High-yield gamma-cyclodextrin glucosyltransferase strain and application thereof

Abstract

The invention provides a strain of high-yield gamma-cyclodextrin glucosyltransferase and application of the strain. Specifically, the invention relates to a gamma-cyclodextrin production method, which comprises the following steps: (a) in the presence of a gamma-cyclodextrin glucosyltransferase mutant, carrying out enzymatic reaction on a substrate starch so as to form gamma-cyclodextrin. The invention also provides a strain for high yield of gamma-cyclodextrin glucosyltransferase, and a gamma-cyclodextrin glucosyltransferase mutant gene is integrated in a strain genome. The mutant enzyme and the strain provided by the invention can be used for generating high-yield gamma-cyclodextrin.

Description

Technical Field

[0001] The invention relates to the fields of biotechnology / synthetic biology / bioengineering / genetic engineering / enzyme engineering, and in particular to a strain with high yield of gamma-cyclodextrin glucosyltransferase and application thereof. Background Art

[0002] Cyclodextrin Glycosyltransferase (CGTase, EC2.4.1.19) is a member of the α-amylase family (G13), which can use starch to produce cyclodextrin. Cyclodextrin is a general term for a series of cyclic oligosaccharides produced by cyclodextrin glucosyltransferase, usually containing 6 to 12 D-pyranose units. Cyclodextrin has a slightly conical hollow cylindrical three-dimensional ring structure, with both a hydrophilic surface and a hydrophobic cavity structure. It is an embedding material with broad application prospects and has been used in medicine, food, daily chemicals, agriculture, environmental protection, materials and other fields. According to the number of glucose units constituting cyclodextrin, the common cyclodextrins composed of 6, 7, and 8 glucose units are named α-cyclodextrin, β-cyclodextrin and γ-cyclodextrin respectively. According to the different product specificities, cyclodextrin glucosyltransferases are divided into α-CGT enzymes, β-CGT enzymes and γ-CGT enzymes.

[0003] Compared with α-cyclodextrin and β-cyclodextrin, γ-cyclodextrin has the best solubility and the largest cavity. It can be almost completely decomposed by α-amylase in the body and can be rapidly degraded, absorbed, and metabolized in the gastrointestinal tract. Therefore, γ-cyclodextrin has the lowest toxicity and currently has no minimum daily intake limit. It has broad application prospects in the fields of food and medicine. At present, the global cyclodextrin industry market size has reached 1.5 billion yuan, and β-cyclodextrin is the main one, while the output of γ-cyclodextrin only accounts for about 4% of the global cyclodextrin output, and its price is extremely high.

[0004] At present, the bacterial species commonly used in the industrial production of cyclodextrin glucosyltransferase (CGTase) include only a few species such as Bacillus stearothermophilus, Bacillus stearalkaliphilus, and Bacillus softening. The products generated by the CGTase produced by them when converting starch are mainly β-cyclodextrin, so they are generally used in the production of β-cyclodextrin. The γ-CGTase for γ-cyclodextrin either has low product specificity and poor production performance, or the production bacteria have weak enzyme production capacity during fermentation and low yield, which cannot meet the requirements of industrial production, greatly affecting the commercial production and promotion and application of γ-cyclodextrin.

[0005] Researchers at home and abroad have been trying to find gamma-cyclodextrin glucosyltransferase (γ-CGTase) with good product specificity and high catalytic efficiency, and to express it heterologously (i.e., using a heterologous host with strong production performance to construct a genetically engineered strain that can efficiently express γ-CGTase), in order to significantly increase its yield and realize industrial production.

[0006] At present, the existing technology has the following disadvantages:

[0007] ① The proportion of γ-cyclodextrin in the products of starch conversion catalyzed by CGTase from existing sources is very low, generally less than 30%, that is, the product specificity is insufficient. The γ-CGTase produced by wild-type strains has a very low conversion rate for starch, generally reported to be 8-10%, and the highest is only about 30%.

[0008] ② The proportion of γ-cyclodextrin produced by γ-CGTase produced by genetically engineered enzyme-producing bacteria in the cyclodextrin mixture can be as high as 50%-80%, but existing literature reports show that its starch conversion rate is still low (about 10%).

