As another example, a guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as set forth in SEQ ID NO: 45. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 25 or 45 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 25 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 45. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence shown in SEQ ID NO: 25 or 45 (DNA targeting segment).Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 25. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 45. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 25 or 45. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 25. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 45. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 25 or 45. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 25. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:45 (DNA targeting segment).Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 25 or 45. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 25. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 45 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment that comprises, consists essentially of, or consists of a sequence that differs from the sequence shown in SEQ ID NO: 25 or 45 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 25 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 45 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment, which DNA targeting segment comprises, consists essentially of, or consists of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 25 or 45 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 25 by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH5 (chromosome 13, coordinates 77460242-77460537) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 45 by no more than 3, no more than 2, or no more than 1 nucleotide.

[0252] As another example, a guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 315-344 (DNA targeting segment). Alternatively, a guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 315-344 (DNA targeting segment). 17, at least 18, at least 19, or at least 20 consecutive nucleotides. Alternatively, the guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 315-344. Alternatively, the guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 315-344. Alternatively, the guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 315-344 (DNA targeting segment). Alternatively, the guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 315-344 (DNA targeting segment). Alternatively, a guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 315-344 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides.Alternatively, a guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 315-344 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0253] As another example, a guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 318, 320, 321, and 341 (DNA targeting segment). Alternatively, a guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 318, 320, 321, and 341 (DNA targeting segment). 17, at least 18, at least 19, or at least 20 consecutive nucleotides. Alternatively, the guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 318, 320, 321, and 341. Alternatively, the guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 318, 320, 321, and 341. Alternatively, the guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 318, 320, 321 and 341 (DNA targeting segment). Alternatively, the guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 318, 320, 321 and 341 (DNA targeting segment).Alternatively, a guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 318, 320, 321 and 341 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, a guide RNA targeting mouse L-SH5 (chromosome 14, coordinates 103,450,397-103,451,396) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 318, 320, 321, and 341 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0254] As another example, a guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence shown in any one of SEQ ID NOs: 26, 46, and 257-285 (DNA targeting segment). Alternatively, a guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may include a DNA targeting segment that includes, consists essentially of, or consists of a sequence shown in any one of SEQ ID NOs: 26, 46, and 257-285 (DNA targeting segment). 17, at least 18, at least 19, or at least 20 consecutive nucleotides. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 26, 46 and 257-285. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 26, 46 and 257-285. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 26, 46 and 257-285 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 26, 46 and 257-285 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 26, 46, and 257-285 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides.Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment, which DNA targeting segment comprises, consists essentially of, or consists of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 26, 46, and 257-285 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0255] As another example, a guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 26, 46, 268, 271, and 280. Alternatively, a guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may include a DNA targeting segment that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 26, 46, 268, 271, and 280. 17, at least 18, at least 19, or at least 20 consecutive nucleotides. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 26, 46, 268, 271 and 280. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 26, 46, 268, 271 and 280. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 26, 46, 268, 271 and 280. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 26, 46, 268, 271 and 280.Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 26, 46, 268, 271 and 280 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment, which DNA targeting segment comprises, consists essentially of, or consists of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 26, 46, 268, 271, and 280 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0256] As another example, a guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as shown in SEQ ID NO: 26 or 46. As another example, a guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as shown in SEQ ID NO: 26. As another example, a guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as shown in SEQ ID NO: 46. Alternatively, a guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may include a DNA targeting segment that includes, consists essentially of, or consists of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence (DNA targeting segment) as shown in SEQ ID NO: 26 or 46. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 26 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 46 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO: 26 or 46 (DNA targeting segment).Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 26. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 46. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 26 or 46. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 26. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 46. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 26 or 46. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 26. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:46 (DNA targeting segment).Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 26 or 46. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 26. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 46 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment that comprises, consists essentially of, or consists of a sequence that differs from the sequence shown in SEQ ID NO: 26 or 46 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 26 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 46 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment, which DNA targeting segment comprises, consists essentially of, or consists of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 26 or 46 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment, which comprises, consists essentially of, or consists of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 26 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH18 (chromosome 6, coordinates 170031084-170031382) may comprise a DNA targeting segment, which comprises, consists essentially of, or consists of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 46 (DNA targeting segment).

