A method for improving xylose metabolism capacity by regulating the expression of reductive TCA pathway genes through an oxygen-responsive metabolic switch

Abstract

The present invention discloses a method for improving xylose metabolism capacity by regulating the expression of genes of the reductive TCA pathway through an oxygen-responsive metabolic switch, and belongs to the technical field of gene recombination and metabolic engineering. The method disclosed in the present invention is achieved by regulating the expression of genes related to the rTAC pathway using an oxygen-responsive metabolic switch that is low-expressed under aerobic conditions and high-expressed under anaerobic conditions. The engineered bacteria constructed by this method can achieve efficient metabolism of xylose during anaerobic fermentation using xylose as a single substrate or corn straw hydrolysate with glucose and xylose as the main carbon sources as a substrate. The method of improving xylose metabolism capacity of the present invention provides a technical reference for constructing engineered bacteria that can efficiently metabolize xylose-containing substrates such as corn straw hydrolysate under anaerobic fermentation production conditions.

Description

Technical Field

[0001] The present invention relates to the technical field of gene recombination and metabolic engineering, and more specifically to a method for improving xylose metabolism capacity by regulating the expression of genes in the reduction TCA pathway through an oxygen-responsive metabolic switch. Background Art

[0002] Lignocellulose is the main component of agricultural waste such as crop straw, weeds and wood waste, and is the most abundant biomass resource on earth. According to incomplete statistics, the annual output of crop straw in China alone is close to 900 million tons, accounting for about 25% of the global straw output. If agricultural waste is burned or discarded at will, it will not only waste resources but also cause secondary harm to the environment. Lignocellulose can be used to produce various chemicals such as alcohols, microbial oils and organic acids by releasing sugars through hydrolysis and fermentation. Lignocellulosic biomass is mainly composed of cellulose, hemicellulose and lignin. The hydrolysis products of its main components, cellulose and hemicellulose, are mainly mixtures of various hexoses and pentoses, mainly including glucose (accounting for 50%-70%) and xylose (accounting for 30%-40%). However, compared with glucose generated by cellulose hydrolysis, only a few natural microorganisms can metabolize xylose produced by hemicellulose hydrolysis, and these microorganisms generally have disadvantages such as low efficiency in the co-utilization of xylose and glucose and inhibition of carbon catabolism, resulting in low yields of target products and a small number of xylose-derived products, which greatly limits the bioconversion efficiency of lignocellulose and the application potential of lignocellulose resources. Therefore, achieving efficient co-utilization of xylose by microorganisms is crucial for the large-scale industrial utilization of lignocellulosic biomass.

[0003] Escherichia coli is an extremely important industrial microorganism that is widely used in the production of biomedicine, biofuels, and bio-based chemicals. Escherichia coli has natural glucose and xylose metabolic pathways and is the preferred chassis for the production of chemicals from lignocellulose hydrolysates. However, due to the carbon catabolism inhibition effect, when glucose and xylose are used as fermentation substrates at the same time, Escherichia coli will preferentially utilize glucose and cannot metabolize xylose at the same time. In order to eliminate the carbon catabolism inhibition effect, the commonly used strategy is to inactivate glucose-specific phosphotransferase (ptsG), but the metabolic efficiency of xylose is still very low. In addition, the metabolism of xylose requires a large amount of ATP and there are rate-limiting enzymes, especially under anaerobic fermentation conditions where cells cannot synthesize ATP quickly, the transport and metabolic rate of xylose is relatively low, which seriously hinders the industrialization process of using Escherichia coli to metabolize xylose-containing substrates (such as cellulose hydrolysate) to produce chemicals. In addition, Saccharomyces cerevisiae is also an important industrial microorganism widely used in many production fields such as food, beverages, and biofuels. However, since natural Saccharomyces cerevisiae itself cannot effectively metabolize xylose, this also limits its application in the production of chemicals using xylose-containing substrates. Based on this, providing a genetic engineering technology for efficiently metabolizing xylose is crucial for transforming important industrial microorganisms such as Escherichia coli and Saccharomyces cerevisiae to efficiently metabolize xylose to produce chemicals.

[0004] Therefore, providing a method for improving xylose metabolism capacity by regulating the expression of reductive TCA pathway genes through an oxygen-responsive metabolic switch is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a method for improving xylose metabolism ability by regulating the expression of genes in the reductive TCA (Tricarboxylic acid cycle) pathway through an oxygen-responsive metabolic switch, which effectively improves the xylose metabolism efficiency of Escherichia coli and Saccharomyces cerevisiae when they utilize xylose alone or co-utilize glucose and xylose, and provides a technical reference for constructing genetically engineered bacteria that efficiently metabolize xylose to produce chemicals.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A method for improving xylose metabolism capacity by regulating the expression of genes in the reductive TCA pathway through an oxygen-responsive metabolic switch, wherein the oxygen-responsive metabolic switch is a gene expression regulatory element that is low-expressed under aerobic conditions and highly expressed under anaerobic conditions in Escherichia coli or Saccharomyces cerevisiae;

[0008] The gene expression regulatory element comprises an expression regulatory element P of the anaerobic glycerol-3-phosphate dehydrogenase subunit A gene used to regulate the gene expression of Escherichia coli. glpA and the expression regulatory element P of fumarate reductase flavonoid subunit frdA; or an expression control element P of the alcohol dehydrogenase 1 gene (ADH1) used to control gene expression in Saccharomyces cerevisiae ADH1 .

[0009] Furthermore, the expression control element P glpA The sequence is shown as 1-230 bp in SEQ ID NO.30;

[0010] The expression control element P frdA The sequence is shown as 1-300 bp in SEQ ID NO.54;

[0011] The expression control element P ADH1 The sequence is shown as 9-263bp in SEQ ID NO.61.

[0012] Furthermore, the method of improving xylose metabolism capacity by regulating the expression of genes in the reductive TCA pathway through an oxygen-responsive metabolic switch,

[0013] The fermentation is carried out using recombinant Escherichia coli BX-08 or BX-09; or using recombinant Saccharomyces cerevisiae SC-04.

[0014] The recombinant Escherichia coli BX-08 uses Escherichia coli BW25113 as the starting strain, sequentially knocks out the glucose-specific enzyme IIBC component gene ptsG, the lactate dehydrogenase gene ldhA, the alcohol dehydrogenase gene adhE, the phosphotransacetylase gene pta, and the overexpressed phosphoenolpyruvate carboxykinase gene pck; by expressing the regulatory element P glpA The malate dehydrogenase gene mdh, fumarase B gene fumB and fumarate reductase gene cluster frdABCD were overexpressed respectively.

[0015] Malate dehydrogenase gene mdh, fumarase B gene fumB and fumarate reductase gene cluster frdABCD are rTCA pathway genes.

[0016] Knocking out the gene of the glucose-specific enzyme IIBC component (ptsG) can relieve carbon catabolite repression and enable Escherichia coli to metabolize glucose and xylose simultaneously; knocking out the lactate dehydrogenase (ldhA) gene, alcohol dehydrogenase (adhE) gene, phosphotransacetylase (pta) gene and overexpressing the phosphoenolpyruvate carboxykinase (pck) gene can effectively reduce the accumulation of by-products lactate, ethanol and acetate, thereby adjusting more carbon flow to the reductive TCA cycle of Escherichia coli.

