Application of transmembrane transporter in improving gibberellin production of microorganism
By heterologously expressing NPF and SWEET transmembrane transporters in Gibberellin, the production of GA4 and GA7 was increased, solving the problems of low yield and high production cost in existing technologies, and achieving more efficient and stable gibberellin production.
Patent Information
- Application Number
- CN202311032638.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-16
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2043-08-16
AI Technical Summary
The low yield and high production cost of GA4 and GA7 in the existing technology limit their large-scale application in industrial production.
By heterologously expressing transmembrane transporters of the NPF and SWEET families in Gibberella fujikura, the efflux capacity of gibberellins was enhanced and the production of GA4 and GA7 was increased.
When NPF is heterologously expressed in wild-type Gibberellin, GA3 production decreases by 20-80% and GA4+7 production increases by 30-120%; when SWEET is heterologously expressed, GA3 production decreases by 20-100% and GA4+7 production increases by 40-500%, achieving more efficient, more stable and safer gibberellin production.
Smart Images

Figure CN119490574B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to application of a transmembrane transporter protein in improving gibberellin yield of microorganisms. BACKGROUND
[0002] Economic crops such as rice, corn and sugarcane will appear the phenomenon of plant overgrowth after being infected by pathogenic fungi such as Fusarium graminearum, Gibberella fujikuroi and Fusarium moniliforme, i.e. "foolish seedling disease". The disease will cause plant overgrowth, less fruit setting or no fruit setting, and even cause plant shedding or death, which seriously harms the development of agricultural economy in China.
[0003] With in-depth research on the foolish seedling disease, it is found that the main factor causing plant overgrowth is a kind of plant growth hormone, i.e. gibberellin (GAs) secreted by pathogenic fungi. Gibberellin is a kind of tetracyclic diterpenoid compounds. Corresponding to the plant overgrowth, the use of ppm level of gibberellin will bring the phenomena of seed dormancy elimination, seed germination acceleration, crop yield improvement, fruit setting promotion and dwarf overcoming, which are beneficial to plant growth.
[0004] So far, there are 136 kinds of gibberellins found from various organisms, and only a few gibberellins such as GA1, GA3, GA4 and GA7 belonging to the free type have strong physiological activity. Among them, GA3 has the highest activity and is the most widely used, and is the only gibberellin product that is currently commercially mass-produced. However, GA3 has too high activity, and excessive use will cause plant overgrowth. In recent years, GA 4+7 The application of GA4 and GA7 in flower and fruit protection, dormancy breaking and the like has attracted attention. However, GA4 and GA7 have differences or even opposite effects in action. GA7 will strongly inhibit flower bud formation, while GA4 will not inhibit flower bud formation and has a promoting effect. Therefore, the mixed use of GA4 and GA7 can realize complementary advantages. The common mixed dosage form on the market is GA4 and GA7 in different proportions, and the dosage form rich in GA7 has a market sales price 20% higher than that of the dosage form containing the same content of GA4. Therefore, compared with GA3, GA4 and GA7 are more efficient, more stable, safer and have higher economic value.
[0005] However, the yield of GA4 and GA7 is low and the production cost is high in industrial production, which limits the large-scale application thereof. Therefore, new technology is urgently needed to improve the yield of GA4 and GA7. SUMMARY
[0006] In order to solve the problems of low yield and high production cost of GA4 and GA7 in the prior art, the application provides application of a transmembrane transporter protein in improving gibberellin yield of microorganisms, which increases the gibberellin efflux capacity by overexpressing the transporter proteins of the NPF and SWEET families, and improves the yield of GA4 and GA7.
[0007] To achieve the above-mentioned purpose, the first aspect of the present application provides the use of a transmembrane transporter in improving gibberellin production of microorganisms, wherein the transmembrane transporter is at least one protein selected from the NPF and the SWEET protein family. The transmembrane transporter is a kind of non-permeable biological membrane composed of lipid bilayer, which can mediate processes including generation of electrochemical potential, energy generation, metabolism, signal transduction, etc. The NPF transmembrane protein existing in Arabidopsis belongs to the Peptide Transporter (PTR) family. The SWEET protein existing at the same time is initially considered to be a kind of new sugar transporter, which helps the transmembrane transport of sugars such as glucose, fructose and sucrose.