[0257] As another example, a guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 345-374 (DNA targeting segment). Alternatively, a guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 345-374 (DNA targeting segment). 17, at least 18, at least 19, or at least 20 consecutive nucleotides. Alternatively, the guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 345-374. Alternatively, the guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 345-374. Alternatively, the guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 345-374 (DNA targeting segment). Alternatively, the guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 345-374 (DNA targeting segment). Alternatively, a guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 345-374 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides.Alternatively, a guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 345-374 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0258] As another example, a guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence (DNA targeting segment) as set forth in any one of SEQ ID NOs: 347, 360, 369, and 370. Alternatively, a guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence (DNA targeting segment) as set forth in any one of SEQ ID NOs: 347, 360, 369, and 370. Alternatively, the guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 347, 360, 369, and 370. Alternatively, the guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 347, 360, 369, and 370. Alternatively, the guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 347, 360, 369 and 370. Alternatively, the guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 347, 360, 369 and 370.Alternatively, a guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 347, 360, 369 and 370 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, a guide RNA targeting mouse L-SH18 (chromosome 17, coordinates 15,226,387-15,227,386) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 347, 360, 369, and 370 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0259] As another example, a guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence as shown in any one of SEQ ID NOs: 27, 47, and 286-314 (DNA targeting segment). Alternatively, a guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence as shown in any one of SEQ ID NOs: 27, 47, and 286-314 (DNA targeting segment). 17, at least 18, at least 19, or at least 20 consecutive nucleotides. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 27, 47 and 286-314. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 27, 47 and 286-314. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 27, 47 and 286-314. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 27, 47 and 286-314. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 27, 47, and 286-314 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides.Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 27, 47, and 286-314 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0260] As another example, a guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310. Alternatively, a guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310. At least 17, at least 18, at least 19, or at least 20 consecutive nucleotides. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306 and 310. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306 and 310. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306 and 310 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306 and 310 (DNA targeting segment).Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306 and 310 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment, which DNA targeting segment comprises, consists essentially of, or consists of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 27, 47, 288, 296, 305, 306, and 310 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0261] As another example, a guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as set forth in SEQ ID NO: 27 or 47. As another example, a guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as set forth in SEQ ID NO: 27. As another example, a guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence (DNA targeting segment) as set forth in SEQ ID NO: 47. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 27 or 47 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 27 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 47. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence shown in SEQ ID NO: 27 or 47 (DNA targeting segment).Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 27. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 47. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 27 or 47. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 27. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 47. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 27 or 47. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 27. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:47 (DNA targeting segment).Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 27 or 47. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) shown in SEQ ID NO: 27. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 47 (DNA targeting segment). Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment that comprises, consists essentially of, or consists of a sequence that differs from the sequence shown in SEQ ID NO: 27 or 47 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 27 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, the guide RNA targeting human L-SH20 (chromosome 9, coordinates 25207412-25207703) may c...

Claims

1. A method for integrating a nucleic acid construct into a genomic safe harbor locus in a human cell, the method comprising administering to the human cell: (a) a nuclease agent or one or more nucleic acids encoding the nuclease agent, wherein the nuclease agent targets a nuclease target site in the genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9; and (b) the nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site and the nucleic acid construct is inserted into the genomic safe harbor locus.

2. A method for expressing a product of interest from a genomic safe harbor locus in a human cell, the method comprising administering to the human cell: (a) a nuclease agent or one or more nucleic acids encoding the nuclease agent, wherein the nuclease agent targets a nuclease target site in the genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes the product of interest, wherein the nuclease agent cleaves the nuclease target site, the nucleic acid construct is inserted into the genomic safe harbor locus to form a modified genomic safe harbor locus, and the product of interest is expressed by the modified genomic safe harbor locus.

3. The method according to claim 1 or 2, wherein the human cell is a liver cell.

4. A method according to any preceding claim, wherein the human cell is a hepatocyte.

5. A method according to any preceding claim, wherein the human cells are in vitro or ex vivo.

6. The method of any one of claims 1 to 4, wherein the human cell is in a subject.

7. A method of integrating a nucleic acid construct into a genomic safe harbor locus in a human cell of a human subject, the method comprising administering to the human subject: (a) a nuclease agent or one or more nucleic acids encoding the nuclease agent, wherein the nuclease agent targets a nuclease target site in the genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9; and (b) the nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site and the nucleic acid construct is inserted into the genomic safe harbor locus.

8. A method of expressing a product of interest from a genomic safe harbor locus in a human cell of a human subject, the method comprising administering to the human subject: (a) a nuclease agent or one or more nucleic acids encoding the nuclease agent, wherein the nuclease agent targets a nuclease target site in the genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) genomic coordinates of about 25207412 to about 25207703 on human chromosome 9; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes the product of interest, wherein the nuclease agent cleaves the nuclease target site, the nucleic acid construct is inserted into the genomic safe harbor locus to form a modified genomic safe harbor locus, and the product of interest is expressed by the modified genomic safe harbor locus.

9. The method according to claim 7 or 8, wherein the human cell is a liver cell.

10. The method according to any one of claims 7 to 9, wherein the human cell is a hepatocyte.

11. The method of any preceding claim, wherein the nuclease agent comprises: (a) Zinc finger nuclease (ZFN); (b) transcription activator-like effector nuclease (TALEN); or (c)(i) a Cas protein or a nucleic acid encoding the Cas protein; and (ii) a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence.

12. The method according to any one of claims 1 to 10, wherein the nuclease agent comprises: (a) a Cas protein or a nucleic acid encoding the Cas protein; and (b) a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence.

13. The method of claim 12, wherein the method comprises administering the guide RNA in the form of RNA.

14. The method of claim 13, wherein the guide RNA comprises at least one modification.

15. The method of claim 14, wherein the at least one modification comprises a 2'-O-methyl modified nucleotide.

16. The method of claim 14 or 15, wherein the at least one modification comprises phosphorothioate bonds between nucleotides.

17. The method according to any one of claims 12 to 16, wherein the guide RNA is a single guide RNA (sgRNA).

18. The method according to any one of claims 12 to 17, wherein the Cas protein is a Cas9 protein.

19. The method according to claim 18, wherein the Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein or Neisseria meningitidis Cas9 protein.

20. The method of claim 18, wherein the Cas protein is derived from Streptococcus pyogenes Cas9 protein.

21. The method of any one of claims 12 to 20, wherein the nucleic acid encoding the Cas protein is codon optimized for expression in mammalian cells or human cells.

22. The method of any one of claims 12 to 21, wherein the method comprises administering the nucleic acid encoding the Cas protein, wherein the nucleic acid comprises mRNA encoding the Cas protein.

23. The method of claim 22, wherein the mRNA encoding the Cas protein comprises at least one modification.

24. The method of any one of claims 12 to 23, wherein the Cas protein or the nucleic acid encoding the Cas protein and the guide RNA or the one or more DNAs encoding the guide RNA are associated with lipid nanoparticles.