[0017] The recombinant Escherichia coli BX-09 uses Escherichia coli BW25113 as the starting strain, sequentially knocks out the glucose-specific enzyme IIBC component gene ptsG, the lactate dehydrogenase gene ldhA, the alcohol dehydrogenase gene adhE, the phosphotransacetylase gene pta, and the overexpressed phosphoenolpyruvate carboxykinase gene pck; and then, through the expression regulatory element P glpA Overexpression of malate dehydrogenase gene mdh and fumarase B gene fumB respectively, through the expression of regulatory element P frdA Overexpression of the fumarate reductase gene cluster frdABCD.

[0018] The recombinant Saccharomyces cerevisiae SC-04 is based on Saccharomyces cerevisiae S288C as the starting strain, overexpresses the xylose reductase gene XYL1 and the xylitol dehydrogenase gene XYL2 from Pichia stipitis, overexpresses the xylulose kinase gene XKS1 from Yarrowia lipolytica, and overexpresses the expression regulatory element P ADH1 Regulated fumarase B gene fumB.

[0019] In Saccharomyces cerevisiae, heterologous expression of the xylose reductase-encoding gene XYL1 and the xylitol dehydrogenase-encoding gene XYL2 from Pichia stipitis and heterologous expression of the xylulokinase-encoding gene XKS1 from Yarrowia lipolytica enables Saccharomyces cerevisiae to metabolize xylose.

[0020] P by oxygen-responsive metabolic switch ADH1 The expression of Escherichia coli fumarase B gene fumB can enhance the rTCA expression of Saccharomyces cerevisiae, thereby improving its ability to metabolize xylose.

[0021] Further, the phosphoenolpyruvate carboxykinase gene pck sequence is shown in SEQ ID NO.22;

[0022] With expression control element P glpA The malate dehydrogenase gene mdh is shown in SEQ ID NO.30;

[0023] With expression control element P glpA The fumarase B gene fumB is shown in SEQ ID NO.38;

[0024] With expression control element P glpA The fumarate reductase gene cluster frdABCD is shown in SEQ ID NO.46;

[0025] With expression control element P frdAThe fumarate reductase gene cluster frdABCD is shown in SEQ ID NO.54;

[0026] Contains xylose reductase gene XYL1, xylitol dehydrogenase gene XYL2, xylulose kinase gene XKS1 and expression regulatory element P ADH1 The regulated fragment of the fumarase B gene fumB is shown in SEQ ID NO.61.

[0027] Further, the recombinant Escherichia coli BX-08.

[0028] Further, the recombinant Escherichia coli BX-09.

[0029] Further, the recombinant Saccharomyces cerevisiae SC-04.

[0030] Furthermore, the recombinant Escherichia coli BX-08, the recombinant Escherichia coli BX-09 or the recombinant Saccharomyces cerevisiae SC-04 is used in the efficient metabolism of xylose.

[0031] Furthermore, a method for efficiently metabolizing xylose is provided, which utilizes the recombinant Escherichia coli BX-08, the recombinant Escherichia coli BX-09 or the recombinant Saccharomyces cerevisiae SC-04 for anaerobic fermentation; the carbon source used for fermentation is xylose or corn straw hydrolyzate.

[0032] The main carbon sources in other cellulose hydrolysates are also glucose and xylose. The genetically engineered bacteria constructed by the present invention can also efficiently utilize the main fermentable sugars in other cellulose hydrolysates, namely glucose and xylose, as carbon sources, providing technical support for the efficient fermentation of cellulose hydrolysates to produce chemicals.

[0033] It can be known from the above technical solutions that, compared with the prior art, the present invention discloses a method for improving xylose metabolism capacity by regulating the expression of genes of the reducing TCA pathway through an oxygen-responsive metabolic switch, and specifically provides a method for constructing a recombinant Escherichia coli or a recombinant Saccharomyces cerevisiae that can metabolize xylose more efficiently. The engineered bacteria constructed by this method can achieve efficient metabolism of xylose in the anaerobic fermentation process with xylose as a substrate alone or with corn straw hydrolyzate with glucose and xylose as the main carbon source as a substrate. The method of improving xylose metabolism capacity of the present invention provides a technical reference for constructing engineered bacteria that can efficiently metabolize xylose as a substrate alone or with glucose and xylose as the main carbon source as a substrate under anaerobic fermentation production conditions. DETAILED DESCRIPTION

[0034] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] LB liquid medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L. The corresponding LB solid medium is supplemented with 2% agar.

[0036] Example 1

[0037] A method for improving xylose metabolism capacity by regulating the expression of reductive TCA pathway genes through an oxygen-responsive metabolic switch, comprising the following steps:

[0038] Using Escherichia coli BW25113 as the starting strain, the glucose-specific enzyme IIBC component gene ptsG, lactate dehydrogenase gene ldhA, alcohol dehydrogenase gene adhE, phosphotransacetylase gene pta and overexpressed phosphoenolpyruvate carboxykinase gene pck were knocked out in sequence.

[0039] (1) Knockout of the glucose-specific enzyme IIBC component (ptsG) gene

[0040] (1-1) Step 1: Preparation of knockout fragment ΔptsG-1000.

[0041] Using Escherichia coli BW25113 genomic DNA as a template, primers ΔptsG-1 and ΔptsG-2 were used to amplify a PCR product containing the upstream homology arm gene fragment F; primers ΔptsG-3 and ΔptsG-4 were used to amplify a PCR product containing the downstream homology arm gene fragment r.

[0042] The specific sequences of primers ΔptsG-1 and ΔptsG-2 are as follows:

[0043] ΔptsG-1: 5'-cattgtgaccttccgtaatgcgg-3'; SEQ ID NO. 1.

[0044] ΔptsG-2: 5'-ctgccttagtctttacgttctcacgcgtggcaag-3'; SEQ ID NO. 2.

[0045] The specific sequences of primers ΔptsG-3 and ΔptsG-4 are as follows:

[0046] ΔptsG-3: 5'-cgtgagaacgtaaagactaaggcagccagatggc-3'; SEQ ID NO. 3.

[0047] ΔptsG-4: 5'-tgagcaggataatgtcgctcagtcc-3'; SEQ ID NO. 4.

[0048] PCR amplification system: Primestar enzyme (Takara) 25 µL, upstream and downstream primers 2 µL each, template 1 µL, ddH2O 20 µL.

[0049] PCR amplification program: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 57°C for 30 seconds, extension at 72°C for 10 seconds / kb, 35 cycles; extension at 72°C for 10 minutes.

[0050] After agarose gel electrophoresis and product recovery, the upstream homology arm gene fragment F and the downstream homology arm gene fragment r were obtained.

[0051] Using upstream homology arm gene fragment F and downstream homology arm gene fragment r as substrates, ΔptsG-1 and ΔptsG-4 as primers, PCR amplification was performed to obtain a PCR product containing the knockout fragment ΔptsG-1000. The amplification system and amplification conditions were the same as above.

[0052] The PCR product was subjected to agarose gel electrophoresis and product recovery to obtain the knockout fragment ΔptsG-1000.

[0053] (1-2) Step 2: Prepare knockout plasmid ΔptsG-gRNA.

[0054] Using E. coli BW25113 genomic DNA as a template, ΔptsG-gRNA-F and gRNA-R as primers, amplification was performed to obtain a PCR product containing the ΔptsG-gRNA gene fragment. The amplification system and amplification conditions were the same as above.

[0055] The specific sequences of ΔptsG-gRNA-F and gRNA-R are as follows:

[0056] ΔptsG-gRNA-F: 5'-GGACTAGGTGATGCCATAGGCAACAACTGgttttagagctagaaatagcaagtt-3'; SEQ ID NO. 5.

[0057] gRNA-R: 5'-CCGctcgagtagggataacagggt-3'; SEQ ID NO. 6.

