Application of Lentiviral Vector Overexpressing LncRNA SNHG16 in Repair Engineering Materials

Abstract

The present invention provides the application of a lentiviral vector overexpressing LncRNA SNHG16 in a repair engineering material. Specifically, it relates to the application of a lentiviral vector overexpressing LncRNA SNHG16 in an engineering material for repairing tissue defects, and the application of adipose stem cells containing a lentiviral vector overexpressing LncRNA SNHG16 in an engineering material for repairing tissue injuries. The present invention transfects adipose stem cells with a lentiviral vector overexpressing LncRNA SNHG16, and the obtained adipose stem cells containing the lentiviral vector overexpressing LncRNA SNHG16 can promote the proliferation and adipogenic differentiation of adipose stem cells, form tissue-engineered fat, and be used as an implant material to fill the site of tissue defect for repairing the tissue defect.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of a lentiviral vector overexpressing LncRNA SNHG16 in a repair engineering material. Background Art

[0002] Skin and soft tissue injuries can be caused by various factors such as trauma, tumor resection, and congenital malformations, and have always been common diseases in the surgical field. Moreover, with the development of China's infrastructure construction, population aging trend, etc., the incidence of soft tissue injuries caused by industrial production accidents, traffic accidents, chronic systemic diseases, etc. has been remaining high, with characteristics such as multiple types and long course. However, at present, the methods for repairing large-area soft tissue defects are still relatively limited, including autologous transplantation and material implantation, both of which have problems such as low transplantation efficiency and poor long-term stability. In autologous tissue transplantation, adipose tissue is considered an ideal material for repairing and reconstructing soft tissue defects, but problems such as high postoperative absorption rate and concomitant infection limit its curative effect. In recent years, the emergence of adipose tissue engineering has been regarded as a new treatment strategy with great potential, and has strong plasticity in terms of implant function and graft survival rate.

[0003] Adipose-derived stem cells (ADSCs), as adult stem cells with mesenchymal stem cell characteristics in adipose tissue, have advantages such as high proliferation activity, multi-directional differentiation potential, low immunogenicity, and rich sources, and are the core elements of tissue engineering. Adipose stem cells loaded on scaffolds form tissue-engineered fat under the induction of various cytokines. Therefore, inducing the proliferation and adipogenic differentiation of ADSCs is the key scientific problem for realizing fat regeneration. However, from the current research status at home and abroad, the adipogenic differentiation mechanism of ADSCs is still unclear. Although it has been clarified that some cytokines or chemical substances can promote their adipogenic differentiation, such as BMP-4, MLL3, etc., it is difficult to solve how to promote cell proliferation at the same time.

[0004] Long non-coding RNAs (lncRNAs) are non-coding RNAs with a length exceeding 200 nucleotides and can act as signaling RNAs in response to internal and external stimuli of cells. In recent years, reports have confirmed that lncRNAs can affect the proliferation and differentiation of stem cells at multiple levels of gene expression. LncRNAs with different localizations play roles through different pathways. In the nucleus, lncRNAs can regulate gene expression at the epigenetic, pre-transcriptional, and transcriptional levels. For example, they can affect the methylation level of gene promoter regions, or bind to RNA-binding proteins, transcription factor proteins, etc. to regulate the expression of functional genes. LncRNAs in the cytoplasm can act as competing endogenous RNAs (ceRNAs) to target multiple miRNAs and affect the expression or stability of target genes. In addition, lncRNAs from extracellular vesicles of cells themselves or other surrounding cells can enter target cells through endocytosis and perform corresponding functions. Summary of the Invention

[0005] The purpose of the present invention is to use a lentiviral vector overexpressing LncRNA SNHG16 to modify adipose stem cells, promote the proliferation and adipogenic differentiation of adipose stem cells, form tissue-engineered fat, and use it as an implant material to repair tissue defects.

[0006] The present invention provides an application of a lentiviral vector overexpressing LncRNA SNHG16 in engineering materials for repairing tissue defects.

[0007] In a specific embodiment, the tissue defect is a skin and soft tissue defect.