25. The method of any preceding claim, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537; (ii) human chromosome 6, coordinates 170031084-170031382; and (iii) human chromosome 9, coordinates 25207412-25207703.

26. The method of any one of claims 12 to 25, wherein the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13.

27. The method of any one of claims 12 to 26, wherein the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

39.

28. The method according to claim 26 or 27, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25, 45 and 228-256; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 25, 45, and 228-256; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 25, 45, and 228-256; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 25, 45, and 228-256.

29. The method according to claim 26 or 27, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 25; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in SEQ ID NO:

25.

30. The method of any one of claims 26 to 29, wherein the DNA targeting segment comprises SEQ ID NO:

25.

31. The method of any one of claims 26 to 30, wherein the DNA targeting segment consists of SEQ ID NO:

25.

32. The method of any one of claims 12 to 25, wherein the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6.

33. The method of any one of claims 12 to 25 and 32, wherein the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

40.

34. The method of claim 32 or 33, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 26, 46 and 257-285; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 26, 46, and 257-285; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 26, 46, and 257-285; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 26, 46, and 257-285.

35. The method of claim 32 or 33, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 26; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in SEQ ID NO:

26.

36. The method of any one of claims 32 to 35, wherein the DNA targeting segment comprises SEQ ID NO:

26.

37. The method of any one of claims 32 to 36, wherein the DNA targeting segment consists of SEQ ID NO:

26.

38. The method of any one of claims 12 to 25, wherein the genomic safe harbor locus is the genomic coordinates of about 25207412 to about 25207703 on human chromosome 9.

39. The method of any one of claims 12 to 25 and 38, wherein the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

41.

40. The method of claim 38 or 39, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 27, 47 and 286-314; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 27, 47, and 286-314; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 27, 47, and 286-314; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 27, 47, and 286-314.

41. The method of claim 38 or 39, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 27; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in SEQ ID NO:

27.

42. The method of any one of claims 38 to 41, wherein the DNA targeting segment comprises SEQ ID NO:

27.

43. The method of any one of claims 38 to 42, wherein the DNA targeting segment consists of SEQ ID NO:

27.

44. The method of any one of claims 1 to 11, wherein the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13.

45. The method of any one of claims 1 to 11, wherein the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

39.

46. ​​The method of any one of claims 1 to 11, wherein the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6.

47. The method of any one of claims 1 to 11, wherein the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

40.

48. The method of any one of claims 1 to 11, wherein the genomic safe harbor locus is the genomic coordinates of about 25207412 to about 25207703 on human chromosome 9.

49. The method of any one of claims 1 to 11, wherein the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

41.

50. A method for integrating a nucleic acid construct into a genomic safe harbor locus in a mouse cell, the method comprising administering to the mouse cell: (a) a nuclease agent or one or more nucleic acids encoding the nuclease agent, wherein the nuclease agent targets a nuclease target site in the genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4; and (b) the nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site and the nucleic acid construct is inserted into the genomic safe harbor locus.

51. A method for expressing a product of interest from a genomic safe harbor locus in a mouse cell, the method comprising administering to the mouse cell: (a) a nuclease agent or one or more nucleic acids encoding the nuclease agent, wherein the nuclease agent targets a nuclease target site in the genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes the product of interest, wherein the nuclease agent cleaves the nuclease target site, the nucleic acid construct is inserted into the genomic safe harbor locus to form a modified genomic safe harbor locus, and the product of interest is expressed by the modified genomic safe harbor locus.

52. The method of claim 50 or 51, wherein the mouse cell is a liver cell.

53. The method of any one of claims 50 to 52, wherein the mouse cell is a hepatocyte.

54. according to the method described in any one of claims 50 to 53, wherein the mouse cell is in vitro or ex vivo.

55. The method of any one of claims 50 to 53, wherein the mouse cell is in a subject.

56. A method of integrating a nucleic acid construct into a genomic safe harbor locus in a mouse cell of a mouse subject, the method comprising administering to the mouse subject: (a) a nuclease agent or one or more nucleic acids encoding the nuclease agent, wherein the nuclease agent targets a nuclease target site in the genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4; and (b) the nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, wherein the nuclease agent cleaves the nuclease target site and the nucleic acid construct is inserted into the genomic safe harbor locus.

57. A method for expressing a product of interest from a genomic safe harbor locus in a mouse cell of a mouse subject, the method comprising administering to the mouse subject: (a) a nuclease agent or one or more nucleic acids encoding the nuclease agent, wherein the nuclease agent targets a nuclease target site in the genomic safe harbor locus, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4; and (b) a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes the product of interest, wherein the nuclease agent cleaves the nuclease target site, the nucleic acid construct is inserted into the genomic safe harbor locus to form a modified genomic safe harbor locus, and the product of interest is expressed by the modified genomic safe harbor locus.

58. The method of claim 56 or 57, wherein the mouse cell is a liver cell.

59. The method of any one of claims 56 to 58, wherein the mouse cell is a hepatocyte.

60. The method of any one of claims 50 to 59, wherein the nuclease agent comprises: (a) Zinc finger nuclease (ZFN); (b) transcription activator-like effector nuclease (TALEN); or (c)(i) a Cas protein or a nucleic acid encoding the Cas protein; and (ii) a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence.

61. The method of any one of claims 50 to 59, wherein the nuclease agent comprises: (a) a Cas protein or a nucleic acid encoding the Cas protein; and (b) a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence.

62. The method of claim 61, wherein the method comprises administering the guide RNA in the form of RNA.

63. The method of claim 62, wherein the guide RNA comprises at least one modification.

64. The method of claim 63, wherein the at least one modification comprises a 2'-O-methyl modified nucleotide.

65. The method of claim 63 or 64, wherein the at least one modification comprises phosphorothioate bonds between nucleotides.