[0058] The PCR product was subjected to agarose gel electrophoresis and product recovery to obtain the ΔptsG-gRNA gene fragment.

[0059] The ΔptsG-gRNA gene fragment and pEcgRNA plasmid were digested with endonucleases XhoI and SpeI at 37°C for 2 hours, respectively. The digestion products were recovered to obtain ΔptsG-gRNA digestion fragments and digested pEcgRNA fragments, respectively.

[0060] ΔptsG-gRNA gene fragment digestion system: ΔptsG-gRNA gene fragment 40 µL, XhoI enzyme 1 µL, SpeI 1 µL, rCutSmart 5 µL, ddH2O 3 µL.

[0061] pEcgRNA plasmid restriction enzyme digestion system: pEcgRNA plasmid 40 µL, XhoI enzyme 1 µL, SpeI 1 µL, rCutSmart 5 µL, ddH2O 3 µL.

[0062] The ΔptsG-gRNA digested fragment and the digested pEcgRNA fragment were ligated under the action of T4 DNA ligase at 22°C for 2 hours to obtain a ligation product.

[0063] T4 DNA ligase ligation system: 2 µL of ΔptsG-gRNA digested fragment, 1 µL of T4 DNA ligase, 1 µL of T4 DNA ligase buffer, 1 µL of digested pEcgRNA fragment, and 5 µL of ddH2O.

[0064] 10 µL of the above ligation product was transferred into the commercial trans 10 competent medium (Quanshijin Company) according to the instructions, revived at 37°C for 1 hour, spread on LB solid medium plates containing 50 µg / mL spectinomycin, and cultured at 37°C for 12 hours to obtain single colonies.

[0065] The above single colony was inoculated into LB liquid culture medium containing 50 µg / mL spectinomycin and cultured for 12 hours. The plasmid was extracted and sequenced. The sequencing results showed that the knockout plasmid ΔptsG-gRNA was the one with the ptsG gene knocked out.

[0066] (1-3) Step 3: Knockout of ptsG gene: Electroporate the plasmid pEcCas into BW25113 host competent cells, resuscitate at 37℃, spread on LB plates containing 50 µg / mL kanamycin sulfate, and culture at 37℃ until a single colony grows. Inoculate the single colony carrying the pEcCas plasmid in an LB tube (with 50 µg / mL kanamycin sulfate resistance) and culture at 37℃ for 12 h.

[0067] Transfer 1 mL of bacterial solution from the above test tube to a vial containing 20 mL of LB liquid medium, add 50 µg / mL kanamycin sulfate and a final concentration of 10 mM arabinose, and culture at 37°C until the bacterial solution concentration reaches OD = 0.6~0.8.

[0068] The competent cells were prepared using the E. coli in the above bacterial solution. 100 ng ΔptsG-gRNA knockout plasmid and 400 ng knockout fragment ΔptsG-1000 were added to 100 µL of competent cells for electroporation. After electroporation, 1 mL of pre-cooled LB liquid culture medium was immediately added, and the cells were revived at 37°C for 1 h. The cells were spread on a double-resistance LB plate containing 50 µg / mL kanamycin sulfate and 50 µg / mL spectinomycin, and cultured at 37°C until a single colony grew.

[0069] A single colony was picked for sequencing verification, and the sequencing results showed that the strain with the ptsG gene knocked out was the obtained strain with the ptsG gene knocked out.

[0070] (1-4) Step 4: Elimination of knockout plasmid ΔptsG-gRNA and pEcCas:

[0071] Pick 3 to 6 strains with ptsG knockout gene and place them in a test tube containing 3 mL LB liquid medium, add 50 µg / mL kanamycin sulfate and a final concentration of 20mM rhamnose, and culture for about 12 hours. Pipette 10 µL of the bacterial solution in the above test tube and transfer it to a test tube containing 3 mL of antibiotic-free LB liquid medium and culture for about 12 hours, then streak it on an LB plate containing 20g / L sucrose and culture at 37°C until a single colony grows.

[0072] The same colony was picked and spotted on non-antibiotic LB, monoclonal antibody LB containing 50 µg / mL kanamycin sulfate, and monoclonal antibody LB containing 50 µg / mL spectinomycin, and cultured overnight at 37°C. If only the non-antibiotic plate grew at the corresponding position, it indicated that the knockout plasmid ΔptsG-gRNA and pEcCas contained in the bacteria had been eliminated. The strain was named engineered strain BX-01 for the next experiment.

[0073] (2) Knockout of ldhA, adhE and pta genes

[0074] The knockout of ldhA, adhE and pta genes was carried out in the same manner as the knockout of the glucose-specific enzyme IIBC component (ptsG) gene, except that the primers used to prepare the knockout fragments and the upstream primers used to prepare the knockout plasmids were different.

[0075] ① Based on the engineered strain BX-01, the ldhA gene was knocked out. The primers used to prepare the knockout fragments were ΔldhA-1 and ΔldhA-2, ΔldhA-3 and ΔldhA-4; the upstream primer used to prepare the knockout plasmid was ΔldhA-gRNA-F. The strain after knocking out the ldhA gene was named engineered strain BX-02.

[0076] The specific primer sequences are as follows:

[0077] ΔldhA-1: 5'-caagcagaatcaagttctaccg-3'; SEQ ID NO. 7.

[0078] ΔldhA-2: 5'-agcggcaagaaagactttctccagtgatgttg-3'; SEQ ID NO. 8.

[0079] ΔldhA-3: 5'-agaaagtctttcttgccgctcccctgcattc-3'; SEQ ID NO. 9.

[0080] ΔldhA-4: 5'-tgtctgttttgcggtcgcc-3'; SEQ ID NO. 10.

[0081] ΔldhA-gRNA-F: 5'-GGACTAGTGATACGCGCGGTGAATACGGgttttagagctagaaatagcaagtt-3'; SEQ ID NO. 11.

[0082] ② Based on the engineered strain BX-02, the adhE gene was knocked out. The primers used to prepare the knockout fragments were ΔadhE-1 and ΔadhE-2, ΔadhE-3 and ΔadhE-4; the upstream primer used to prepare the knockout plasmid was ΔadhE-gRNA-F. The strain after the adhE gene was knocked out was named the engineered strain BX-03.

[0083] The specific primer sequences are as follows:

[0084] ΔadhE-1: 5'-ggttgaccagcgcaaataac-3'; SEQ ID NO. 12.

[0085] ΔadhE-2: 5'-gcgctactgaaatgctctcctgataatgttaaactt-3'; SEQ ID NO. 13.

[0086] ΔadhE-3: 5'-ggagagcatttcagtagcgctgtctggcaa-3'; SEQ ID NO. 14.

[0087] ΔadhE-4: 5'-tgaactgtgcgccatcaatg-3'; SEQ ID NO. 15.

[0088] ΔadhE-gRNA-F: 5'-GGACTAGTGGATCAGGTTGATGTCTGGGgttttagagctagaaatagcaagtt-3'; SEQ ID NO. 16.

[0089] ③ Based on the engineered strain BX-03, the pta gene was knocked out. The primers used to prepare the knockout fragments were Δpta-1 and Δpta-2, Δpta-3 and Δpta-4; the upstream primer used to prepare the knockout plasmid was Δpta-gRNA-F. The strain after the pta gene was knocked out was named the engineered strain BX-04.

[0090] The specific primer sequences are as follows:

[0091] Δpta-1: 5'-CATGAGCGTTGACGCAATCAAC-3'; SEQ ID NO. 17.

[0092] Δpta-2: 5'-GATGACGAGAGGTTTATCCTCTTTCGTTACCGCC-3'; SEQ ID NO. 18.