[0008] In a specific embodiment, the lentiviral vector overexpressing LncRNA SNHG16 is a PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector, wherein PLVX is a lentiviral vector, SNHG16 is driven by a CMV promoter for expression, the CDGA-2A-PURO gene is driven by an EF1A promoter for expression, and it has green fluorescence and puromycin resistance.

[0009] In a specific embodiment, the sequence of the PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector is as shown in SEQ ID NO.1.

[0010] In a specific embodiment, the method for constructing the lentiviral vector overexpressing LncRNA SNHG16 comprises the following steps:

[0011] Screen LncRNA SNHG16;

[0012] The linearized PLVX-EF1A-CDGA-2A-PURO-CMV-MCS vector was obtained by restriction enzyme digestion;

[0013] Using homologous recombination ligation, the PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector was constructed, wherein the inserted sequence of SNHG16 was the full-length gene.

[0014] The present invention also provides an application of adipose stem cells containing a lentiviral vector overexpressing LncRNA SNHG16 in engineering materials for repairing tissue defects.

[0015] In a specific embodiment, the lentiviral vector overexpressing LncRNA SNHG16 is the PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector, wherein PLVX is a lentiviral vector, SNHG16 is driven by the CMV promoter for expression, the CDGA-2A-PURO gene is driven by the EF1A promoter for expression, and it has green fluorescence and puromycin resistance.

[0016] In a specific embodiment, the sequence of the PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector is as shown in SEQ ID NO.1.

[0017] In a specific embodiment, the preparation method of adipose stem cells containing a lentiviral vector overexpressing LncRNA SNHG16 includes the following steps:

[0018] Step (1), constructing a lentiviral vector overexpressing LncRNA SNHG16;

[0019] Step (2), transfecting adipose stem cells with the lentiviral vector overexpressing LncRNA SNHG16 constructed in step (1) to obtain adipose stem cells containing a lentiviral vector overexpressing LncRNA SNHG16.

[0020] In a specific embodiment, the multiplicity of infection MOI of the virus in step (2) is 50.

[0021] The beneficial effects of the present invention at least include:

[0022] First, the present invention transfects adipose stem cells with a lentiviral vector overexpressing LncRNA SNHG16, and the obtained adipose stem cells containing a lentiviral vector overexpressing LncRNA SNHG16 can promote the proliferation and adipogenic differentiation of adipose stem cells, form tissue-engineered fat, and be filled into the tissue defect site as an implant material to repair the tissue defect.

[0023] Second, compared with plasmid vectors, lentiviruses can effectively introduce and integrate foreign genes into the genome of target cells through in vitro infection and in vivo injection. They have a stronger ability to infect cells, can achieve long-term expression of foreign genes in dividing and non-dividing cells, and do not cause toxicity and immune reactions. Description of the Drawings

[0024] Figure 1 It is a comparison chart of CCK-8 cell proliferation activities of the control group, adipose stem cell exosome group, and adipose tissue exosome group on days 0, 1, 3, and 5;

[0025] Figure 2 It is a comparison chart of microscopic images of Oil Red O staining on the 5th day of the control group, adipose stem cell exosome group, and adipose tissue exosome group;

[0026] Figure 3 It is a heat map of high-throughput sequencing of lncRNA in adipose tissue exosomes;

[0027] Figure 4 It is a GO enrichment analysis chart of lncRNA in adipose tissue exosomes;

[0028] Figure 5 It is a comparison chart of the expression levels of lncRNA SNHG16 in adipose stem cell exosomes and adipose tissue exosomes;

[0029] Figure 6 It is a schematic diagram of the structure of the SNHG16 overexpression plasmid;

[0030] Figure 7 It is the cell fluorescence expression content under different multiplicities of infection (MOI) values of lentiviruses;

[0031] Figure 8 It is a comparison chart of the intracellular SNHG16 expression levels of adipose stem cells, adipose stem cells transfected with empty SNHG16 lentivirus, and adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0032] Figure 9 It is a comparison chart of CCK-8 cell proliferation activities of adipose stem cells transfected with empty SNHG16 lentivirus and adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0033] Figure 10 It is a cell cycle fitting chart of adipose stem cells transfected with empty SNHG16 lentivirus;