[0009] ③ The genetically engineered bacteria reported in the existing literature all use prokaryotes as hosts, especially E. coli (Escherichia coli). The main disadvantages of prokaryotic hosts are: the exogenous genes exist in plasmids, the genetic traits are unstable, the strains are easy to degenerate, and they are not conducive to large-scale industrial applications; they are easy to form inclusion bodies when expressing exogenous proteins, resulting in low actual expression of active enzyme proteins; the protein secretion ability is poor, and the cell wall needs to be broken and homogenized when collected, resulting in a lot of impurities in the fermentation broth, and the purity of the obtained CGT enzyme is low, affecting the product quality; it is easy to be degraded by the host's own protease, so that the enzyme activity is maintained for a short time, which is not conducive to production operations. The bigger problem is that E. coli, a commonly used host in genetic engineering operations, has potential safety risks in the field of food and medicine.

[0010] Therefore, there is an urgent need to establish a safe, efficient, and high-yield γ-CGTase microbial secretion expression system in this field to promote the development and application of γ-cyclodextrin. Summary of the invention

[0011] The invention provides a safe, efficient and high-yield microbial secretion expression system for gamma-CGT enzyme and application thereof.

[0012] In a first aspect of the present invention, a method for producing γ-cyclodextrin is provided, comprising the steps of:

[0013] (a) in the presence of a mutant of γ-cyclodextrin glucosyltransferase, subjecting substrate starch to an enzymatic hydrolysis reaction, thereby forming γ-cyclodextrin;

[0014]

[0015] The mutant has the following mutation: S561A, wherein the site is based on the wild-type alkaliphilic Bacillus clarkii 7364 γ-cyclodextrin glucosyltransferase sequence shown in SEQ ID NO:3.

[0016] In another preferred embodiment, in the presence of the γ-cyclodextrin glucosyltransferase mutant, the conversion rate of starch to cyclodextrin is 50-70 wt %, preferably 60-70 wt %, more preferably 65-70 wt %, based on the total weight of cyclodextrin.

[0017] In another preferred embodiment, the cyclodextrin includes: γ-cyclodextrin and β-cyclodextrin.

[0018] In another preferred embodiment, the content of γ-cyclodextrin in all cyclodextrins is ≥ 95%, preferably

[0019] ≥97%, more preferably ≥98%.

[0020] In the second aspect of the present invention, an isolated or purified γ-cyclodextrin glucosyltransferase mutant is provided, wherein the mutant is: a γ-cyclodextrin glucosyltransferase mutant having S561A;

[0021] Wherein, the amino acid numbering is based on the amino acid sequence of wild-type Bacillus clarkii7364 shown in SEQ ID NO:3.

[0022] In the third aspect of the present invention, an isolated polynucleotide is provided, wherein the polynucleotide encodes the γ-cyclodextrin glucosyltransferase mutant according to the second aspect of the present invention.

[0023] In another preferred example, the polynucleotide sequence is SEQ ID NO: 2.

[0024] In the fourth aspect of the present invention, a vector is provided, wherein the vector contains the polynucleotide described in the third aspect of the present invention.

[0025] In the fifth aspect of the present invention, a genetically engineered host cell is provided, wherein the host cell contains the vector described in the fourth aspect of the present invention, or the polynucleotide described in the third aspect of the present invention is integrated into its genome.

[0026] In another preferred embodiment, the host cell is selected from the following group: prokaryotes, eukaryotes, or a combination thereof.

[0027] In another preferred embodiment, the host cell is a unicellular organism.

[0028] In another preferred embodiment, the host cell is a eukaryotic organism.

[0029] In another preferred embodiment, the host cell is a fungus.

[0030] In another preferred embodiment, the host cell comprises a fungus selected from the group consisting of yeast, mold, or a combination thereof.

[0031] In another preferred embodiment, the host cell is yeast.

[0032] In another preferred embodiment, the host cell is Pichia pastoris.

[0033] In another preferred embodiment, the host cell is genetically engineered Pichia sp., with the accession number being CGMCC NO.27287.

[0034] In the sixth aspect of the present invention, there is provided a use of the γ-cyclodextrin glucosyltransferase mutant described in the second aspect of the present invention, which is used in an enzymatic hydrolysis reaction.