[0008] Specifically, the microorganism includes Fusarium fujikuroi. The industrial production of gibberellins mainly relies on the liquid fermentation of Fusarium fujikuroi. In addition, some species belonging to Fusarium, such as Fusarium moniliforme, and some species belonging to Aspergillus, such as Aspergillus niger, have also been confirmed to have the potential for industrial synthesis of gibberellins. Stable and high-yield strains are crucial for industrial production.
[0009] Specifically, the gibberellin includes at least one of GA4, GA7. In combination Figure 1 , the synthesis sites of GA3, GA4 and GA7 in Fusarium fujikuroi are in the cytoplasm, and the biosynthesis thereof starts from acetyl coenzyme A (Acetyl-CoA) synthesized by TCA cycle, and then IPP and its isomer dimethylallyl diphosphate (DMAPP) are synthesized by the mevalonate pathway. Subsequently, the precursor digermyl diphosphate (GGDP) is synthesized by the catalysis of synthetase via GDP and farnesyl diphosphate (FPP). Under the action of gibberellin synthesis gene cluster, two molecules of GGDP are cyclized to synthesize pyrophosphate cubebate (CDP), and then kaurene is produced. Kaurenoic acid is produced by stepwise oxidation of P450 monooxygenase on C-19, and then GA12-seminol is produced by oxidation at C-7α and C-6β positions. GA 14 , GA 14 is converted into GA4 by oxidation, GA7 is produced by desaturation, and GA3 is converted into GA3 by hydroxylation.
[0010] Preferably, the transmembrane transporter NPF is at least one selected from NPF1.2, NPF2.5, NPF5.5 and NPF8.1; more preferably, NPF8.1;
[0011] The amino acid sequence of NPF1.2 is shown in SEQ ID NO. 1,
[0012] The NPF2.5 amino acid sequence is shown as SEQ ID NO. 2,
[0013] The NPF5.5 amino acid sequence is shown as SEQ ID NO. 3,
[0014] The NPF8.1 amino acid sequence is shown as SEQ ID NO. 4.
[0015] Preferably, the transmembrane transporter SWEET is selected from at least one of SWEET1, SWEET5; more preferably SWEET1;
[0016] The SWEET1 amino acid sequence is shown as SEQ ID NO. 5,
[0017] The SWEET5 amino acid sequence is shown as SEQ ID NO. 6.
[0018] Specifically, the application is to heterologously express the transmembrane transporter in Gibberella jujuba by constructing an expression plasmid.
[0019] In a second aspect of the present application, a Gibberella jujuba engineering strain with high yield of gibberellins GA4 and GA7 is provided, which is obtained by the following method: constructing a transmembrane transporter NPF or SWEET gene fragment into an expression plasmid, and transforming it into Gibberella jujuba.
[0020] In a third aspect of the present application, a method for improving the yield of microbial gibberellins by transmembrane transporter NPF or SWEET is provided, which comprises the following steps:
[0021] Constructing a transmembrane transporter NPF or SWEET gene fragment into an expression plasmid;
[0022] Transforming the expression plasmid into Gibberella jujuba protoplast to obtain transformants;
[0023] Preparing a seed liquid of the transformants, inoculating the seed liquid into a fermentation medium for culture, and preparing GA4 and GA7.
[0024] Specifically, the gene fragment of the transmembrane transporter NPF or SWEET is reverse transcribed from Arabidopsis thaliana RNA.