[0034] Figure 11 It is a cell cycle fitting chart of adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0035] Figure 12Comparison chart of RT-qPCR results of Ki67 and PCNA mRNA expression in the group of adipose stem cells transfected with empty SNHG16 lentivirus and the group of adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0036] Figure 13 Corresponding band diagram of Western blot of Ki67 and PCNA protein expression in the group of adipose stem cells transfected with empty SNHG16 lentivirus and the group of adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0037] Figure 14 Analysis and comparison chart of gray values of corresponding bands of Western blot of Ki67 and PCNA protein expression in the group of adipose stem cells transfected with empty SNHG16 lentivirus and the group of adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0038] Figure 15 Comparison chart of microscopic images of Oil Red O staining on the 5th day in the group of adipose stem cells transfected with empty SNHG16 lentivirus and the group of adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0039] Figure 16 Comparison chart of absorbance values at 520 nm after isopropanol extraction after Oil Red O staining on the 5th day in the group of adipose stem cells transfected with empty SNHG16 lentivirus and the group of adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0040] Figure 17 Comparison chart of RT-qPCR results of PPAR-γ and CEBP-α mRNA expression in the group of adipose stem cells transfected with empty SNHG16 lentivirus and the group of adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0041] Figure 18 Corresponding band diagram of Western blot of PPAR-γ and CEBP-α protein expression in the group of adipose stem cells transfected with empty SNHG16 lentivirus and the group of adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0042] Figure 19 Analysis and comparison chart of gray values of corresponding bands of Western blot of PPAR-γ and CEBP-α protein expression in the group of adipose stem cells transfected with empty SNHG16 lentivirus and the group of adipose stem cells transfected with SNHG16 overexpression lentivirus;

[0043] Figure 20 Microscopic green fluorescence expression of cells in the group of adipose stem cells transfected with empty SNHG16 plasmid and the group of adipose stem cells transfected with SNHG16 overexpression plasmid;

[0044] Figure 21The green fluorescence expression of cells under the microscope in the adipose stem cell transfected empty SNHG16 lentivirus group and the adipose stem cell transfected SNHG16 overexpression lentivirus group. DETAILED DESCRIPTION

[0045] The present invention is described in detail below with reference to the accompanying drawings and embodiments, but the present invention can be implemented in many different ways as limited and covered by the claims.

[0046] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Specifically:

[0047] The culture medium MEM-α, penicillin-streptomycin (100x), DPBS, special grade fetal bovine serum, and trypsin were purchased from VivaCell; the CCK-8 kit was purchased from Bioss; the Oil Red O staining kit, insulin, propidium iodide PI solution, RNaseA ribonuclease A, and RIPA cell lysis buffer were purchased from solarbio; the adipogenic induction medium was purchased from apexgene; the reverse transcription kit and PCR kit were purchased from Vazyme; the polyacrylamide gel (SDS.PAGE) was purchased from ACE; the BCA detection kit and protein ladder were purchased from Bioss; anti-Ki67 (WL01384a), anti-PCNA (WL02208), anti-PPAR-γ (WL01800), and anti-CEBP-α (WL01899) were purchased from Wanlei; HRPGoat anti Rabbit IgG (HL) was purchased from AntGene; TBST, ECL chemiluminescent solution, and PVDF membrane were purchased from ECOTOP; GAPDH, Ki67, PCNA, PPAR-γ, and CEBP primers were purchased from Shanghai Bioengineering Corporation.

[0048] The specific operation steps of CCK-8, Oil Red O staining, flow cell cycle PI staining, RT-qPCR, and Western blot in the present invention are as follows:

[0049] CCK-8: 2×10 3 Adipose stem cells were inoculated into 96-well plates and cultured for 1-5 days, with the medium changed every 2 days. During the test, 10 μl of CCK-8 reagent was added to each well of the original culture medium, mixed and placed in a 37°C constant temperature incubator for 30 minutes. The OD value was read at 450nm using an enzyme-linked immunosorbent assay.

[0050] Oil Red O staining: 7.5 × 10 4Adipose stem cells were seeded into 6-well plates and cultured in adipogenic induction medium for 2 days, then cultured in medium containing 10 μg / ml insulin for 1 day, and the culture was alternated in cycles until the 5th day. Oil Red O staining kit was used for staining detection.