66. The method of any one of claims 61 to 65, wherein the guide RNA is a single guide RNA (sgRNA).

67. The method of any one of claims 61 to 66, wherein the Cas protein is a Cas9 protein.

68. The method of claim 67, wherein the Cas9 protein is derived from a Streptococcus pyogenes Cas9 protein, a Staphylococcus aureus Cas9 protein, a Campylobacter jejuni Cas9 protein, a Streptococcus thermophilus Cas9 protein, or a Neisseria meningitidis Cas9 protein.

69. The method of claim 67, wherein the Cas protein is derived from the Streptococcus pyogenes Cas9 protein.

70. The method of any one of claims 61 to 69, wherein the nucleic acid encoding the Cas protein is codon optimized for expression in mammalian cells or mouse cells.

71. The method of any one of claims 61 to 70, wherein the method comprises administering the nucleic acid encoding the Cas protein, wherein the nucleic acid comprises mRNA encoding the Cas protein.

72. The method of claim 71, wherein the mRNA encoding the Cas protein comprises at least one modification.

73. The method of any one of claims 61 to 72, wherein the Cas protein or the nucleic acid encoding the Cas protein and the guide RNA or the one or more DNA encoding the guide RNA are associated with lipid nanoparticles.

74. The method of any one of claims 50 to 73, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) Mouse chromosome 14, coordinates 103,450,397-103,451,396; (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386; and (iii) Mouse chromosome 4, coordinates 92,827,563-92,828,592.

75. The method of any one of claims 61 to 74, wherein the genomic safe harbor locus is the genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14.

76. The method of any one of claims 61 to 75, wherein the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

405.

77. The method of claim 75 or 76, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 315-344; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 315-344; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 315-344; and / or (IV) The DNA targeting segment consists of any one of SEQ ID NOs: 315-344.

78. The method of any one of claims 61 to 74, wherein the genomic safe harbor locus is the genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17.

79. The method of any one of claims 61 to 74 and 78, wherein the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

406.

80. The method of claim 78 or 79, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 345-374; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 345-374; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 345-374; and / or (IV) The DNA targeting segment consists of any one of SEQ ID NOs: 345-374.

81. The method of any one of claims 61 to 74, wherein the genomic safe harbor locus is the genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4.

82. The method of any one of claims 61 to 74 and 81, wherein the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

407.

83. The method of claim 81 or 82, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 375-404; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 375-404; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 375-404; and / or (IV) The DNA targeting segment consists of any one of SEQ ID NOs: 375-404.

84. The method of any one of claims 50 to 60, wherein the genomic safe harbor locus is the genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14.

85. The method of any one of claims 50 to 60, wherein the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

405.

86. The method of any one of claims 50 to 60, wherein the genomic safe harbor locus is the genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17.

87. The method of any one of claims 50 to 60, wherein the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

406.

88. The method of any one of claims 50 to 60, wherein the genomic safe harbor locus is the genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4.

89. The method of any one of claims 50 to 60, wherein the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

407.

90. The method of any preceding claim, wherein the nucleic acid construct is administered simultaneously with the nuclease agent or the one or more nucleic acids encoding the nuclease agent.

91. The method of any one of claims 1 to 89, wherein the nucleic acid construct is not administered simultaneously with the nuclease agent or the one or more nucleic acids encoding the nuclease agent.

92. The method of claim 91, wherein the nucleic acid construct is administered before the nuclease agent or the one or more nucleic acids encoding the nuclease agent.

93. The method of claim 91, wherein the nucleic acid construct is administered after the nuclease agent or the one or more nucleic acids encoding the nuclease agent.

94. A method according to any preceding claim, wherein the product of interest is a polypeptide of interest.

95. The method of claim 94, wherein the polypeptide of interest comprises a therapeutic polypeptide.

96. The method of claim 94 or 95, wherein the polypeptide of interest is a secreted polypeptide.

97. The method of claim 94 or 95, wherein the polypeptide of interest is an intracellular polypeptide.

98. A method according to any preceding claim, wherein the promoter is active in liver cells.

99. A method according to any preceding claim, wherein the promoter is a tissue-specific promoter.

100. The method of any one of claims 1 to 98, wherein the promoter is a constitutive promoter.

101. The method of any one of claims 1 to 99, wherein the promoter is an inducible promoter.

102. A method according to any preceding claim, wherein the nucleic acid construct does not comprise homology arms.

103. The method of claim 102, wherein the nucleic acid construct is inserted into the target genomic locus via non-homologous end joining.

104. according to the method described in any one of claim 1 to 101, wherein said nucleic acid construct comprises homology arms.

105. The method of claim 104, wherein the nucleic acid construct is inserted into the target genomic locus via homology directed repair.

106. The method of any preceding claim, wherein the nucleic acid construct is single-stranded DNA or double-stranded DNA.

107. The method of claim 106, wherein the nucleic acid construct is single-stranded DNA.

108. A method according to any preceding claim, wherein the nucleic acid construct is in a nucleic acid vector or a lipid nanoparticle.

109. The method of claim 108, wherein the nucleic acid construct is in the nucleic acid vector.

110. The method of claim 109, wherein the nucleic acid vector is a viral vector.

111. The method of claim 109 or 110, wherein the nucleic acid vector is an adeno-associated virus (AAV) vector.

112. The method of claim 111, wherein the AAV vector is a single-stranded AAV (ssAAV) vector.

113. The method of claim 111 or 112, wherein the AAV vector is derived from an AAV8 vector, an AAV3B vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV9 vector, an AAVrh.74 vector, an AAV-DJ vector or an AAVhu.37 vector.