[0025] Preferably, the method comprises the following steps:
[0026] (1) Extracting Arabidopsis thaliana RNA, reverse transcribing to obtain the corresponding cDNA, and using it as a template to PCR to obtain a transmembrane transporter NPF or SWEET gene fragment; linearizing a vector plasmid pUC-fFuCas9-HTBNLS-hph, and one-step cloning to connect the target transporter NPF or SWEET gene fragment with the vector to construct an expression plasmid;
[0027] (2) Collecting the enzyme solution of the wild type Gibberella fujikuroi to prepare a protoplast suspension; transforming the expression plasmid constructed in step (1) into the protoplast to obtain transformants;
[0028] (3) Coating the transformants prepared in step (2) on a MYG agar plate containing hygromycin, and culturing at 28℃ for 3-5 days; picking single colonies to inoculate into a seed culture medium, and culturing at 28℃, 250 rpm for 48 h to obtain a seed liquid; inoculating the seed liquid into a fermentation culture medium, and culturing at 28℃, 250 rpm for 7 days; collecting the supernatant of the bacterial solution, and determining the yield of GA4 and GA7 after dilution.
[0029] Preferably, the MYG culture medium is composed of the following: maltose 4-6 g / L, yeast extract 4-6 g / L, glucose 8-12 g / L, sucrose 168-173 g / L, agar 19-21 g / L, and water as a solvent.
[0030] Preferably, the seed culture medium is composed of the following: corn starch 18-22 g / L, sucrose 14-16 g / L, peanut powder 14-16 g / L, soybean meal 2-4 g / L, KH2PO4 0.8-1.2 g / L, MgSO4 0.8-1.2 g / L, and water as a solvent.
[0031] Preferably, the fermentation culture medium is composed of the following: corn starch 60-90 g / L, rice flour 70-100 g / L, soybean meal 3-7 g / L, peanut powder 3-7 g / L, KH2PO4 0.3-0.7 g / L, K2SO4 0.3-0.7 g / L, MgSO4 0.3-0.7 g / L, and water as a solvent. 4` 7H2O 0.10-0.12 g / L, and water as a solvent.
[0032] The present application has the following beneficial effects: the present application is based on the heterologous expression of Arabidopsis thaliana transporters in Gibberella fujikuroi, and a plurality of NPF and SWEET family transporters are screened according to the characteristics of the transporters capable of transporting gibberellins. It is found that the heterologous expression of NPF in wild type Gibberella fujikuroi reduces the yield of GA3 by 20-80%, and the yield of GA4 and GA7 is increased by 30-120%; the heterologous expression of SWEET in wild type Gibberella fujikuroi reduces the yield of GA3 by 20-100%, and the yield of GA4 and GA7 is increased by 40-500%. 4+7 4+7 The present application provides a new idea for increasing the yield of gibberellins, effectively increases the yield of GA 4+7 by using heterologous overexpression of transmembrane transporters NPF or SWEET, and obtains more efficient, more stable, safer, and more economically valuable gibberellins, which has a positive role in promoting the industrial production. BRIEF DESCRIPTION OF DRAWINGS
[0033] Figure 1 The biosynthesis pathway of gibberellins GA3, GA4 and GA7.
[0034] Figure 2 Fig. 8 is a cDNA verification gel for NPF1.2, NPF2.5, NPF5.5, NPF8.1, SWEET1 and SWEET5 in Examples 1-6.
[0035] Figure 3 Fig. 9 is a schematic diagram of construction of pUC-fFuCas9-HTB NLS -hph-NPF8.1 expression plasmid in Example 1.
[0036] Figure 4 Fig. 10 is a comparison of G. fujikuroi under a microscope before and after protoplast preparation in Example 1.
[0037] Figure 5 Fig. 11 is a high performance liquid chromatography method for determining the yield of GA3, GA4 and GA7 in Examples 1-6. DETAILED DESCRIPTION
[0038] The present application will be described in detail below with specific specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present application from the disclosure of the specification. The present application can also be implemented or applied by different specific embodiments, and the details in the specification can be modified or changed based on different views and applications without departing from the spirit of the present application. It should be noted that the following examples and features in the examples can be combined with each other without conflict. The methods used in the examples of the present application are conventional methods unless otherwise specified, and the reagents used can be obtained from commercial channels.
[0039] Example 1:
[0040] The present embodiment provides the application of transmembrane transporter NPF8.1 in improving the yield of microbial gibberellins.
[0041] The present embodiment also provides a G. fujikuroi engineering strain for high-yield gibberellins GA4 and GA7.