[0051] Flow cytometry cell cycle PI staining: Adipose stem cells were digested with trypsin, and the cells were collected by centrifugation at 1000 rpm for 5 minutes. The cells were resuspended and fixed with 75% alcohol and incubated overnight at 4°C. The alcohol was removed by centrifugation at 1000 rpm for 5 minutes. 200 μl of PBS, 10 μl of RNaseA, and 200 μl of propidium iodide (PI) solution were added and incubated at 37°C for 30 minutes. After thorough mixing, the cells were passed through a 200-mesh cell sieve and transferred to a 5-ml flow tube for flow cytometry detection.

[0052] RT-qPCR: Total RNA was prepared using TRIzol reagent, reverse-transcribed into cDNA using a reverse transcription kit, and amplified using a PCR kit and a fluorescence qPCR instrument (QuantStudio 3). The primer sequences are shown in the corresponding content of each example.

[0053] Western blot: Total cell protein was extracted using RIPA cell lysis buffer. The protein concentration was determined using a BCA kit. 20 μg of protein was loaded for 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to a PVDF membrane by wet transfer at 400 mA for 0.5 h. The membrane was blocked with blocking solution at room temperature for 1 h, washed with TBST, and then incubated with the primary antibody overnight at 4°C. The membrane was washed with TBST 3 times, 5 minutes each time, incubated with the corresponding secondary antibody at room temperature for 1 h, and then washed 3 times again, 5 minutes each time. The antigen-antibody complex was detected by enhanced chemiluminescence (ECL), exposed to X-ray film in a darkroom and scanned. Protein quantification was performed by analyzing the gray value of the target band, and the relative expression level of the target protein was expressed as the gray value of the target band / gray value of the internal reference band.

[0054] Example 1

[0055] SNHG16 screening

[0056] Through experimental research, it was found that adipose tissue exosomes (AT-Exo) have a stronger ability to promote the proliferation and adipogenic differentiation of adipose stem cells (ADSCs) than adipose stem cell exosomes (ADSCs-Exo). Further, high-throughput sequencing of lncRNAs in AT-Exo was performed, and SNHG16, which is highly expressed in AT-Exo compared to ADSCs-Exo, was screened out by RT-qPCR.

[0057] 1.1 Experiment on the promotion of the proliferation and adipogenic differentiation of adipose stem cells by adipose tissue exosomes and adipose stem cell exosomes

[0058] A) CCK-8 proliferation activity assay: ADSCs were co-incubated with 30 μg / ml of AT-Exo or ADSCs-Exo for 0 - 5 days, and the proliferation activities of ADSCs at different time points were detected respectively. The results are shown in Figure 1 as follows: Figure 1 Figure showing the comparison of CCK-8 cell proliferation activities of the control group (Control), adipose-derived stem cell exosome group (ADSCs-Exo), and adipose tissue exosome group (AT-Exo) at 0, 1, 3, and 5 days. As can be seen from Figure 1 this figure, compared with the control group (without intervention), the proliferation activities of the AT-Exo group and the ADSCs-Exo group increased more significantly, and the proliferation activity of the AT-Exo group was slightly higher than that of the ADSCs-Exo group.

[0059] B) Oil Red O staining: ADSCs were co-incubated with 30 μg / ml of AT-Exo or ADSCs-Exo for 5 days, and then induced to differentiate into adipocytes. The results are shown in Figure 2 , Figure 2 where (a) in Figure 2 is the Oil Red O staining result of the control group, Figure 2 where (b) in Figure 2 is the Oil Red O staining result of the AT-Exo group, and

[0060] where (c) in

[0061] is the Oil Red O staining result of the ADSCs-Exo group. As can be seen from

[0062] this figure, compared with the control group (without intervention), the adipogenic differentiation levels of the AT-Exo group and the ADSCs group were stronger, and the adipogenic differentiation ability of the AT-Exo group was stronger than that of the ADSCs group.