114. The method of any one of claims 111 to 113, wherein the AAV vector is a recombinant AAV8 (rAAV8) vector.

115. The method of claim 114, wherein the AAV vector is a single-stranded rAAV8 vector.

116. A cell prepared by a method according to any preceding claim.

117. A human cell comprising a nucleic acid construct integrated into a genomic safe harbor locus, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, and wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) Genomic coordinates from about 25207412 to about 25207703 on human chromosome 9.

118. The human cell of claim 117, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537; (ii) human chromosome 6, coordinates 170031084-170031382; and (iii) human chromosome 9, coordinates 25207412-25207703.

119. A human cell according to claim 117 or 118, wherein the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13.

120. A human cell according to any one of claims 117 to 119, wherein the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, essentially consists of, or consists of the sequence shown in SEQ ID NO:

39.

121. A human cell according to claim 117 or 118, wherein the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6.

122. A human cell according to any one of claims 117, 118 and 121, wherein the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, is essentially composed of or is composed of the sequence shown in SEQ ID NO:

40.

123. A human cell according to claim 117 or 118, wherein the genomic safe harbor locus is the genomic coordinates of about 25207412 to about 25207703 on human chromosome 9.

124. A human cell according to any one of claims 117, 118 and 123, wherein the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, is essentially composed of or is composed of the sequence shown in SEQ ID NO:

41.

125. A mouse cell comprising a nucleic acid construct integrated into a genomic safe harbor locus, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, and wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) Genomic coordinates from about 92,827,563 to about 92,828,592 on mouse chromosome 4.

126. The mouse cell of claim 125, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) Mouse chromosome 14, coordinates 103,450,397-103,451,396; (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386; and (iii) Mouse chromosome 4, coordinates 92,827,563-92,828,592.

127. A mouse cell according to claim 125 or 126, wherein the genomic safe harbor locus is the genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14.

128. A mouse cell according to any one of claims 125 to 127, wherein the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, is essentially composed of, or is composed of the sequence shown in SEQ ID NO:

405.

129. A mouse cell according to claim 125 or 126, wherein the genomic safe harbor locus is a genomic coordinate of about 15,226,387 to about 15,227,386 on mouse chromosome 17.

130. A mouse cell according to any one of claims 125, 126 and 129, wherein the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, is essentially composed of, or is composed of the sequence shown in SEQ ID NO:

406.

131. A mouse cell according to claim 125 or 126, wherein the genomic safe harbor locus is a genomic coordinate of about 92,827,563 to about 92,828,592 on mouse chromosome 4.

132. A mouse cell according to any one of claims 125, 126 and 131, wherein the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, is essentially composed of, or is composed of the sequence shown in SEQ ID NO:

407.

133. The cell of any one of claims 116 to 132, wherein the cell is a liver cell.

134. The cell of any one of claims 116 to 133, wherein the cell is a hepatocyte.

135. The cell of any one of claims 116 to 134, wherein the product of interest is expressed.

136. The cell of any one of claims 116 to 135, wherein the product of interest is a polypeptide of interest.

137. The cell of claim 136, wherein the polypeptide of interest comprises a therapeutic polypeptide.

138. The cell of claim 136 or 137, wherein the polypeptide of interest is a secreted polypeptide.

139. The cell of claim 136 or 137, wherein the polypeptide of interest is an intracellular polypeptide.

140. The cell of any one of claims 116 to 139, wherein the promoter is active in liver cells.

141. The cell of any one of claims 116 to 140, wherein the promoter is a tissue-specific promoter.

142. The cell of any one of claims 116 to 140, wherein the promoter is a constitutive promoter.

143. The cell of any one of claims 116 to 141, wherein the promoter is an inducible promoter.

144. A composition comprising a guide RNA or a DNA encoding a guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in a genomic safe harbor locus and a protein binding segment that binds to a Cas protein, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) Genomic coordinates from about 25207412 to about 25207703 on human chromosome 9.

145. The composition of claim 144, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537; (ii) human chromosome 6, coordinates 170031084-170031382; and (iii) human chromosome 9, coordinates 25207412-25207703.

146. The composition of claim 144 or 145, wherein the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13.

147. The composition of any one of claims 144 to 146, wherein the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

39.

148. The composition of claim 146 or 147, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 25, 45 and 228-256; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 25, 45, and 228-256; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 25, 45, and 228-256; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 25, 45, and 228-256.

149. The composition of claim 146 or 147, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 25; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in SEQ ID NO:

25.

150. The composition of any one of claims 146 to 149, wherein the DNA targeting segment comprises SEQ ID NO:

25.

151. The composition of any one of claims 146 to 150, wherein the DNA targeting segment consists of SEQ ID NO:

25.

152. The composition of claim 144 or 145, wherein the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6.

153. A composition according to any one of claims 144, 145 and 152, wherein the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, is essentially composed of, or is composed of the sequence shown in SEQ ID NO:

40.

154. The composition of claim 152 or 153, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 26, 46 and 257-285; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 26, 46, and 257-285; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 26, 46, and 257-285; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 26, 46, and 257-285.

155. The composition of claim 152 or 153, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 26; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in SEQ ID NO:

26.

156. The composition of any one of claims 152 to 155, wherein the DNA targeting segment comprises SEQ ID NO:

26.

157. The composition of any one of claims 152 to 156, wherein the DNA targeting segment consists of SEQ ID NO:

26.

158. The composition of claim 144 or 145, wherein the genomic safe harbor locus is the genomic coordinates of about 25207412 to about 25207703 on human chromosome 9.

159. The composition of any one of claims 144, 145 and 158, wherein the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

41.

160. The composition of claim 158 or 159, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 27, 47 and 286-314; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 27, 47, and 286-314; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 27, 47, and 286-314; and / or (IV) the DNA targeting segment consists of any one of SEQ ID NOs: 27, 47, and 286-314.