[0093] Δpta-3: 5'-GAGGATAAACCTCTCGTCATCATCCGCAGC-3'; SEQ ID NO. 19.

[0094] Δpta-4: 5'-GATCCTGAGGTTAATCCTTCAAACGG-3'; SEQ ID NO. 20.

[0095] Δpta-gRNA-F: 5'-GGACTAGTAGAAAGTGACGGATTTAACGGTTTTAGAGCTAGAAATAGCAAGTT-3'; SEQ ID NO. 21.

[0096] ④ Based on the engineered strain BX-04, the phosphoenolpyruvate carboxykinase gene pck was overexpressed to obtain strain BX-05.

[0097] (A1) Step 1: Prepare the overexpression phosphoenolpyruvate carboxykinase gene integration fragment pck-1000.

[0098] Using Escherichia coli BW25113 genomic DNA as a template, primers pck-1 and pck-2 were used to amplify a PCR product containing the upstream homology arm gene fragment F; primers pck-3 and pck-4 were used to amplify a PCR product containing the gene to be integrated pck (sequence as shown in SEQID NO.22); primers pck-5 and pck-6 were used to amplify a PCR product containing the downstream homology arm gene fragment r.

[0099] The specific primer sequences are as follows:

[0100] pck-1: 5'-tatcggcctggtgcaactctgg-3'; SEQ ID NO. 23.

[0101] pck-2: 5'-ctttaatgaattcactagtattatacctaggactgagct agctgtcaagtatagttatactcaggcggcaacaac-3'; SEQ ID NO. 24.

[0102] pck-3: 5'-gtcctaggtataatactagtgaattcattaaagaggaga aaggtacc atgcgcgttaa caatggtttgacc -3'; SEQ ID NO.25.

[0103] pck-4: 5'-GCTGTAATGCTGT ttacagtttcggaccagccgctac -3'; SEQ ID NO.26.

[0104] pck-5: 5'-tccgaaactgtaaacagcattacagccagcaggaag-3'; SEQ ID NO. 27.

[0105] pck-6: 5'-cagcggaatgctgtcattgttaataacg-3'; SEQ ID NO. 28.

[0106] PCR amplification system: Primestar enzyme (Takara) 25 µL, upstream and downstream primers 2 µL each, template 1 µL, ddH2O 20 µL.

[0107] PCR amplification program: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 57°C for 30 seconds, extension at 72°C for 10 seconds / kb, 35 cycles; extension at 72°C for 10 minutes.

[0108] After agarose gel electrophoresis and product recovery, the upstream homology arm gene fragment F, the to-be-integrated base pck gene fragment M and the downstream homology arm gene fragment r were obtained.

[0109] The upstream homology arm gene fragment F, the gene to be integrated pck fragment M and the downstream homology arm gene fragment r were used as substrates, and pck-1 and pck-6 were used as primers for PCR amplification to obtain a PCR product containing the overexpressed phosphoenolpyruvate carboxykinase gene integration fragment pck-1000. The amplification system and amplification conditions were the same as above.

[0110] The PCR product was subjected to agarose gel electrophoresis and product recovery to obtain the gene integration fragment pck-1000.

[0111] (A2) Step 2: Prepare the integration plasmid pck-gRNA.

[0112] Except for the upstream primer pck-gRNA-F, the other steps for preparing the integration plasmid refer to the above (1-2) Step 2: Preparation of knockout plasmid ΔptsG-gRNA. The pck-gRNA-F primer sequence used to prepare the integration plasmid pck-gRNA is as follows: 5'-GGACTAGTATTGCCGTTCATAATCCCTGgt tttagagctagaaatagcaagtt-3'; SEQ ID NO.29.

[0113] (A3) Step 3: Integrate the pck gene into the E. coli genome

[0114] The gene integration steps are the same as those in step (1-3) above, step 3: knocking out the ptsG gene, except that the knockout plasmid ΔptsG-gRNA and the knockout fragment ΔptsG-1000 in step (1-3) above, are replaced with the integration plasmid pck-gRNA and the integration fragment pck-1000 used for the integration gene. The other operation steps are the same as those in step (1-3) above, step 3: knocking out the ptsG gene.

[0115] (A4) Step 4: Elimination of integrated plasmid pck-gRNA and pEcCas:

[0116] Refer to the fourth step above (1-4): Elimination of knockout plasmid ΔptsG-gRNA and pEcCas, and eliminate the integrated plasmid pck-gRNA and pEcCas. The E. coli that has eliminated the integrated plasmid pck-gRNA and pEcCas was named engineered strain BX-05 and used for the next round of gene integration.

[0117] Example 2

[0118] Using Escherichia coli BX-05 as the starting strain, the rTCA pathway genes malate dehydrogenase gene mdh, fumarase B gene fumB and fumarate reductase gene cluster frdABCD were overexpressed to obtain strain BX-08.

[0119] (2-1) Oxygen-responsive metabolic switch P glpA Overexpression of malate dehydrogenase gene mdh

[0120] Based on the engineered strain BX-05, the P glpA The regulatory element overexpressed the endogenous Escherichia coli malate dehydrogenase mdh gene, and the genomic DNA of Escherichia coli BW25113 was used as a template. The primers used to prepare the gene integration fragment were mdh-1 and mdh-2 (using the genomic DNA of Escherichia coli BW25113 as a template), mdh-3 and mdh-4 (using the synthesized SEQ ID NO.30 as a template, wherein 1-230 bp is the anaerobic expression regulatory element P glpA ) and mdh-5 and mdh-6 (with E. coli BW25113 genomic DNA as template); the upstream primer used to prepare the integration plasmid was mdh-gRNA-F. The strain overexpressing the endogenous E. coli malate dehydrogenase mdh gene was named engineered strain BX-06.

[0121] The specific primer sequences are as follows:

[0122] mdh-1: 5'-aagatgtcgtctggttgcagg-3'; SEQ ID NO. 31.

[0123] mdh-2: 5'-ctcactgaatcaggttcatcaggtgatgattaagctggaaatc-3'; SEQ ID NO. 32.

[0124] mdh-3: 5'-tcacctgatgaac ctgattcagtgagagaacctgccgtttc -3'; SEQ ID NO.33.

[0125] mdh-4: 5'-gggcttcttaacac ttacttattaacgaactcttcgcccagg -3'; SEQ ID NO.34.

[0126] mdh-5: 5'-gttcgttaataagtaagtgttaagaagcccatcagtctgataagg-3'; SEQ ID NO. 35.

[0127] mdh-6: 5'-cacgatgaccatgaactgaaggc-3'; SEQ ID NO. 36.

[0128] mdh-gRNA-F: 5'-GGACTAGTAGGTCATCGAGACAATCAGGgttttagagctagaaatagcaagtt-3'; SEQ ID NO. 37.

[0129] (2-2) Based on the engineered strain BX-06, P glpA The regulatory element overexpressed the endogenous Escherichia coli fumarase B gene fumB. The primers used to prepare the gene integration fragment were fumB-1 and fumB-2 (using the genomic DNA of Escherichia coli BW25113 as a template), fumB-3 and fumB-4 (using the synthesized SEQ ID NO.38 as a template, wherein 1-230 bp is the anaerobic expression regulatory element P glpA ) and fumB-5 and fumB-6 (with E. coli BW25113 genomic DNA as template); the upstream primer used to prepare the integration plasmid was fumB-gRNA-F. The strain overexpressing the endogenous E. coli fumarase B gene fumB was named engineered strain BX-07.