[0042] The present embodiment also provides a method for improving the yield of microbial gibberellins by transmembrane transporter NPF8.1. The specific experimental process is as follows:
[0043]
Construction of transmembrane transporter NPF8.1 gene fragment to expression plasmid
[0044] The root, stem, tender leaf, flower bud and other tissue samples of fresh Arabidopsis thaliana plants are immediately frozen in liquid nitrogen, the tissues are fully ground and broken by a pestle, the treated tissues are used to extract total RNA according to the instructions of the Nuclenex RC101-01 kit, the concentration of the extracted RNA is determined, and the RNA sample is used for reverse transcription according to the instructions of the Nuclenex R223-01 kit. The reverse transcription product is verified by running a nucleic acid gel, and the cDNA fragment of the target transport protein NPF8.1 is obtained. Figure 2 The reverse transcription sample can be stored at -80°C for long-term preservation. The cDNA fragment of NPF8.1 is amplified by using the upstream and downstream primers F4 and R4, and the gene fragment of NPF8.1 is obtained. The amino acid sequence of NPF8.1 is shown in SEQ ID NO. 4. The vector plasmid used is pUC-fFuCas9-HTB NLS -hph, the primers F7 and R7 are designed to linearize the plasmid. The previously obtained NPF8.1 gene fragment is connected to the linearized vector by one-step cloning, and the expression plasmid pUC-fFuCas9-HTB NLS -hph-NPF8.1 Figure 3 ) is obtained.
[0045]
Transformation of the expression plasmid into G. fujikuroi protoplasts to obtain transformants
[0046] Preparation of protoplasts:
[0047] Wild type G. fujikuroi strain was inoculated from plate to liquid YEPD medium (YEPD: yeast extract powder 3 g / L, peptone 10 g / L, glucose 20 g / L) and cultured at 28°C with 250 rpm for 2 days. Cell wall enzyme solution 10 mL was prepared according to the formula of Snailase 5 g / L, Driselase 5 g / L, Yatalase 10 g / L, and filtered through membrane for standby. YEPD bacterial solution was poured into Buchner funnel padded with filter paper in a clean bench, and filtered to dryness. The bacterial body was washed twice with 0.8 M NaCl solution, and filtered to dryness again. About 1 g of bacterial body was scraped into a 50 mL centrifuge tube, and the enzyme solution prepared in advance was added. The enzyme solution was placed in a 30°C, 180 rpm shaker for 4 hours, and manually shaken every half hour to ensure uniformity. The enzyme solution was filtered into a sterilized 50 mL centrifuge tube through double-layer magic filter cloth, and the remaining bacterial body and insoluble matter were removed. The solution was centrifuged at 900 x g for 10 min at 4°C, and the supernatant was discarded. This step and subsequent operations required the solution to be placed on ice. 10 mL of 0.8 M sodium chloride solution was added, resuspended on ice, centrifuged at 900 x g for 10 min at 4°C, and the supernatant was discarded. This step was repeated twice. 10 mL of STC solution (STC solution: sorbitol 45.54 g, Tris-base 0.303 g, CaCl2 1.378 g were weighed on an electronic balance and dissolved in 250 mL ultrapure water, and the pH was adjusted to 7.5 with 1 M HCl) was added, resuspended on ice, centrifuged at 900 x g for 10 min at 4°C, and the supernatant was discarded. This step was repeated twice. 2 mL of STC solution was added, resuspended on ice and diluted to 10 7 individuals / mL, and examined under a microscope Figure 4 ), and placed in a 4°C refrigerator for standby.
[0048] Transformation of protoplasts:
[0049] Transformation group: take 150 μL protoplast suspension, 90 μL expression plasmid, 60 μL 60% PEG6000 solution in 2 mL centrifuge tube, mix evenly, plasmid reaches 10 μg; control group: take 150 μL protoplast suspension, 90 μL STC solution and 60 μL 60% PEG6000 solution in 2 mL centrifuge tube, mix evenly. The above mixed 2 mL centrifuge tube is placed on ice, and is inverted and mixed evenly every 10 min for 3 times, 1.5 mL 60% PEG6000 solution is added, and is mixed evenly by blowing, and is placed at room temperature for 25 min. In a 50 mL centrifuge tube, 6 mL of 100 ng / μL hygromycin-resistant soft agar MYG liquid medium (MYG: maltose 5 g / L, yeast extract 5 g / L, glucose 10 g / L, sucrose 171 g / L, agar 20 g / L, solvent is water), 3 mL of preheated STC solution and one transformation system are added, mixed evenly, and then poured into the MYG hard agar medium with the same concentration of hygromycin; the above plate is transferred to a 28°C incubator, and is vertically cultured for 5 d, thereby obtaining a high-yield Gibberella fujikuroi engineering fungus of gibberellins GA4 and GA7.