[0035] In the seventh aspect of the present invention, there is provided a use of the genetically engineered host cell according to the fifth aspect of the present invention for producing γ-cyclodextrin glucosyltransferase.

[0036] In an eighth aspect of the present invention, a reaction system for performing an enzymatic hydrolysis reaction is provided, the reaction system comprising:

[0037] (Z1) an enzyme, wherein the enzyme is: the γ-cyclodextrin glucosyltransferase mutant described in the second aspect of the present invention; and

[0038] (Z2) Starch substrate.

[0039] In another preferred embodiment, the enzyme is an enzyme that is isolated or not isolated from cells.

[0040] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The pPICZαA plasmid backbone fragment and the γ-CGTase gene fragment amplified separately are shown.

[0042] Figure 2 The figure shows the result of colony PCR on Escherichia coli JM109 containing the recombinant plasmid pPICZαA-γCGT.

[0043] Figure 3The SDS-PAGE electrophoresis diagram of 10 single colonies after induction in shake flasks is shown.

[0044] Figure 4 The electropherogram of the fermentation broth from a 10 L fermentor is shown.

[0045] Figure 5 The growth curve of enzyme activity produced by fermentation in a 10L tank is shown.

[0046] Figure 6 The distribution of various cyclodextrin components in the product generated by starch conversion by γ-CGTase produced by the recombinant engineering bacteria constructed in the present invention is shown. DETAILED DESCRIPTION

[0047] After extensive and in-depth research and a large number of screenings, the inventors unexpectedly developed a method for high-yield γ-cyclodextrin. Specifically, the inventors found that a high-yield γ-cyclodextrin glycosyltransferase mutant can be produced by mutating the original gene sequence of γ-cyclodextrin glycosyltransferase and then transferring it into Pichia pastoris, and the γ-cyclodextrin glycosyltransferase mutant is used for the enzymatic hydrolysis of starch to obtain high-yield γ-cyclodextrin. The present invention was completed on this basis.

[0048] the term

[0049] As used herein, "CGTase," "CGTase," or "cyclodextrin glucosyltransferase" are used interchangeably to refer to cyclodextrin glucosyltransferase.

[0050] As used herein, the terms "Pichia pastoris genetically engineered bacteria", "Pichia pastoris X33", and "Pichiasp." are used interchangeably and all refer to Pichia pastoris genetically engineered bacteria into which the γ-cyclodextrin glucosyltransferase mutant gene of the present invention is integrated.

[0051] As used herein, the terms "Alkalophilic Bacillus clarkii 7364", "wild-type Bacillus clarkii 7364", and "wild-type Alkalophilic Bacillus clarkii 7364" are used interchangeably and all refer to wild-type Alkalophilic Bacillus clarkii 7364.

[0052] As used herein, the terms "γ-cyclodextrin glucosyltransferase mutant", "γ-cyclodextrin glucosyltransferase mutant protein", and "mutant γ-cyclodextrin glucosyltransferase" are used interchangeably and refer to a mutant protein having one or more amino acid substitutions, deletions, or insertions compared to the amino acid sequence of a wild-type γ-cyclodextrin glucosyltransferase.

[0053] As used herein, "cyclodextrin" or "CD" refers to cyclodextrins converted from starch as a substrate and CGTase as a biocatalyst. There are generally three types, named: α-cyclodextrin (α-CD), β-cyclodextrin (β-CD), and γ-cyclodextrin (γ-CD), which are closed ring structures formed by 6, 7, and 8 glucose residues connected by glycosidic bonds, respectively.

[0054] The purpose of the present invention is to use starch as raw material (substrate) and CGTase secreted by the constructed recombinant genetic engineering bacteria as catalyst to transform starch into gamma-cyclodextrin.

[0055] As used herein, "prokaryotes" refers to organisms such as bacteria and actinomycetes that do not have a typical nuclear structure (lack of a nuclear membrane).

[0056] As used herein, "eukaryote" refers to organisms with a typical nuclear structure, such as yeast, mold (filamentous fungi), animal and plant cells, and an intact nuclear membrane.

[0057] As used herein, "host bacteria" refers to strains that have recombined foreign genes into their own genomes, can grow and reproduce autonomously, and the foreign genes are replicated synchronously with the host genome and expressed (synthesized proteins encoded by the target genes). The recombinant strains constructed are called "recombinant genetically engineered bacteria".