[0060] 1.2 High-throughput sequencing of lncRNAs in AT-Exo

[0061] High-throughput sequencing of lncRNAs: Using the Arraystar LncRNA Array method (see below), a large number of lncRNAs were found in AT-Exo

[0062] Among them, the specific steps of the Arraystar LncRNA Array method are as follows: Using Exosomes obtained by reagent treatment were used, and the quantity and quality of RNA were evaluated using NanoDrop ND-1000 (Thermo Fisher Scientific, USA). RNA integrity was evaluated by standard denaturing gel electrophoresis. Sample labeling and microarray hybridization were performed according to the Agilent one-color microarray-based gene expression analysis protocol (Agilent Technologies). Each sample was amplified using the random primer method and transcribed into fluorescent cDNA. The labeled cDNA was purified using the RNeasy Mini Kit (Qiagen), and the concentration and activity were detected using NanoDrop ND-1000. The hybridization solution was dispensed onto the pad slides, assembled onto the lncRNA expression microarray slides, and the hybridized chips were washed, fixed, and scanned using an Agilent DNA microarray scanner (part number G2505C).

[0063] The results of high-throughput sequencing of lncRNA are shown in Figure 3 as follows. From Figure 3 it can be seen that multiple lncRNAs are contained in the two adipose tissue exosome samples subjected to high-throughput sequencing.

[0064] 1.3 GO enrichment analysis was performed on all lncRNAs, and it was found that these lncRNAs were related to cell cycle regulation and lipid metabolism regulation

[0065] GO enrichment analysis was performed on all lncRNAs. The analysis results are shown in Figure 4 as follows. From Figure 4 it can be seen that the top 15 functions of the lncRNAs contained in the two adipose tissue exosome samples subjected to high-throughput sequencing include cell cycle, cell biogenesis, lipid metabolism of cells, etc.

[0066] 1.4 RT-qPCR was used to verify that the expression level of SNHG16 was higher in AT-Exo than in ADSCs-Exo

[0067] RT-qPCR analysis was performed on adipose tissue exosomes (AT-Exo) and adipose-derived stem cell exosomes (ADSCs-Exo). The results showed that the expression level of SNHG16 was significantly higher in AT-Exo than in ADSCs-Exo, as shown in Figure 5 as follows.

[0068] The RT-qPCR detection method is as described above. The primer sequences used for amplification are shown in Table 1.

[0069] Table 1 Amplification primers for detecting the expression level of SNHG16 in AT-Exo and ADSCs-Exo by RT-qPCR

[0070] Primer Name Primer Number Primer Sequence GAPDH-F SEQ ID NO.2 5’-ACAGCCTCAAGATCATCAGC-3’ GAPDH-R SEQ ID NO.3 5’-GGTCATGAGTCCTTCCACGAT-3’ SNHG16-F SEQ ID NO.4 5’-TGGTGTTTCGTTTCTGGTGACTGAG-3’ SNHG16-R SEQ ID NO.5 5’-GCAAGAGACTTCCTGAGGCACATC-3’

[0071] Example 2

[0072] Construction of a lentiviral vector for overexpressing LncRNA SNHG16

[0073] In the present invention, the human LncRNA SNHG16 sequence is constructed into the PLVX-EF1A-CDGA-2A-PURO-CMV-MCS vector.

[0074] The construction steps include:

[0075] Screen LncRNA SNHG16.

[0076] Obtain a linearized PLVX-EF1A-CDGA-2A-PURO-CMV-MCS vector by restriction enzyme digestion.

[0077] Construct a PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector by homologous recombination ligation. The PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector is a lentiviral vector for overexpressing LncRNA SNHG16.

[0078] In the lentiviral vector for overexpressing LncRNA SNHG16, PLVX is a lentiviral vector, and LncRNA SNHG16 is driven by the CMV promoter for expression; the CDGA-2A-PURO gene is driven by the EF1a promoter for expression and has green fluorescence and puromycin resistance.

[0079] Specifically:

[0080] 1) Gene information: Homo sapiens small nucleolar RNA host gene 16 (SNHG16), transcript variant2, long non-coding RNA, Sequence ID: NR_038109.1 (human LncRNA SNHG16, transcriptional splicing 2), and the sequence to be inserted is the full length of the gene.

[0081] 2) Lentivirus used: In the present invention, the pSPAX2 and pMD2.G packaging systems are used to package the lentiviral vector plasmid, which can infect adipose-derived mesenchymal stem cells (ADSCs).