[0130] The specific primer sequences are as follows:

[0131] fumB-1: 5'-atcagccgcgatgagtctctg-3'; SEQ ID NO. 39.

[0132] fumB-2: 5'-ctcactgaatcagtgctatacgttttgccagaaggccg-3'; SEQ ID NO. 40.

[0133] fumB-3: 5'-aacgtatagca ctgattcagtgagagaacctgccg -3'; SEQ ID NO.41.

[0134] fumB-4: 5'-acgcaccagcac ttacttagtgcagttcgcgcactg -3'; SEQ ID NO.42.

[0135] fumB-5: 5'-tgcactaagtaagtgctggtgcgttaaatgattatcatgc-3'; SEQ ID NO. 43.

[0136] fumB-6: 5'-ttccagcgctgcatattcgcc-3'; SEQ ID NO. 44.

[0137] fumB-gRNA-F: 5'-GGACTAGTGGAATTTATGCTCTACACCAgttttagagctagaaatagcaagtt-3'; SEQ ID NO. 45.

[0138] (2-3) Based on the engineered strain BX-07, P glpA The regulatory elements overexpressed the endogenous Escherichia coli fumarate reductase frdABCD gene cluster. The primers used to prepare the gene integration fragment were frdABCD-1 and frdABCD-2 (using the genomic DNA of Escherichia coli BW25113 as a template), frdABCD-3 and frdABCD-4 (using the synthesized SEQ ID NO.46 as a template, wherein 1-230 bp is the anaerobic expression regulatory element P glpA ) and frdABCD-5 and frdABCD-6 (using E. coli BW25113 genomic DNA as template); the upstream primer used to prepare the integration plasmid was frdABCD-gRNA-F. The strain overexpressing the endogenous E. coli fumarate reductase frdABCD gene cluster was named engineered strain BX-08.

[0139] The specific primer sequences are as follows:

[0140] frdABCD-1: 5'-gaatcaacgttgatgattgcggtcagc-3'; SEQ ID NO. 47.

[0141] frdABCD-2: 5'-ctcactgaatcagggatagcaggaaggtttctgtcaacaatc-3'; SEQ ID NO. 48.

[0142] frdABCD-3: 5'-tcctgctatcc ctgattcagtgagagaacctgccgtttc -3'; SEQ ID NO.49.

[0143] frdABCD-4:5'-ccatcaggcatattcg ttagattgtaacgacaccaatcagcgtg -3'; SEQ ID NO.50.

[0144] frdABCD-5: 5'-cgttacaatctaacgaatatgcctgatggtgcaacac-3'; SEQ ID NO. 51.

[0145] frdABCD-6: 5'-cggttacagtcgccaattccatcc-3'; SEQ ID NO. 52.

[0146] frdABCD-gRNA-F: 5'-GGACTAGTAAATAGGGGAAATGTCACCAgttttagagctagaaatagcaagtt-3'; SEQ ID NO. 53.

[0147] Example 3 Based on the engineered strain BX-07, frdA The regulatory elements overexpressed the endogenous Escherichia coli fumarate reductase frdABCD gene cluster to obtain the engineered strain BX-09.

[0148] Based on the engineered strain BX-07, the P frdA The regulatory elements were used to overexpress the endogenous Escherichia coli fumarate reductase frdABCD gene cluster. The primers used to prepare the gene integration fragment were frdABCD-1 and frdABCD-f2 (using the genomic DNA of Escherichia coli BW25113 as a template), frdABCD-f3 and frdABCD-4 (using the synthesized SEQ ID NO.54 as a template, wherein 1-300 bp is the anaerobic expression regulatory element P frdA ) and frdABCD-5 and frdABCD-6 (using E. coli BW25113 genomic DNA as template); the upstream primer used to prepare the integration plasmid was frdABCD-gRNA-F. The strain overexpressing the endogenous E. coli fumarate reductase frdABCD gene cluster was named engineered strain BX-09.

[0149] The specific primer sequences are as follows:

[0150] frdABCD-f2: gagtagacttcgtgcccggatagcaggaaggtttctgtcaacaatc; SEQ ID NO.55.

[0151] frdABCD-f3:tgctatcc gggcacgaagtctactcgcaac ; SEQ ID NO.56.

[0152] Example 4

[0153] A method for improving xylose metabolism capacity by regulating the expression of reductive TCA pathway genes through an oxygen-responsive metabolic switch, comprising the following steps:

[0154] Using Saccharomyces cerevisiae S288C as the starting strain, the plasmid pMO-xyl1-xyl2-xks1 containing the gene XYL1 encoding xylose reductase and the gene XYL2 encoding xylitol dehydrogenase from Pichia stipitis and the gene XKS1 encoding xylulose kinase from Yarrowia lipolytica were heterologously expressed, and the obtained engineered bacteria were named SC-03.

[0155] Saccharomyces cerevisiae S288C was used as the starting strain to heterologously express the gene XYL1 encoding xylose reductase and the gene XYL2 encoding xylitol dehydrogenase from Pichia stipitis, the gene XKS1 encoding xylulose kinase from Yarrowia lipolytica, and the regulatory element P expressed by the alcohol dehydrogenase 1 gene (ADH). ADH1 The regulated expression of the fumarase B gene fumB plasmid pMO-xyl1-xyl2-xks1-fumB, the obtained engineered bacteria was named SC-04.

[0156] (1) Obtaining the xylose assimilation pathway plasmid pMO-xyl1-xyl2-xks1

[0157] The fragment xyl1-xyl2-xks1 (sequence shown in SEQ ID NO.57) containing the xylose reductase gene XYL1, the xylitol dehydrogenase gene XYL2 and the xylulokinase gene XKS1 was fully synthesized, and the pMO-1 vector fragment (sequence shown in SEQ ID NO.58) was fully synthesized. The pMO-xyl1-xyl2-xks1 plasmid was obtained by connecting the xyl1-xyl2-xks1 gene fragment and the pMO-1 vector fragment using the pEASY®-Basic Seamless Cloning and Assembly Kit basic version homologous recombination seamless cloning kit and the method described in its instructions. The specific operation is as follows: 2×Basic Assembly Mix 5 µL, xyl1-xyl2-xks1 fragment 3 µL, pMO-1 vector fragment 1 µL, deionized water 1 µL were added together, gently mixed, and reacted at 50°C for 15 minutes. After the reaction, the centrifuge tube was placed on ice for a few seconds before transformation. The transformation steps are as follows: (1) Thaw Trans-10 competent cells on ice. (2) Add 2 µL of the recombinant product to 50 µL of competent cells, gently flick the wall of the centrifuge tube to mix (do not vortex), and place on ice for 30 minutes. (3) Heat shock in a 42°C water bath for 30 seconds, then immediately transfer to ice and cool for 2 minutes. (4) Add 450 µL of room temperature LB medium, then culture at 37°C in a shaker at 250 rpm for 1 hour. (5) Take 200 µL and apply it to an LB plate containing 100 µg / mL ampicillin and culture at 37°C overnight. (6) Pick a single colony and enrich and culture it in an LB tube at 37°C for 12 hours to extract the plasmid and obtain the plasmid pMO-xyl1-xyl2-xks1.

[0158] Among them, the upstream homologous recombination sequence P1XXX-F is agtgtcttgcgtctctagagac (SEQ ID NO.59), and the downstream homologous recombination sequence P1XXX-R is cttgcgtaacctgtacccttaagc (SEQ ID NO.60).