[0058] Host bacteria are generally genetically modified and are not completely equivalent to wild-type strains, but some basic physiological characteristics are still retained. This is also the underlying logic for selecting suitable host bacteria for different exogenous genes in order to exhibit different culture characteristics.

[0059] Generally, the technical difficulty of transferring genes from prokaryotes (such as the CGTase encoding gene used in the present invention) into prokaryotic hosts is lower than that into eukaryotic hosts, but prokaryotic hosts have many disadvantages that are not conducive to subsequent production, which have been described in detail above.

[0060] The host bacteria selected in the present invention is Pichia pastoris, which is a eukaryotic host with excellent production performance. It was successfully constructed after overcoming great technical obstacles, which is one of the biggest highlights of the present invention.

[0061] As used herein, "recombinant plasmid" refers to a plasmid tool that can recombinate foreign genes into the host nuclear genome.

[0062] As used herein, "starch conversion rate" refers to the ratio of (γ-cyclodextrin production / starch feed amount), that is, the conversion rate of the single component "γ-cyclodextrin" to starch, while the conversion rate generally refers to the ratio of the total amount of the mixture of all three cyclodextrins (α-, β-, γ-) to the starch feed amount. Therefore, the starch conversion rate described herein can better reflect the product specificity of the CGTase of the present invention than this index in general literature.

[0063] Protein of the present invention

[0064] As used herein, the term "protein of the present invention" refers to γ-cyclodextrin glucosyltransferase or a mutant thereof.

[0065] In the present invention, a particularly preferred class of proteins is

[0066] (i) γ-cyclodextrin glycosyltransferase mutant with S561A.

[0067] As used herein, "isolated polypeptide" means that the polypeptide is substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify the polypeptide using standard protein purification techniques. Substantially pure polypeptides can produce a single major band on a non-reducing polyacrylamide gel. The purity of the polypeptide can also be further analyzed using an amino acid sequence.

[0068] The active polypeptide of the present invention can be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. The polypeptide of the present invention can be a naturally purified product, or a chemically synthesized product, or produced from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, plant) using recombinant technology. Depending on the host used in the recombinant production scheme, the polypeptide of the present invention can be dehydration condensation or non-dehydration condensation. The polypeptide of the present invention may also include or not include an initial methionine residue.

[0069] The present invention also includes fragments, derivatives and analogs of the polypeptide. As used herein, the terms "fragment", "derivative" and "analog" refer to polypeptides that substantially retain the same biological function or activity of the polypeptide.

[0070] The polypeptide fragments, derivatives or analogs of the present invention may be (i) polypeptides having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) polypeptides having a substitution group in one or more amino acid residues, or (iii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) polypeptides formed by fusion of an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein formed with an antigen IgG fragment). According to the teachings herein, these fragments, derivatives and analogs belong to the scope known to those skilled in the art.

[0071] The polypeptide preferably has a sequence as shown in SEQ ID NO: 3, and the term also includes variants and derivative polypeptides of SEQ ID NO: 3 that have the same function as the polypeptide. These variants include (but are not limited to): deletion, insertion and / or substitution of one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, and addition of one or more (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus.

[0072] For example, in the art, when amino acids with similar or similar properties are substituted, the function of the protein is usually not changed. For another example, adding one or more amino acids at the C-terminus and / or N-terminus usually does not change the function of the protein. The term also includes active fragments and active derivatives of the γ-cyclodextrin glucosyltransferase (γ-CGTase) of the present invention. The present invention also provides analogs of the polypeptide.

[0073] These polypeptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by radiation or exposure to mutagens, and by site-directed mutagenesis or other known molecular biological techniques. Analogs also include analogs with residues different from natural L-amino acids (such as D-amino acids), and analogs with non-naturally occurring or synthetic amino acids (such as β, γ-amino acids). It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.

[0074] Modifications (usually without changing the primary structure) include: chemical derivatization of polypeptides in vivo or in vitro, such as acetylation or carboxylation. Modifications also include sequences with phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides that have been modified to improve their anti-proteolytic properties or optimize their solubility properties.

[0075] The amino or carboxyl terminus of the protein of the present invention may also contain one or more polypeptide fragments as protein tags. Any suitable tag can be used in the present invention. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty1. These tags can be used to purify the protein.