[0050] Gibberellin metabolism
[0051] The high-yield Gibberella fujikuroi engineering fungus of gibberellins GA4 and GA7 is cultured on the MYG hard agar medium for 5 days, the transformants are picked into the seed culture medium with a toothpick, and are cultured at 250 rpm for 2 days, and then are transferred to a fermentation medium with an inoculation amount of 6%, and are cultured at 28°C and 250 rpm for 7 days, and then the bacterial liquid supernatant is collected, is diluted, and is determined for the yield of GA3, GA4 and GA7 by using high performance liquid chromatography, and the results are shown in Table 1 and Figure 5 .
[0052] The culture media used in the experiment include:
[0053] Seed culture medium: corn starch 20 g / L, sucrose 15 g / L, peanut powder 15 g / L, soybean meal 3 g / L, KH2PO4 1 g / L, MgSO4 1 g / L, solvent is water.
[0054] Fermentation medium: corn starch 75 g / L, rice flour 87.5 g / L, soybean meal 5 g / L, peanut powder 5 g / L, KH2PO4 0.5 g / L, K2SO4 0.5 g / L, MgSO4·7H2O 0.11 g / L, solvent is water.
[0055] Examples 2-6:
[0056] Compared with Example 1, Examples 2-6 respectively use NPF1.2, NPF2.5, NPF5.5, SWEET1, SWEET5 gene fragments to replace NPF8.1, and the remaining operation steps are the same. The high-yield gibberellin GA4, GA7 G. bilimbata engineering bacteria of the prepared transformants are fermented under the same conditions, the bacterial liquid supernatant is collected, diluted, and then the yields of GA3, GA4 and GA7 are determined by high performance liquid chromatography. The results are shown in Table 1 and Figure 5 .
[0057] The primers used in Examples 1-6 are as follows:
[0058] NPF1.2 upstream and downstream primers F1, R1:
[0059] F1: ATGGAGAACCCTCCCAATGAAAC
[0060] R1: AAGATCTAAGTCCAGTTGTTAAAACCAATTAA
[0061] NPF2.5 upstream and downstream primers F2, R2:
[0062] F2: ATGGCTGATTCAAAATCTGGTGACACGG
[0063] R2: CAAGATCCTAAAGATGTTAAAACCTAG
[0064] NPF5.5 upstream and downstream primers F3, R3:
[0065] F3: ATGGCGTCTTTTCTCCGAGTCATCGTTC
[0066] R3: CTACACAGAAGCGATTATCCTTCGATC
[0067] NPF8.1 upstream and downstream primers F4, R4:
[0068] F4: ATGGAAGAAAAAGATGTGTATACGCA
[0069] R4: TCAATGTGCTCGACCAACAGCTT
[0070] SWEET1 upstream and downstream primers F5, R5:
[0071] F5: ATGAACATCGCTCACACTATC
[0072] R5: AACTTGAAGGTCTTGCTTTCCATT
[0073] F6, R6 for SWEET5:
[0074] F6: ATGACGGACCCCCACACCGCCCGGACGATCGTCG
[0075] R6: TGGAATCGAACTTGGCCAGGCTTGA
[0076] F7, R7 for linearization:
[0077] F7: GCAAGAGGGCAGGATCCAAT
[0078] R7: GGTCATGTCTGCTCAAGCGG
[0079] Comparative Example 1:
[0080] The wild-type G. fujikuroi was fermented under the same conditions as in Example 1, and the supernatant of the mycelium liquid was collected, diluted, and then subjected to high performance liquid chromatography to determine the yields of GA3, GA4, and GA7. The results are shown in Table 1 and Figure 5 .