[0159] (2) Obtaining the pMO-xyl1-xyl2-xks1-fumB plasmid containing the xylose assimilation pathway and overexpressing the fumarase B gene

[0160] The gene XYL1 containing xylose reductase, XYL2 containing xylitol dehydrogenase, XKS1 containing xylulose kinase and P containing alcohol dehydrogenase 1 gene expression regulatory element ADH1 The fragment xyl1-xyl2-xks1-fumB (sequence as shown in SEQ ID NO.61) of the fumarase B gene fumB that regulates expression is a fully synthesized gene. The pMO-2 vector fragment (sequence as shown in SEQ ID NO.62) is a fully synthesized gene. The pMO-xyl1-xyl2-xks1-fumB plasmid is obtained by connecting the xyl1-xyl2-xks1-fumB gene fragment and the pMO-2 vector fragment using the pEASY®-Basic Seamless Cloning and Assembly Kit basic version homologous recombination seamless cloning kit and the method described in its instructions. The specific operation is the same as above to obtain the plasmid pMO-xyl1-xyl2-xks1-fumB.

[0161] The upstream homologous recombination sequence P2XXX-F is gtgtcttgcgtaacctgtacccttaag (SEQ ID NO. 63), and the downstream homologous recombination sequence P2XXX-R is gcgtctctccatacatcgggattc (SEQ ID NO. 64).

[0162] (3) Preparation of competent yeast

[0163] A single colony of the starting strain of Saccharomyces cerevisiae S288C was cultured in YPD medium at 30°C and 200 rpm overnight. The final OD 600 The cells with a turbidity of nm = 0.3 were inoculated into 50 mL YPD medium and cultured at 30°C until OD 600nm=1.2-1.6; centrifuge the bacterial solution at 3000 rpm for 3 min at 4°C and collect it into a 50 mL sterile centrifuge tube; discard the supernatant and wash once with 20 mL sterile water; discard the supernatant again and wash once with 20 mL 1 mol / L sorbitol; re-pipette and mix the Saccharomyces cerevisiae cells in 16 mL of 1 mol / L sorbitol, add 2 mL 10×TE and 2 mL 10×LiOAc and mix thoroughly, and keep at 30°C for 30 min; add 200 μL 1 mol / L DTT stock solution to the mixture and keep it on an oscillator for 15 min; collect the Saccharomyces cerevisiae cells by centrifugation at 3000 rpm for 3 min at 4°C; discard the supernatant and wash twice with 20 mL 1 mol / L sorbitol; remove all liquid as much as possible after centrifugation, resuspend the yeast cells in 200 μL 1 mol / L sorbitol, and aliquot to obtain competent cells.

[0164] (4) Plasmid transformation of genetically engineered bacteria

[0165] The construction of genetically engineered strains SC-03 and SC-04 both involved plasmid transformation. After the starting strain was cultured overnight in YPD liquid medium, competent cells were prepared and the corresponding recombinant plasmids containing gene expression cassettes were added. Then the cells were pipetted until they were completely mixed, placed in an electroporator at 1.5 kV to electroporate the cells, and 1 mL of 1M sorbitol was immediately added to the electroporated cells. The electroporated cells in the cuvette were then placed in a 50 mL centrifuge tube containing 6 mL of culture medium (sorbitol: YPD = 1:1), and placed in a 30°C shaker for 2 h of recovery. Finally, wash with sterile water, and apply 100 μL of the mixture on a YPD solid plate containing 400 mg / LG418 antibiotics, and wait for the colonies to grow for fermentation.

[0166] Example 5 Recombinant E. coli BX-08 and BX-09 were cultured and metabolized xylose using xylose medium as substrate

[0167] The seed culture medium was LBG liquid medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, glucose 10 g / L.

[0168] Xylose medium I: xylose 20 g / L, K2HPO4 3.5 g / L, KH2PO4 5 g / L, (NH4)2HPO4 3.5 g / L, NaCl 1 g / L, CaCl2•2H2O 30 mg / L, MgSO4•7H2O 1.2 g / L, yeast powder 5.0 g / L, trace element solution 0.2%, biotin 4×10 -4 g / L, vitamin B1 4×10 -4 g / L.

[0169] Preparation method of trace element solution: weigh 1 g FeSO4·7H2O, 1g MnSO4·H2O, 0.1g ZnSO4·7H2O, 0.2g CuSO4, 0.002g NiCl2·6H2O, add water to make the volume 100 mL, then add 100 µl concentrated hydrochloric acid to adjust the pH, then filter the bacteria through a membrane, and add 0.2% to the fermentation medium system.

[0170] The anaerobic culture of recombinant E. coli BX-08 and BX-09 comprises the following steps:

[0171] (1) Seed culture: Single colonies of Escherichia coli BX-08 and BX-09 were selected and inoculated into LBG liquid culture medium respectively. The culture was incubated at 37°C and 200 rpm for 12 h. The colonies were then transferred to fresh LBG liquid culture medium for secondary activation for 12 h. The activated strains BX-08 and BX-09 were used for seed expansion culture respectively.

[0172] (2) Seed expansion culture: The constant temperature shaking conditions were 37°C and 200 rpm. 50 mL of xylose medium I was placed in a 250 mL baffled bottle and inoculated to a final concentration of OD 600 =0.5, three parallel experiments were performed for each strain, and aerobic culture was performed for 12 h.

[0173] (3) Anaerobic culture: The aerobic cultured cells were centrifuged at 5000 rpm for 4 min to collect the cells, and then 50 mL of xylose medium I was added to transfer the cells into a 100 mL anaerobic bottle and inoculated to a final concentration of OD 600 =3, placed in a constant temperature shaker, 37°C, 200 rpm, and cultured for 96 h.

[0174] (4) Analytical method: The xylose in the culture medium was detected by UltiMate 3000 high performance liquid chromatograph (HPLC, Thermo Fisher Scientific) and the xylose consumption was calculated. The chromatographic column used was a Bio-Rad Aminex HPX-87H organic acid chromatographic column. The results are shown in Table 1.

[0175] Comparative Example 1 Recombinant Escherichia coli BX-05 cultured in xylose medium to metabolize xylose

[0176] The experimental method is the same as that of Example 4 except that the strains are changed from BX-08 and BX-09 to BX-05. The results are shown in Table 1.

[0177] Table 1

[0178]

[0179] The results in Table 1 show that in the anaerobic bottle, the strain BX-08 of Example 5 consumed 15.8 g / L of xylose, the strain BX-09 of Example 5 consumed 16.5 g / L of xylose anaerobically, and the strain BX-05 of Comparative Example 1 consumed only 8.3 g / L of xylose. The strain BX-08 of Example 5 and the strain BX-09 of Example 5 increased the consumption of xylose by 90.4% and 98.8% respectively compared with the strain BX-05 of Comparative Example 1.

[0180] Example 6 Recombinant E. coli BX-08 and BX-09 were cultured and metabolized xylose using corn straw hydrolysate as substrate

[0181] Preparation method of corn straw hydrolyzate: After the corn straw is crushed, it is screened with a 25-mesh sieve to obtain corn straw powder, and the corn straw powder is added to a 1% NaOH solution to make the solid content of the corn straw powder in the solution reach 10%, and then treated at 100°C for 1 h, and then filtered to obtain corn straw residue. The obtained corn straw residue is rinsed with tap water, and the rinsing is stopped when its pH is the same as the pH of tap water, and then the corn straw residue is dried at 50°C for use. Weigh dry corn straw residue and dissolve it in 0.05 M phosphoric acid solution to make the solid content of corn straw residue in the solution reach 20%. Add Novozymes' Novocell HS cellulase (154 FPU / mL) with a final concentration of 40 FPU / g (corn straw residue). Then place it in a shaker at 50°C, 200 rpm, and perform enzymolysis for 72 h. After the enzymolysis, centrifuge at 4500 rpm for 15 min, and take the supernatant to obtain corn straw hydrolyzate (containing 42 g / L glucose and 21 g / L xylose).