[0076] In order to secrete the translated protein (e.g., secrete it outside the cell), a signal peptide sequence, such as pelB signal peptide, can be added to the amino acid amino terminus of the γ-cyclodextrin glycosyltransferase (γ-CGTase). The signal peptide can be cleaved off during the process of secretion of the polypeptide from the cell.

[0077] The polynucleotide of the present invention can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand.

[0078] Taking the mutant γ-CGT encoding S561A as an example, the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 3 or a degenerate variant. As used herein, "degenerate variant" in the present invention refers to a nucleic acid sequence that encodes a protein having SEQ ID NO: 3 but differs from the coding region sequence shown in SEQ ID NO: 2.

[0079] The polynucleotide encoding the mature polypeptide of SEQ ID NO: 3 includes: a coding sequence encoding only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0080] The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, or may include additional coding and / or non-coding sequences.

[0081] The present invention also relates to variants of the above-mentioned polynucleotides, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the present invention. The variants of the polynucleotides may be naturally occurring variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not substantially change the function of the polypeptide encoded by it.

[0082] The present invention also relates to polynucleotides that hybridize with the above sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize with the polynucleotides of the present invention under stringent conditions (or stringent conditions). In the present invention, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) addition of denaturing agents during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO:1.

[0083] The present invention also relates to nucleic acid fragments that hybridize to the above sequences. As used herein, a "nucleic acid fragment" has a length of at least 15 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. The nucleic acid fragment can be used in nucleic acid amplification techniques (such as PCR) to determine and / or isolate a polynucleotide encoding a γ-cyclodextrin glycosyltransferase (γ-CGTase) protein.

[0084] The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and are preferably purified to homogeneity. The full-length nucleotide sequence of the γ-cyclodextrin glucosyltransferase (γ-CGTase) of the present invention or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequences disclosed in the present invention, especially the open reading frame sequences, and commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art are used as templates to amplify and obtain the relevant sequences. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified each time in the correct order.

[0085] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0086] In addition, artificial synthesis methods can also be used to synthesize related sequences, especially when the fragment length is shorter. Usually, a long fragment of sequence can be obtained by synthesizing multiple small fragments first and then connecting them.

[0087] At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. Then the DNA sequence can be introduced into various existing DNA molecules (or such as vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis. The method of amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain full-length cDNA from the library, the RACE method (RACE-cDNA terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

[0088] The present invention also relates to a vector comprising the polynucleotide of the present invention, a host cell produced by genetic engineering using the vector of the present invention or the γ-cyclodextrin glucosyltransferase (γ-CGTase) protein coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.

[0089] The polynucleotide sequence of the present invention can be used to express or produce recombinant γ-cyclodextrin glucosyltransferase (γ-CGTase) polypeptides by conventional recombinant DNA techniques. Generally, the following steps are involved:

[0090] The invention discloses a method for transforming or transducing a suitable host cell using a polynucleotide (or variant) encoding a γ-cyclodextrin glucosyltransferase (γ-CGTase) polypeptide of the invention, or using a recombinant expression vector containing the polynucleotide; culturing the host cell in a suitable culture medium; and separating and purifying the protein from the culture medium or the cell.

[0091] In the present invention, the γ-cyclodextrin glycosyltransferase (γ-CGTase) polynucleotide sequence can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenovirus, retrovirus or other vectors well known in the art. As long as they can replicate and be stable in the host, any plasmid and vector can be used. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element.

[0092] Methods well known to those skilled in the art can be used to construct expression vectors containing γ-cyclodextrin glucosyltransferase (γ-CGTase) encoding DNA sequences and appropriate transcription / translation control signals. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: lac or trp promoters of Escherichia coli; λ phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, retroviral LTRs and other known promoters that can control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0093] In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0094] The vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform appropriate host cells to enable them to express proteins.

[0095] Host cells can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells of Drosophila S2 or Sf9; animal cells such as CHO, COS, 293 cells, or Bowes melanoma cells, etc.

[0096] In another preferred embodiment, suitable host cells include Gram-positive bacteria such as Bacillus subtilis, Gram-negative bacteria such as Escherichia coli, actinomycetes such as Streptomyces, yeasts such as Saccharomyces cerevisiae, and fungi such as Aspergillus, all of which are commonly used host cells for recombinant vectors.