[0081] Comparative Examples 2-3:
[0082] Comparative Examples 2-3 used NPF 4.1 and SWEET 10 gene fragments to replace NPF8.1, respectively, instead of Example 1, and the remaining steps were the same. The transformants prepared were fermented under the same conditions, and the supernatant of the mycelium liquid was collected, diluted, and then subjected to high performance liquid chromatography to determine the yields of GA3, GA4, and GA7. The results are shown in Table 1. The amino acid sequence of NPF 4.1 is shown in SEQ ID NO. 7, and the amino acid sequence of SWEET 10 is shown in SEQ ID NO. 8.
[0083] The following primers were used in Comparative Examples 2-3:
[0084] F8, R8 for NPF 4.1:
[0085] F1: ATGCAGATCGAGATGGAGGAGAA
[0086] R1: TTAGTAGCGCTTGGCCCAGAAGA
[0087] F9, R9 for SWEET 10:
[0088] F2: ATGGCTATCAGCCAGGCCGTC
[0089] R2: TTAGTTCTTAGAGATGAGGAAGACCT
[0090] It was found that, compared with Comparative Examples 1-3, the transmembrane transport proteins NPF1.2, NPF2.5, NPF5.5, NPF8.1, SWEET1 and SWEET5 can effectively transport gibberellins GA4 and GA7, and increase the yield of GA 4+7 Among them, the yield of GA3 decreased by 20-80% in the wild-type Gibberella fujikuroi heterologously expressing NPF, and the yield of GA 4+7 increased by 30-120%; the yield of GA3 decreased by 20-100% in the wild-type Gibberella fujikuroi heterologously expressing SWEET, and the yield of GA 4+7 increased by 40-500%. In combination with Table 1, the transmembrane transport protein SWEET1 in Example 5 precisely and efficiently transported the more economically valuable GA7 before converting GA3, avoided the production of GA3, made the product separation simple and convenient, achieved the purpose of reducing cost and increasing efficiency, and had a positive role in promoting the industrial production of GA7.
[0091] Table 1. Gibberellin metabolism
[0092]
[0093] The above-described examples only describe the preferred embodiments of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope of the present application.
Claims
1. Application of a transmembrane transporter protein in improving gibberellin production of microorganisms, characterized in that, the transmembrane transporter protein is SWEET1, and the amino acid sequence of the SWEET1 is shown as SEQ ID NO. 5; the microorganism is Gibberella fujikuroi; the gibberellin is at least one of GA4 and GA7.
2. Use according to claim 1, characterized in that, the application comprises heterologous expression of the transmembrane transporter protein in Gibberella fujikuroi by means of construction of an expression plasmid.
3. A Gibberella fujikuroi engineering strain with high gibberellins GA4 and GA7 production, characterized in that, The application is obtained by the following method: a transmembrane transporter protein SWEET1 gene fragment is constructed into an expression plasmid, and the expression plasmid is transformed into Gibberella fujikuroi; the amino acid sequence of the SWEET1 is shown as SEQ ID NO.
5.
4. A method for increasing gibberellin production in a microorganism by a transmembrane transporter SWEET1, characterized by, The application comprises the following steps: a transmembrane transporter protein SWEET1 gene fragment is constructed into an expression plasmid; the expression plasmid is transformed into Gibberella fujikuroi protoplasts to obtain transformants; seed liquid of the transformants is prepared, the seed liquid is inoculated into a fermentation medium for culture, and GA4 and GA7 are prepared; the amino acid sequence of the SWEET1 is shown as SEQ ID NO.
5.
5. The method of claim 4, wherein, The fermentation medium is composed of corn starch 60~90 g / L, rice flour 70~100 g / L, soybean meal 3~7 g / L, peanut powder 3~7 g / L, KH2PO4 0.3~0.7 g / L, K2SO4 0.3~0.7 g / L, MgSO 4` 7H2O 0.10~0.12 g / L, and the solvent is water.
Citation Information
Patent Citations
Application of transmembrane transporter as growth regulation switch in genetically engineered bacteria
CN117777249A