161. The composition of claim 158 or 159, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 27; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in SEQ ID NO:

27.

162. The composition of any one of claims 158 to 161, wherein the DNA targeting segment comprises SEQ ID NO:

27.

163. The composition of any one of claims 158 to 162, wherein the DNA targeting segment consists of SEQ ID NO:

27.

164. A composition comprising a guide RNA or a DNA encoding a guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in a genomic safe harbor locus and a protein binding segment that binds to a Cas protein, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) Genomic coordinates from about 92,827,563 to about 92,828,592 on mouse chromosome 4.

165. The composition of claim 164, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) Mouse chromosome 14, coordinates 103,450,397-103,451,396; (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386; and (iii) Mouse chromosome 4, coordinates 92,827,563-92,828,592.

166. The composition of claim 164 or 165, wherein the genomic safe harbor locus is the genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14.

167. A composition according to any one of claims 164 to 166, wherein the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, essentially consists of, or consists of the sequence shown in SEQ ID NO:

405.

168. The composition of claim 166 or 167, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 315-344; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 315-344; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 315-344; and / or (IV) The DNA targeting segment consists of any one of SEQ ID NOs: 315-344.

169. The composition of claim 164 or 165, wherein the genomic safe harbor locus is the genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17.

170. The composition of any one of claims 164, 165 and 169, wherein the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

406.

171. The composition of claim 169 or 170, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 345-374; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 345-374; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 345-374; and / or (IV) The DNA targeting segment consists of any one of SEQ ID NOs: 345-374.

172. The composition of claim 164 or 165, wherein the genomic safe harbor locus is genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4.

173. A composition according to any one of claims 164, 165 and 172, wherein the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, is essentially composed of, or is composed of the sequence shown in SEQ ID NO:

407.

174. The composition of claim 172 or 173, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 375-404; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 375-404; and / or (III) the DNA targeting segment comprises any one of SEQ ID NOs: 375-404; and / or (IV) The DNA targeting segment consists of any one of SEQ ID NOs: 375-404.

175. The composition of any one of claims 144 to 174, wherein the composition comprises the DNA encoding the guide RNA.

176. The composition of claim 175, wherein the DNA encoding the guide RNA is in a nucleic acid vector.

177. The composition of claim 176, wherein the nucleic acid vector is a viral vector.

178. The composition of claim 176 or 177, wherein the nucleic acid vector is an adeno-associated virus (AAV) vector.

179. The composition of claim 178, wherein the AAV vector is a single-stranded AAV (ssAAV) vector.

180. The composition of claim 178 or 179, wherein the AAV vector is derived from an AAV8 vector, an AAV3B vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV9 vector, an AAVrh.74 vector, an AAV-DJ vector or an AAVhu.37 vector.

181. The composition of any one of claims 178 to 180, wherein the AAV vector is a recombinant AAV8 (rAAV8) vector.

182. The composition of claim 181, wherein the AAV vector is a single-stranded rAAV8 vector.

183. The composition of any one of claims 144 to 174, wherein the composition comprises the guide RNA in the form of RNA.

184. The composition of claim 183, wherein the guide RNA comprises at least one modification.

185. The composition of claim 184, wherein the at least one modification comprises a 2'-O-methyl modified nucleotide.

186. The composition of claim 184 or 185, wherein the at least one modification comprises phosphorothioate bonds between nucleotides.

187. The composition of any one of claims 144 to 186, wherein the guide RNA is a single guide RNA (sgRNA).

188. The composition of any one of claims 144 to 187, further comprising the Cas protein or a nucleic acid encoding the Cas protein.

189. The composition of claim 188, wherein the composition comprises the Cas protein.

190. The composition of claim 188, wherein the composition comprises the nucleic acid encoding the Cas protein.

191. The composition of claim 190, wherein the nucleic acid encoding the Cas protein is codon optimized for expression in mammalian cells or human cells.

192. The composition of claim 190 or 191, wherein the nucleic acid encoding the Cas protein comprises DNA encoding the Cas protein.

193. The composition of claim 192, wherein the DNA encoding the guide RNA is in a nucleic acid vector.

194. The composition of claim 193, wherein the nucleic acid vector is a viral vector.

195. The composition of claim 193 or 194, wherein the nucleic acid vector is an adeno-associated virus (AAV) vector.

196. The composition of claim 195, wherein the AAV vector is a single-stranded AAV (ssAAV) vector.

197. The composition of claim 195 or 196, wherein the AAV vector is derived from an AAV8 vector, an AAV3B vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV9 vector, an AAVrh.74 vector, an AAV-DJ vector or an AAVhu.37 vector.

198. The composition of any one of claims 195 to 197, wherein the AAV vector is a recombinant AAV8 (rAAV8) vector.

199. The composition of claim 198, wherein the AAV vector is a single-stranded rAAV8 vector.

200. The composition of claim 190 or 191, wherein the nucleic acid encoding the Cas protein comprises an mRNA encoding the Cas protein.

201. The composition of claim 200, wherein the mRNA encoding the Cas protein comprises at least one modification.

202. A composition according to any one of claims 144 to 201, wherein the Cas protein or the nucleic acid encoding the Cas protein and the guide RNA or the one or more DNAs encoding the guide RNA are associated with lipid nanoparticles.

203. A composition according to any one of claims 144 to 202, wherein the Cas protein is a Cas9 protein.

204. The composition of claim 203, wherein the Cas9 protein is derived from a Streptococcus pyogenes Cas9 protein, a Staphylococcus aureus Cas9 protein, a Campylobacter jejuni Cas9 protein, a Streptococcus thermophilus Cas9 protein, or a Neisseria meningitidis Cas9 protein.