[0182] Corn straw hydrolysate medium I: corn straw hydrolysate (diluted with deionized water to contain 14 g / L glucose and 7 g / L xylose), K2HPO4 3.5 g / L, KH2PO4 5 g / L, (NH4)2HPO4 3.5 g / L, NaCl 1 g / L, CaCl2•2H2O 30 mg / L, MgSO4•7H2O 1.2 g / L, yeast powder 5.0 g / L, trace element solution 0.2%, biotin 4×10 -4 g / L, vitamin B1 4×10 -4 g / L.

[0183] The culture method of recombinant Escherichia coli BX-08 and BX-09 was the same as that of Example 5, except that corn straw hydrolyzate medium I was used to replace xylose medium I in Example 5. The results are shown in Table 2.

[0184] Comparative Example 2: Recombinant Escherichia coli BX-05 cultured in corn straw hydrolysate medium to metabolize xylose

[0185] The experimental method is the same as Example 6 except that the strains are changed from BX-08 and BX-09 to BX-05. The results are shown in Table 2.

[0186] Table 2

[0187]

[0188] The results in Table 2 show that in the anaerobic bottle, the strain BX-08 of Example 6 consumed 7 g / L of xylose, the strain BX-09 of Example 6 consumed 7 g / L of xylose anaerobically, and the strain BX-05 of Comparative Example 2 consumed only 3.6 g / L of xylose. The xylose consumption of strains BX-08 and BX-09 of Example 6 was 94.4% higher than that of strain BX-05 of Comparative Example 2.

[0189] Example 7 Recombinant E. coli BX-08 and BX-09 were cultured in fermenters using corn straw hydrolysate as substrate to metabolize xylose

[0190] Corn straw hydrolysate medium II: corn straw hydrolysate (containing 42 g / L glucose and 21 g / L xylose), K2HPO4 3.5 g / L, KH2PO4 5 g / L, (NH4)2HPO4 3.5 g / L, NaCl 1 g / L, CaCl2•2H2O 30 mg / L, MgSO4•7H2O 1.2 g / L, yeast powder 5.0 g / L, trace element solution 0.2%, biotin 4×10 -4 g / L, vitamin B1 4×10 -4 g / L.

[0191] The recombinant E. coli BX-08 and BX-09 were cultured in 5 L fermenters in an aerobic-anaerobic two-stage culture process, including the following steps:

[0192] (1) Seed culture: Pick single colonies of Escherichia coli BX-08 and BX-09 and inoculate them into 20 mL LBG liquid medium respectively. Culture them at 37°C and 200 rpm for 12 h. Then transfer them to fresh LBG liquid medium for secondary activation for 12 h. The activated strains BX-08 and BX-09 were used for fermentation culture respectively.

[0193] (2) Fermentation cell culture: 200 mL of LBG medium was placed in a 500 mL baffled bottle, and 20 mL of the seed solution (OD 600 10) was inoculated into 200 mL LBG medium at 37°C and aerobic culture for 10 h for inoculation of the fermenter.

[0194] (3) 5 L fermentation tank culture: 2 L corn straw hydrolysate medium II was placed in a 5 L fermentation tank, with an initial pH of 7.0, 37 °C, and a rotation speed of 300 rpm. The culture was carried out aerobically until OD 600 When the temperature was 30, aeration was stopped, stirring was fixed at 200 rpm, and then cultured for 24 h.

[0195] (4) Analysis method: UltiMate 3000 high performance liquid chromatograph (HPLC, Thermo Fisher Scientific) was used to detect glucose and xylose in the culture medium and calculate the glucose and xylose consumption. The chromatographic column used was a Bio-Rad Aminex HPX-87H organic acid chromatographic column. The results are shown in Table 3.

[0196] Comparative Example 3: Recombinant Escherichia coli BX-05 was cultured in a fermenter to metabolize xylose using corn straw hydrolysate as a substrate

[0197] The experimental method is the same as Example 7 except that the strains are changed from BX-08 and BX-09 to BX-05. The results are shown in Table 3.

[0198] Table 3

[0199]

[0200] The results in Table 3 show that in the fermenter, the strain BX-08 of Example 7 consumed 14.9 g / L of xylose, the strain BX-09 of Example 7 consumed 15.1 g / L of xylose anaerobically, and the strain BX-05 of Comparative Example 3 consumed only 7.7 g / L of xylose. The strain BX-08 of Example 7 and the strain BX-09 of Example 7 increased the xylose consumption by 93.5% and 96.1% respectively compared with the strain BX-05 of Comparative Example 3.

[0201] Example 8 Recombinant Saccharomyces cerevisiae SC-04 Metabolizes Xylose Using Xylose Medium as Substrate

[0202] The seed culture medium was SC medium: YNB 1.7 g / L, (NH4)2SO4 5 g / L, amino acid mixture 1.655 g / L, Glu 20 g / L, adjusted to pH=6, 400 mg / L G418 antibiotic, used for seed culture of recombinant Saccharomyces cerevisiae SC-04.

[0203] The amino acid mixture formula is as follows: Adenine 0.5g / L, Alanine 2.0g / L, Arginine 2.0g / L, Asparagine 2.0g / L, Aspartic acid 2.0g / L, Cysteine ​​2.0g / L, Glutamine 2.0g / L, Glutamic acid 2.0g / L, Glycine 2.0g / L, Histidine 2.0g / L, Inositol 2.0g / L, Isoleucine 2.0g / L, Leucine 4.0g / L, Lysine 2.0g / L, Methionine 2.0g / L, para-Aminobenzoic acid 0.2g / L, Phenylalanine 2.0g / L, Proline 2.0g / L, Serine 2.0g / L, Threonine 2.0g / L, Tryptophan 2.0g / L, Tyrosine 2.0g / L, Uracil 2.0g / L, Valine 2.0g / L.

[0204] Xylose medium SC-I: Xylose 20 g / L, (NH4)2SO4 7.5 g / L, KH2PO4 14.4 g / L, MgSO4•7H2O 0.5 g / L, EDTA 15 mg / L, ZnSO4•7H2O 4.5 mg / L, Cocl2•7H2O 0.3 mg / L, MnSO4•H2O 1 mg / L, CuSO4•5H2O 0.3 mg / L, FeSO4•7H2O 3 mg / L, NaMoO4•2H2O 0.3 mg / L, H3BO4 1 mg / L, KI 0.1 mg / L, biotin 0.05 mg / L, calcium pantothenate 1 mg / L, vitamin B3 1 mg / L, inositol 25 mg / L, thiamine 1 mg / L, vitamin B6 1 mg / L, p-aminobenzoic acid 0.2 mg / L, 400 mg / L G418 antibiotic.

[0205] The anaerobic culture of recombinant Saccharomyces cerevisiae SC-04 includes the following steps:

[0206] (1) Seed culture: Pick a single colony of recombinant Saccharomyces cerevisiae SC-04 and inoculate it into SC medium. Cultivate it at 30°C and 200 rpm for 12 h. Use the activated strain SC-04 for seed expansion culture.

[0207] (2) Seed expansion culture: The constant temperature shaking conditions were 30°C and 200 rpm. 50 mL of SC medium was placed in a 250 mL baffled bottle and inoculated to a final concentration of OD 600 = 0.5, aerobic culture for 12 h, and the activated strain SC-04 was used for anaerobic culture.