[0082] 3) Promoter: The promoter used in the present invention is CMV, and the CMV promoter can initiate the expression of foreign genes in ADSCs.

[0083] 4) Plasmid map, see the plasmid map in Figure 6 as shown.

[0084] 5) The sequence of the lentiviral vector overexpressing LncRNA SNHG16 (plasmid sequence) is shown in SEQ ID NO.1, where:

[0085] SEQ ID NO.1:

[0086] gaattcctcgag catcatgtcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagataagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagt

[0087] It should be noted that the sequence represented by capital letters in the above plasmid sequence is the complete inserted SNHG16 sequence.

[0088] Example 3

[0089] Preparation of ADSCs cell line overexpressing LncRNA SNHG16

[0090] 3.1 Infection method

[0091] After the successful construction of the lentiviral vector plasmid overexpressing LncRNA SNHG16, virus packaging was carried out using the pSPAX2 and pMD2.G packaging systems, and then adipose stem cells were transfected to prepare an ADSCs cell line overexpressing LncRNA SNHG16. The specific operations are as follows: On the first day: Cells were plated in groups, and the cell number was expected to reach an ideal confluence rate (about 30 - 40%) during the experiment on the next day; On the second day: The cryopreserved virus solution was thawed by standing on ice; Calculate the volume of virus solution required for each well, dilute it in the medium volume required for that well to make an infection solution; Add a certain volume ratio of polybrene (final concentration: 2 - 10 μg / mL) to enhance the infection efficiency; Aspirate the medium in the well and add the infection solution; Culture overnight; On the third day: Replace with fresh medium and continue culturing in an incubator at 37°C and 5% CO2. Observe the green fluorescence expression on the fourth and fifth days under a fluorescence microscope and take pictures to judge the lentivirus infection efficiency. When the cells expressing green fluorescence reach more than 80%, collect the cells for relevant experimental detection.

[0092] In this example, the MOI values of the infection experiment were set to 0, 20, 50, 80, and 100. The volume of virus solution used V (μL) = N × MOI / T, where N is the cell number and T is the virus titer (TU / ml).

[0093] 3.2 Identification results of infection efficiency

[0094] The microscopic fluorescence expression levels of lentivirus transfected into adipose stem cells with different MOI values are shown in Figure 7 as follows. Figure 7 In Figure 7 , a, b, c, and d correspond to the photos with MOI values of 20, 50, 80, and 100 respectively, and

[0095] In this invention, the optimal MOI value of the experiment was determined according to the number of green fluorescences after transfection. It can be seen from Figure 7 that when MOI = 50, the infection efficiency is the highest.

[0096] 3.3 Verification of high expression of LncRNA SNHG16 in ADSCs by RT - qPCR

[0097] RT-qPCR analysis was performed on the expression levels of LncRNA-SNHG16 in the blank control group of uninfected adipose-derived stem cells (ADSCs), the SNHG16-16 empty lentivirus, and the negative control group transfected with the overexpressed LncRNA SNHG16 lentiviral vector (SNHG16 overexpressed lentivirus). The results showed that the negative control group highly expressed LncRNA-SNHG16, as shown in Figure 8 shown.

[0098] The specific detection steps were as follows: Total cellular RNA was extracted after transfection, reverse-transcribed into cDNA, an amplification system was prepared, and the reaction was carried out in a PCR instrument. The PCR amplification primers were as follows:

[0099] The sequence of the forward primer F was as shown in SEQ ID NO.6, and the sequence of the reverse primer R was as shown in SEQ ID NO.7.

[0100] SEQ ID NO.6:

[0101] 5’-GTGGATCCGAGCTCGGTACCGCGTTCTTTTCGAGGTCGGCCGCGTGG-3’.

[0102] SEQ ID NO.7:

[0103] 5’-ATATTTTATTACCGGTTTAATTAATGACGGTAGTTTCCCAAGTTTATTGTAAG-3’.

[0104] Example 4

[0105] Evaluation of the proliferation activity of the ADSCs cell line overexpressing LncRNA SNHG16

[0106] After preparing the ADSCs cell line overexpressing SNHG16, the CCK-8 and flow cytometry PI staining were used to evaluate the cell proliferation activity. The results are shown in Figures 9 - 13 shown.