[0097] When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting factors of DNA, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Examples include the SV40 enhancer of 100 to 270 base pairs on the late side of the replication origin, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

[0098] Those skilled in the art will appreciate how to select appropriate vectors, promoters, enhancers and host cells.

[0099] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0100] The obtained transformant can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0101] The recombinant polypeptide in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0102] application

[0103] The present invention also provides the application of the gamma-cyclodextrin glucosyltransferase (gamma-CGTase) and its mutants, especially the application in the reaction of enzymatically hydrolyzing starch to generate gamma-cyclodextrin.

[0104] Since certain mutant γ-cyclodextrin glucosyltransferases (γ-CGTases) of the present invention have a very high conversion rate for starch to γ-cyclodextrin (such as S561A), they can be used for in vitro enzymatic synthesis of γ-cyclodextrin.

[0105] Typically, the present invention provides a method for producing γ-cyclodextrin in vitro using the γ-cyclodextrin glucosyltransferase (γ-CGTase) of the present invention. In the method of the present invention, starch raw material can be directly produced by enzymolysis of γ-cyclodextrin glucosyltransferase (γ-CGTase) to produce the corresponding product γ-cyclodextrin.

[0106] Medium formulation

[0107] The formulas of the culture media used in the present invention are as follows:

[0108] Luria-Bertani (LB) medium: Tryptone 10.0 g·L-1, Yeast extract 5.0 g·L-1, sodium chloride 10.0 g·L-1, pH 7.0, additionally add 2% agar powder to make LB solid medium, sterilize at 121°C for 20 min, add ampicillin with a final concentration of 100 mg·L-1 and kanamycin with a concentration of 50 mg·L-1 when used.

[0109] Yeast peptone dextrose (YPD) medium: anhydrous glucose 20.0 g·L-1, Tryptone 20.0 g·L-1, Yeast extract 10.0 g·L-1, additionally add 2% agar powder to make YPD solid medium, sterilize at 115℃ for 20 min.

[0110] BSM inorganic salt culture medium: 85% H3PO4 26.7ml·L-1, CaSO4·2H2O 0.93g·L-1, K2SO418.2g·L-1, MgSO4·2H2O 14.9g·L-1, KOH 4.13g·L-1, glycerol 40g·L-1, PTM1 trace element solution 4.0ml·L-1.

[0111] PTM1 trace element solution: CuSO4·5H2O 6.0g·L-1, KI 0.088g·L-1, MnSO4·H2O3.0g·L-1, Na2MoO4·2H2O 0.2g·L-1, H3BO3 0.02g·L-1, CoCl2·6H2O 0.5g·L-1, ZnCl2 20.0g·L-1, FeSO4·7H2O 65.0g·L-1, Biotin 0.2g·L-1, concentrated H2SO4 5.0ml·L-1.

[0112] Growth medium: 50% glycerol containing 12 mL·L-1 PTM1 trace element solution.

[0113] Methanol induction medium: 100% methanol containing 12 mL·L-1 PTM1 trace element solution.

[0114] The main advantages of the present invention include:

[0115] 1. The present invention is based on the γ-CGTase gene derived from the wild-type strain of Bacillus clarkii 7364, and has undergone certain artificial modification, and the original amino acid sequence of the enzyme protein has been subjected to point mutation, and the mutant γ-CGTase obtained has a conversion rate of more than 60% for converting starch to γ-cyclodextrin. More importantly, in the cyclodextrin mixture generated by the conversion of starch, the proportion of γ-cyclodextrin is as high as more than 95%. At present, there is no literature report on γ-CGTase that can simultaneously achieve the above two indicators.

[0116] 2. The present invention uses Pichia pastoris as a host to construct a recombinant engineered bacterium carrying a target gene. The exogenous target gene is recombined into the host genome, the genetic traits are stable, and the strain is not easy to degenerate.

[0117] 3. The γ-CGT enzyme synthesized by the recombinant engineered bacteria constructed by the present invention can be autonomously secreted outside the cell without the need for cell homogenization and cell wall breaking. The bacteria can be separated by simple means such as centrifugation, and the obtained fermentation clear liquid is a crude enzyme liquid rich in γ-CGT enzyme, which greatly simplifies the operation and saves energy consumption, and is very suitable for large-scale industrial applications.