205. A composition according to claim 203, wherein the Cas protein is derived from Streptococcus pyogenes Cas9 protein.

206. according to the composition described in any one in claim 144 to 202, wherein said composition also comprises nucleic acid construct, wherein said nucleic acid construct comprises the nucleic acid that is operably connected to promoter, and wherein said nucleic acid encodes the interested product.

207. The composition of claim 206, wherein the product of interest is a polypeptide of interest.

208. The composition of claim 207, wherein the polypeptide of interest comprises a therapeutic polypeptide.

209. The composition of claim 207 or 208, wherein the polypeptide of interest is a secreted polypeptide.

210. The composition of claim 207 or 208, wherein the polypeptide of interest is an intracellular polypeptide.

211. A composition according to any one of claims 206 to 210, wherein the promoter is active in liver cells.

212. A composition according to any one of claims 206 to 211, wherein the promoter is a tissue-specific promoter.

213. A composition according to any one of claims 206 to 211, wherein the promoter is a constitutive promoter.

214. A composition according to any one of claims 206 to 211, wherein the promoter is an inducible promoter.

215. A composition according to any one of claims 206 to 214, wherein the nucleic acid construct does not comprise a homology arm.

216. A composition according to any one of claims 206 to 214, wherein the nucleic acid construct comprises a homology arm.

217. The composition of any one of claims 206 to 216, wherein the nucleic acid construct is single-stranded DNA or double-stranded DNA.

218. A composition according to claim 217, wherein the nucleic acid construct is single-stranded DNA.

219. according to the composition described in any one of claims 206 to 218, wherein the nucleic acid construct is in a nucleic acid carrier or a lipid nanoparticle.

220. The composition of claim 219, wherein the nucleic acid construct is in the nucleic acid vector.

221. The composition of claim 220, wherein the nucleic acid vector is a viral vector.

222. A composition according to claim 220 or 221, wherein the nucleic acid vector is an adeno-associated virus (AAV) vector.

223. The composition of claim 222, wherein the AAV vector is a single-stranded AAV (ssAAV) vector.

224. The composition of claim 222 or 223, wherein the AAV vector is derived from an AAV8 vector, an AAV3B vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV9 vector, an AAVrh.74 vector, an AAV-DJ vector or an AAVhu.37 vector.

225. The composition of any one of claims 222 to 224, wherein the AAV vector is a recombinant AAV8 (rAAV8) vector.

226. A composition according to claim 225, wherein the AAV vector is a single-stranded rAAV8 vector.

227. A nucleic acid comprising a genomic safe harbor locus comprising an integrated nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, and wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates from about 77460242 to about 77460537 on human chromosome 13; (ii) genomic coordinates of about 170031084 to about 170031382 on human chromosome 6; and (iii) Genomic coordinates from about 25207412 to about 25207703 on human chromosome 9.

228. The nucleic acid of claim 227, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) human chromosome 13, coordinates 77460242-77460537; (ii) human chromosome 6, coordinates 170031084-170031382; and (iii) human chromosome 9, coordinates 25207412-25207703.

229. The nucleic acid of claim 227 or 228, wherein the genomic safe harbor locus is the genomic coordinates of about 77460242 to about 77460537 on human chromosome 13.

230. The nucleic acid of any one of claims 227 to 229, wherein the genomic safe harbor locus is human chromosome 13, coordinates 77460242-77460537, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

39.

231. The nucleic acid of claim 227 or 228, wherein the genomic safe harbor locus is the genomic coordinates of about 170031084 to about 170031382 on human chromosome 6.

232. The nucleic acid of any one of claims 227, 228 and 231, wherein the genomic safe harbor locus is human chromosome 6, coordinates 170031084-170031382, or comprises, is essentially composed of, or is composed of the sequence shown in SEQ ID NO:

40.

233. The nucleic acid of claim 227 or 228, wherein the genomic safe harbor locus is the genomic coordinates of about 25207412 to about 25207703 on human chromosome 9.

234. The nucleic acid of any one of claims 227, 228 and 233, wherein the genomic safe harbor locus is human chromosome 9, coordinates 25207412-25207703, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

41.

235. A nucleic acid comprising a genomic safe harbor locus comprising an integrated nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid encodes a product of interest, and wherein the genomic safe harbor locus is selected from the following genomic locations: (i) genomic coordinates of about 103,450,397 to about 103,451,396 on mouse chromosome 14; (ii) genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17; and (iii) Genomic coordinates from about 92,827,563 to about 92,828,592 on mouse chromosome 4.

236. The nucleic acid of claim 235, wherein the genomic safe harbor locus is selected from the following genomic locations: (i) Mouse chromosome 14, coordinates 103,450,397-103,451,396; (ii) mouse chromosome 17, coordinates 15,226,387-15,227,386; and (iii) Mouse chromosome 4, coordinates 92,827,563-92,828,592.

237. The nucleic acid of claim 235 or 236, wherein the genomic safe harbor locus is genomic coordinates from about 103,450,397 to about 103,451,396 on mouse chromosome 14.

238. The nucleic acid of any one of claims 235 to 237, wherein the genomic safe harbor locus is mouse chromosome 14, coordinates 103,450,397-103,451,396, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

405.

239. The nucleic acid of claim 235 or 236, wherein the genomic safe harbor locus is the genomic coordinates of about 15,226,387 to about 15,227,386 on mouse chromosome 17.

240. The nucleic acid of any one of claims 235, 236 and 239, wherein the genomic safe harbor locus is mouse chromosome 17, coordinates 15,226,387-15,227,386, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

406.