[0107] Figure 9 is the result graph of CCK-8 detection of cell proliferation activity after overexpressing SNHG16; Figure 10 is the cell cycle fitting graph of adipose-derived stem cells transfected with the SNHG16 empty lentivirus, Figure 11 adipose-derived stem cells are the cell cycle fitting graph after transfection with the SNHG16 overexpressed lentivirus; Figure 12 is the result of RT-qPCR detection of the expression levels of Ki67 and PCNA mRNA after transfection; Figure 13 is the band graph of Ki67 and PCNA proteins detected by Western blot after transfection; Figure 14Results of semi - quantitative gray - scale value analysis of Ki67 and PCNA protein expression levels. (n = 3, ** indicates P < 0.01, *** indicates P < 0.001)

[0108] It can be seen that after transfection with the over - expression SNHG16 vector, the proliferation activity of cells increased at 5 and 7 days; Figure 9 It can be seen that after transfection with the over - expression SNHG16 vector, the proliferation activity of cells increased at 5 and 7 days; From Figure 10 and Figure 11 It can be seen that flow cytometry PI staining showed an increase in the number of cells in the S phase (proliferation phase) after over - expression of SNHG16; From Figure 12 It can be seen that RT - qPCR showed an increase in the expression levels of the key cell - cycle regulatory genes Ki67 and PCNA after transfection, and from Figure 13 and Figure 14 It can be seen that Western blot showed an increase in the expression levels of the key cell - cycle proteins Ki67 and PCNA after transfection.

[0109] The RT - qPCR detection method is described in detail above, and the primer sequences used in the amplification are shown in Table 2.

[0110] Table 2 Amplification primers for detecting the expression levels of Ki67 and PCNA mRNA after transfection by RT - qPCR

[0111] Primer Name Primer Number Primer Sequence Ki67-F SEQ ID NO.8 5’-CAGGAAGTGGCAGAGGTAGGAC-3’ Ki67-R SEQ ID NO.9 5’-GCTTGGTGGAATACTGAGACTGATG-3’ PCNA-F SEQ ID NO.10 5’-GGTCTGGTGGAAGTGATGCTAATAG-3’ PCNA-R SEQ ID NO.11 5’-TGAGACAGGAGAATTGCTTGAACC-3’

[0112] Example 5

[0113] Evaluation of the adipogenic differentiation level of ADSCs cell line over - expressing LncRNA SNHG16

[0114] After preparing the ADSCs cell line over - expressing SNHG16, Oil Red O staining, RT - qPCR, and Western blot were used to evaluate the adipogenic differentiation level of the cells, and the results are shown in detail in Figures 15 - 19 .

[0115] Figure 15 Figure showing the results of Oil Red O staining for detecting the lipid formation level in adipose - derived stem cells after transfection with lentivirus. Among them, a and c are the Oil Red O staining conditions in cells under a microscope magnified 100 times, and b and d are the Oil Red O staining conditions in cells under a microscope magnified 200 times; Figure 16 Absorbance value at 520 nm after isopropanol extraction of cells stained with Oil Red O; Figure 17 Results of RT - qPCR for detecting the expression levels of PPAR - γ and CEBP - α mRNA after transfection; Figure 18 Band diagram of Western blot for detecting PPAR - γ and CEBP - α proteins after transfection; Figure 19Results of semi - quantitative grayscale value analysis of the protein expression levels of PPAR - γ and CEBP - α. (n = 3, * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001).

[0116] From Figure 15 it can be seen that after transfection with the over - expressing SNHG16 vector, the number of lipid droplets in the cells increased; from Figure 16 it can be seen that the lipid formation level of the cells increased after transfection; from Figure 17 it can be seen that RT - qPCR showed that the expression levels of the key regulatory genes PPAR - γ and CEBP - α in adipogenic differentiation increased after transfection, and from Figure 18 and Figure 19 it can be seen that Western blot showed that the expression levels of the key adipogenic differentiation proteins PPAR - γ and CEBP - α increased after transfection.