[0118] 4. The host bacteria used in the present invention is Pichia pastoris, which has good biological safety and no special restrictions on industrial application.

[0119] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0120] Example 1. Cloning of CGTase Gene and Construction of Recombinant Vector

[0121] The present inventors artificially synthesized the γ-CGTase gene derived from Alkalophilic Bacillus clarkii 7364, whose amino acid sequence is SEQ ID NO: 1 and whose nucleotide sequence is SEQ ID NO: 2, as shown below respectively.

[0122] GEVHASNATNDLSNVNYAEEVIYHIVTDRFKDGDPDNNPQGQLFSNGCSDLTKYCGGDWQGIIDEIESGYLPDMGITALWISPPVENVFDLHPEGFSSYHGYWARDFKKTNPFFGDFDDFSRLIETAHAHDIKVVIDFVPNHTSPVDIEDGALYDNGTLLGHYSTDANNYFYNYGGSDFSDYENSIYRNLYDLASLNQQHSFIDKYLKESIQLWLDTGIDGIRVDAVAHMPLGWQKAFISSVYDYNPVFTFGEWFTGAQGSNHYHHFVNNSGMSALDFRYAQVAQDVLRNQKGTMHDIYDMLASTQLDYERPQDQVTFIDNHDIDRFTVEGRDTRTTDIGLAFLLTSRGVPAIYYGTENYMTGKGDPGNRKMMESFDQTTTAYQVIQKLAPLRQENKAVAYGSTKERWINDDVLIYERSFNGDYLLVAINKNVNQAYTISGLLTEMPAQVYHDVLDSLLDGQSLAVKENGTVDSFLLGPGEVSVWQHISESGSAPVIGQVGPPMGKPGDAVKISGSGFGSEPGTVYFRDTKIDVLTWDDETIVITLPETLGGKAQISVTNADGVTSNGYDFQLLTGKQESVRFVVDNAHTNYGENVYLVGNVPELGNWNPADAIGPMFNQVVYSYPTWYYDVSVPADTALEFKFIIVDGNGNVTWESGGNHNYRVTSGSTDTVRVSFRR(SEQ ID NO:1)

[0123]

[0124] The amino acid sequence of the wild-type Bacillus clarkii 7364 γ-CGTase is shown below:

[0125] (SEQ ID NO:3)

[0126] After artificially synthesizing the CGTase gene, connect it to the pUC57 vector for use at any time. When amplifying the CGTase gene, design the primers as follows:

[0127] Primer F1: GGTGAAGTTCATGCTTCTAACG (SEQ ID NO: 4)

[0128] Primer R1: TCTTCTAAAAGAAACTCTAACAGTATCA (SEQ ID NO: 5)

[0129] The PCR reaction conditions were: denaturation at 93°C for 3 min, then denaturation at 93°C for 30 s, annealing at 56°C for 15 s, extension at 72°C for 70 s, and after 30 cycles, incubation at 72°C for 10 min. Figure 1 It was shown that the CGTase gene size was 2037 bp.

[0130] When amplifying the backbone fragment, the following primers were designed using plasmid pPICZaA as a template:

[0131] Primer F2: GTTTCTTTTAGAAGAtaaGCGGCCGCGAATTAATTCG (SEQ ID NO: 6)

[0132] Primer R2: AGCATGAACTTCACCGAATTCTACGTAAGCTTCAGCC (SEQ ID NO:7)

[0133] The PCR reaction conditions were: denaturation at 93°C for 3 min, then denaturation at 93°C for 30 s, annealing at 56°C for 15 s, extension at 72°C for 170 s, and after 30 cycles, incubation at 72°C for 10 min. Figure 1 The results showed that the size of the backbone DNA fragment for constructing the recombinant plasmid was about 5300 bp.