[0208] (3) Anaerobic culture: The aerobic cultured cells were centrifuged at 5000 rpm for 4 min to collect the cells, and then 50 mL of xylose medium SC-I was added to transfer the cells into a 100 mL anaerobic bottle and inoculated to a final concentration of OD 600 =3, placed in a constant temperature shaker, 30℃, 200 rpm, and cultured for 72 h.

[0209] (4) Analytical method: UltiMate 3000 high performance liquid chromatograph (HPLC, Thermo Fisher Scientific) was used to detect the components in the culture medium. The consumption of sugars in the culture medium was determined using a Bio-Rad Aminex HPX-87H organic acid chromatographic column. The results are shown in Table 4.

[0210] Comparative Example 4: Saccharomyces cerevisiae SC-03 was cultured and metabolized xylose using xylose medium SC-I as substrate

[0211] The experimental method is the same as Example 8 except that the strain is changed from SC-04 to SC-03. The results are shown in Table 4.

[0212] Table 4

[0213]

[0214] The results in Table 4 show that in the anaerobic bottle, the strain SC-04 of Example 8 consumed 14.6 g / L of xylose, while the strain SC-03 of Comparative Example 4 only consumed 8.8 g / L of xylose. The xylose consumption of the strain SC-04 of Example 8 was increased by 65.9% compared with the strain SC-03 of Comparative Example 4.

[0215] Example 9: Recombinant Saccharomyces cerevisiae SC-04 was cultured and metabolized xylose using corn straw hydrolysate as substrate

[0216] Recombinant Saccharomyces cerevisiae SC-04 was cultured in a 5 L fermenter using corn straw hydrolysate as substrate and metabolized xylose in an aerobic-anaerobic two-stage culture, including the following steps:

[0217] Corn straw hydrolysate medium SC-II: corn straw hydrolysate (containing 42 g / L glucose and 21 g / L xylose), (NH4)2SO47.5 g / L, KH2PO4 14.4 g / L, MgSO4•7H2O 0.5 g / L, EDTA 15 mg / L, ZnSO4•7H2O 4.5 mg / L, Cocl2•7H2O 0.3 mg / L, MnSO4•H2O 1 mg / L, CuSO4•5H2O 0.3 mg / L, FeSO4•7H2O 3 mg / L, NaMoO4•2H2O 0.3 mg / L, H3BO41 mg / L, KI 0.1 mg / L, biotin 0.05 mg / L, calcium pantothenate 1 mg / L, vitamin B3 1 mg / L, inositol 25 mg / L, thiamine 1 mg / L, vitamin B6 1 mg / L, p-aminobenzoic acid 0.2 mg / L, 400 mg / L G418 antibiotics.

[0218] The aerobic-anaerobic two-stage culture of recombinant Saccharomyces cerevisiae SC-04 includes the following steps:

[0219] (1) Seed culture: Pick a single colony of recombinant Saccharomyces cerevisiae SC-04 and inoculate it into a test tube containing 3 ml of SC medium for overnight culture. Then transfer all of them to 20 mL of SC medium and culture at 30 °C and 200 rpm for 24 h. The activated strain SC-04 is used for seed expansion culture.

[0220] (2) Fermentation cell culture: Place 200 mL of YPD medium in a 500 mL baffled bottle and add 20 mL of the above cultured seed solution (OD 600 8) was inoculated into 200 mL SC medium at 30°C and aerobic culture for 12 h for inoculation of the fermenter.

[0221] (3) 5 L fermenter culture: 2 L corn straw hydrolysate medium SC-II was placed in a 5 L fermenter, with an initial pH of 6.0, 30 °C, rotation speed of 200 rpm, and an initial inoculation OD of 600 The final concentration was 0.5, and cultured aerobically until OD 600 When the temperature was 30, aeration was stopped, stirring was fixed at 200 rpm, and then cultured for 24 h.

[0222] (4) Analysis method: UltiMate 3000 high performance liquid chromatograph (HPLC, Thermo Fisher Scientific) was used to detect glucose and xylose in the culture medium and calculate the glucose and xylose consumption. The chromatographic column used was a Bio-Rad Aminex HPX-87H organic acid chromatographic column. The results are shown in Table 5.

[0223] Comparative Example 5 Recombinant Saccharomyces cerevisiae SC-03 was cultured in a fermenter and metabolized xylose using corn straw hydrolyzate as substrate

[0224] The experimental method is the same as Example 9 except that the strain is changed from SC-04 to SC-03. The results are shown in Table 5.

[0225] Table 5

[0226]

[0227] The results in Table 5 show that in the anaerobic bottle, the strain SC-04 of Example 9 consumed 13.4 g / L of xylose, while the strain SC-03 of Comparative Example 5 only consumed 6.8 g / L of xylose. The xylose consumption of the strain SC-04 of Example 9 was increased by 97% compared with that of the strain SC-03 of Comparative Example 5.

[0228] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for improving xylose metabolism capacity by regulating the expression of reductive TCA pathway genes through an oxygen-responsive metabolic switch, characterized in that: Fermentation was performed using recombinant Escherichia coli BX-08 or BX-09; The construction method of the recombinant Escherichia coli BX-08 is as follows: using Escherichia coli BW25113 as the starting strain, knocking out the glucose-specific enzyme IIBC component gene ptsG, the lactate dehydrogenase gene ldhA, the alcohol dehydrogenase gene adhE, the phosphotransacetylase gene pta and overexpressing the phosphoenolpyruvate carboxykinase gene pck in sequence; then glpA Overexpression of malate dehydrogenase gene mdh, fumarase B gene fumB and fumarate reductase gene cluster frdABCD respectively; The construction method of the recombinant Escherichia coli BX-09 is as follows: using Escherichia coli BW25113 as the starting strain, knocking out the glucose-specific enzyme IIBC component gene ptsG, the lactate dehydrogenase gene ldhA, the alcohol dehydrogenase gene adhE, the phosphotransacetylase gene pta and overexpressing the phosphoenolpyruvate carboxykinase gene pck in sequence; then glpA Overexpression of malate dehydrogenase gene mdh and fumarase B gene fumB respectively, through the expression of regulatory element P frdA Overexpression of the fumarate reductase gene cluster frdABCD; The expression control element P glpA The sequence is shown as 1-230 bp in SEQ ID NO.30; The expression control element P frdA The sequence is shown as 1-300 bp in SEQ ID NO.

54.

2. The method of claim 1, wherein the oxygen-responsive metabolic switch is used to regulate the expression of genes in the reductive TCA pathway to improve xylose metabolism, The pck sequence of the phosphoenolpyruvate carboxykinase gene is shown in SEQ ID NO.22; With the expression control element P glpA The malate dehydrogenase gene mdh is shown in SEQ ID NO.30; With the expression control element P glpA The fumarase B gene fumB is shown in SEQ ID NO.38; With the expression control element P glpA The fumarate reductase gene cluster frdABCD is shown in SEQ ID NO.46; With the expression control element P frdA The fumarate reductase gene cluster frdABCD is shown in SEQ ID NO.

54.

3. The recombinant Escherichia coli BX-08 described in claim 1.

4. The recombinant Escherichia coli BX-09 described in claim 1.

5. Use of the recombinant Escherichia coli BX-08 according to claim 3 or the recombinant Escherichia coli BX-09 according to claim 4 in efficiently metabolizing xylose.

6. A method for efficiently metabolizing xylose, characterized in that: The recombinant Escherichia coli BX-08 according to claim 3 or the recombinant Escherichia coli BX-09 according to claim 4 is used for anaerobic fermentation; the carbon source used for fermentation is xylose or corn straw hydrolyzate.

Images