[0117] For the RT - qPCR detection method, see the above description. The primer sequences used in PCR amplification are shown in Table 3.

[0118] Table 3 Amplification primers for detecting the mRNA expression levels of PPAR - γ and CEBP - α after transfection by RT - qPCR

[0119]

[0120]

[0121] Example 6

[0122] Comparative experiment between plasmid transfection of ADSCs and lentivirus transfection of ADSCs

[0123] 1) Infection method:

[0124] Regarding the plasmid infection method: On the first day: Plate the grouped cells, and the number of cells is expected to reach the ideal confluence rate (about 70 - 80%) during the experiment on the next day; On the second day: Vortex - mix an appropriate amount of plasmid with serum - free medium in a centrifuge tube, add the plasmid transfection reagent E - trans, gently vortex - mix, place at room temperature for 5 - 10 minutes, add drop - by - drop to the cell culture dish, gently mix, and then place the cells in the incubator. After 24 - 48 hours, observe the green fluorescence expression under a fluorescence microscope and take pictures to judge the plasmid infection efficiency.

[0125] Regarding the lentivirus infection method: See Example 3

[0126] 2) Identification of infection results:

[0127] The fluorescence expression level of plasmid - transfected adipose - derived stem cells under the microscope is shown in Figure 20 . Figure 20In a and b, they are the cell conditions under natural light and blue light (exciting green fluorescence) after transfecting the empty plasmid of SNHG16 under a microscope respectively. In c and d, they are the cell conditions under natural light and blue light (exciting green fluorescence) after transfecting the overexpression plasmid of SNHG16 under a microscope respectively.

[0128] The microscopic fluorescence expression levels of lentivirus transfection of adipose stem cells are shown in detail in Figure 21 . Figure 21 In a and b, they are the cell conditions under natural light and blue light (exciting green fluorescence) after transfecting the empty lentivirus of SNHG16 under a microscope respectively. In c and d, they are the cell conditions under natural light and blue light (exciting green fluorescence) after transfecting the overexpression lentivirus of SNHG16 under a microscope respectively.

[0129] The present invention compares the transfection efficiencies of plasmids and lentiviruses by measuring the proportion of green fluorescence after transfection. From Figure 20 it can be seen that the proportions of cells expressing green fluorescence after transfecting the adipose stem cells with the empty and overexpression plasmids of SNHG16 are both less than 1%. From Figure 21 it can be seen that the proportions of cells expressing green fluorescence after transfecting the adipose stem cells with the empty and overexpression lentiviruses of SNHG16 constructed in the present invention are greater than 80%.

[0130] The above content is a further detailed description of the present invention in combination with specific preferred embodiments. It cannot be determined that the specific implementation of the present invention is only limited to these descriptions. For those of ordinary skill in the technical field to which the present invention belongs, without departing from the concept of the present invention, several simple deductions and substitutions can still be made, which should all be regarded as belonging to the protection scope of the present invention.

Claims

1. Use of a lentiviral vector overexpressing LncRNA SNHG16 in the preparation of an engineering material for promoting the proliferation and adipogenic differentiation of adipose stem cells, characterized in that: Adipose-derived stem cells were transfected with lentiviral vectors overexpressing LncRNA SNHG16 to promote the proliferation and adipogenic differentiation of adipose-derived stem cells.

2. The use according to claim 1, characterized in that: The LncRNA SNHG16 overexpression lentiviral vector is a PLVX-EF1A-CDGA-2A-PURO-CMV- SNHG16 vector, wherein PLVX is a lentiviral vector, SNHG16 is driven by the CMV promoter, and the CDGA-2A-PURO gene is driven by the EF1A promoter, and has green fluorescence and puromycin resistance.

3. The use according to claim 2, characterized in that: The sequence of the PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector is shown in SEQ ID NO.

1.

4. The use according to any one of claims 1 to 3, characterized in that: The method for constructing the LncRNA SNHG16 overexpressing lentiviral vector comprises the following steps: Screening of LncRNA SNHG16; The linearized PLVX-EF1A-CDGA-2A-PURO-CMV-MCS vector was obtained by enzyme digestion; The PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector was constructed by homologous recombination, wherein the SNHG16 insertion sequence was the full length of the gene.

Images