241. The nucleic acid of claim 235 or 236, wherein the genomic safe harbor locus is genomic coordinates of about 92,827,563 to about 92,828,592 on mouse chromosome 4.

242. The nucleic acid of any one of claims 235, 236 and 241, wherein the genomic safe harbor locus is mouse chromosome 4, coordinates 92,827,563-92,828,592, or comprises, consists essentially of, or consists of the sequence shown in SEQ ID NO:

407.

243. A nucleic acid according to any one of claims 227 to 242, wherein the product of interest is a polypeptide of interest.

244. The nucleic acid of claim 243, wherein the polypeptide of interest comprises a therapeutic polypeptide.

245. The nucleic acid of claim 243 or 244, wherein the polypeptide of interest is a secreted polypeptide.

246. The nucleic acid of claim 243 or 244, wherein the polypeptide of interest is an intracellular polypeptide.

247. A nucleic acid according to any one of claims 227 to 246, wherein the promoter is active in liver cells.

248. A nucleic acid according to any one of claims 227 to 247, wherein the promoter is a tissue-specific promoter.

249. A nucleic acid according to any one of claims 227 to 247, wherein the promoter is a constitutive promoter.

250. A nucleic acid according to any one of claims 227 to 248, wherein the promoter is an inducible promoter.

251. A method for identifying one or more genomic safe harbor loci in a tissue or cell type of interest, the method comprising: (a) identifying accessible genomic loci in the tissue or cell type of interest; (b) selecting the genomic loci identified in step (a) based on safety criteria, functional silencing criteria and / or structural accessibility criteria; and (c) selecting the genomic loci identified in step (b) based on guide RNA availability, efficacy, and specificity.

252. The method of claim 251, wherein step (a) comprises identifying accessible genomic loci using a transposase-accessible chromatin assay with high-throughput sequencing.

253. A method according to claim 251 or 252, wherein step (a) comprises using DNase I hypersensitive site sequencing to identify accessible genomic loci.

254. A method according to any one of claims 251 to 253, wherein step (a) comprises identifying accessible genomic loci using a transposase-accessible chromatin assay with high-throughput sequencing and DNase I hypersensitive site sequencing.

255. A method according to any one of claims 251 to 254, wherein step (b) comprises selecting the genomic loci identified in step (a) based on safety criteria, functional silencing criteria, and structural accessibility criteria.

256. A method according to any one of claims 251 to 255, wherein the safety criterion in step (b) includes selecting the genomic locus only when the genomic locus is more than 300 kb from any cancer-related gene, more than 300 kb from any miRNA or small RNA, and more than 50 kb from the 5' end of any gene.

257. A method according to any one of claims 251 to 256, wherein the functional silencing criterion in step (b) includes selecting the genomic locus only when the genomic locus is more than 50 kb from any replication origin and more than 50 kb from any ultra-conserved element.

258. A method according to any one of claims 251 to 257, wherein the structural accessibility criterion in step (b) includes selecting the genomic locus only when the genomic locus is not in a copy number variable region.

259. The method of any one of claims 251 to 258, wherein the efficacy in step (c) comprises editing efficiency in the tissue or cell type of interest.

260. A method according to any one of claims 251 to 259, further comprising analyzing markers in the chromatin environment of the genomic loci selected in step (c) to disqualify any genomic loci in regions predicted to be regulatory regions, heterochromatin regions, regions involved in the three-dimensional organization of chromatin, or transcriptionally active regions.

261. The method of claim 260, wherein the markers for the regulatory region include H3K4me1, H3K27ac, and H3K4me3.

262. A method according to claim 260 or 261, wherein the marker for the heterochromatin region includes H3K9me3.

263. A method according to any one of claims 260 to 262, wherein the markers for the regions involved in the three-dimensional organization of chromatin include CTCF.

264. The method of any one of claims 260 to 263, wherein the markers for the transcriptionally active regions include H3K36me3, PolR2A, RNASeq-, and RNASeq+.

265. The method of any one of claims 251 to 264, wherein step (a) comprises identifying accessible genomic loci using a transposase-accessible chromatin assay with high-throughput sequencing and DNase I hypersensitive site sequencing, wherein step (b) comprises selecting the genomic loci identified in step (a) based on safety criteria, functional silencing criteria, and structural accessibility criteria, wherein the safety criteria in step (b) comprises selecting the genomic loci only when the genomic loci are more than 300 kb from any cancer-related gene, more than 300 kb from any miRNA or small RNA, and more than 50 kb from the 5' end of any gene, wherein the functional silencing criteria in step (b) comprises selecting the genomic loci only when the genomic loci are more than 50 kb from any replication origin and more than 50 kb from any ultra-conserved element, and wherein the structural accessibility criteria in step (b) comprises selecting the genomic loci only when the genomic loci are not in a copy number variable region, and The method further comprises analyzing markers in the chromatin environment of the genomic loci selected in step (c) to disqualify any genomic loci in regions predicted to be regulatory regions, heterochromatin regions, regions involved in the three-dimensional organization of chromatin, or transcriptionally active regions, wherein the markers for the regulatory regions comprise H3K4me1, H3K27ac, and H3K4me3, wherein the markers for the heterochromatin regions comprise H3K9me3, wherein the markers for the regions involved in the three-dimensional organization of chromatin comprise CTCF, and wherein the markers for the transcriptionally active regions comprise H3K36me3, PolR2A, RNASeq-, and RNASeq+.

266. The method of any one of claims 251 to 265, wherein the method is used to identify one or more genomic safe harbor loci in a human tissue or cell type of interest.

267. The method of any one of claims 251 to 266, wherein the tissue or cell type of interest is liver.

268. The method of any one of claims 251 to 266, wherein the tissue or cell type of interest is a hematopoietic cell.

Images