[0134] Refer to the above two fragments IIOne Step Cloning Kit (Vazyme Biotech Co., Ltd) instructions were used to seamlessly connect the two plasmids to construct the recombinant expression plasmid pPICZaA-CGTase. The recombinant plasmid was transformed into competent E. coli JM109 and coated on LB+Zeocin (zeocin concentration was 30 μg / ml) plates. After culturing at 37°C overnight, single colonies grew out. Colony PCR was used to verify the correct transformants. Figure 2 As shown, one of the positive single colonies was selected and inoculated into LB (with 30 μg / mL zeocin added). After culturing at 37°C overnight, the bacteria were collected and the plasmid was extracted and sent to a third party for sequencing. After the sequencing was correct, the recombinant vector pPICZaA-γCGTase containing the CGTase was obtained.

[0135] Example 2 Recombinant expression of cyclodextrin glycosyltransferase

[0136] The expression plasmid pPICZaA-γCGTase was linearized with SacI and transformed into Pichia pastoris X33 by electroporation. The transformants were coated on 100 μg / mL zeocin resistance plates. The single colonies grown after 2 days of culture were Pichia pastorisZG-C6 / pPICZaA-γCGTase. Ten single colonies were selected and inoculated into YPD shake flasks. When the OD of the bacteria grew to about 13, methanol was added once every 12 hours at a volume ratio of 1%. The fermentation was stopped after 72 hours of induction, and the supernatant was obtained by centrifugation. The enzyme activity of the supernatant was measured and the target band was detected by SDS-PAGE electrophoresis.

[0137] Enzyme activity determination method:

[0138] In this experiment, the γ-CGTase activity was determined using the bromocresol green method. The specific steps are as follows:

[0139] 1% (w / v) soluble starch was prepared with 50mM Gly-NaOH at pH 10.0 as substrate, 900μL was taken into a 5mL centrifuge tube and preheated in a 40℃ constant temperature water bath for 15-20min, then 100μL crude enzyme solution diluted appropriately was added; after reacting for 10min, 100μL 0.5M hydrochloric acid was added to terminate the reaction, and finally 2mL 200mM citric acid buffer (pH4.2) and 80μL 5mM bromocresol green (BCG) were added. After standing at room temperature for 15-20min, the absorbance was measured at a wavelength of 630nm, wherein the blank was the inactivated enzyme solution.

[0140] One unit of enzyme activity (U) was defined as the amount of enzyme required to generate 1 μmol of γ-CD within 1 min under the above reaction conditions.

[0141] The enzyme activities measured according to the above method are shown in Table 1.

[0142] Table 1. Enzyme activity after shake flask induction

[0143]

[0144] The fermentation broth was subjected to SDS-PAGE electrophoresis. Figure 3 As shown. Each group of fermentation broth has a band detected at 70kDa, indicating that the selected strain does express the target protein. And it can be seen that the S7 band is the darkest, corresponding to the highest enzyme activity detected in the fermentation broth of the same strain S7.

[0145] Therefore, S7 was selected for further tank fermentation verification in subsequent experiments of the present invention.

[0146] Example 3.10L fermenter induced expression fermentation

[0147] In order to further improve the expression level of the enzyme, an induced expression experiment was carried out at the fermentation tank level. The specific operation is as follows:

[0148] The seed liquid was inoculated into the fermenter at 10% inoculation amount, the initial fermentation medium BSM was 4L, the temperature was 30°C, the ventilation ratio was 1.5vvm, and the pH was 5.0. During the fermentation process, the dissolved oxygen concentration (DO) gradually decreased, and the stirring speed was set at about 650rpm.

[0149] When the glycerol in the initial culture medium is exhausted, the methanol induction stage begins and the culture is removed from the tank after 96 hours of induction culture.

[0150] After the fermentation, the supernatant was subjected to SDS-PAGE electrophoresis. Figure 4-Figure 5 As shown (Note: Figure 4 Shown is the induction time, Figure 5 The horizontal axis represents the fermentation period). The target band in the fermentation broth was the most concentrated at 96h of induction, and the enzyme activity reached 34.6U / mL.

[0151] According to the literature search, the expression level of the enzyme in this experiment is the highest expression level of γ-CGTase reported in the literature, laying the foundation for the subsequent efficient utilization of γ-CGTase.

[0152] Example 4. Application of recombinant γ-CGTase in the preparation of γ-cyclodextrin (γ-CD)

[0153] This example studies starch conversion reactions under the following conditions:

[0154] Using 15% starch as the substrate, 7.5 U / g enzyme was added at 70°C for 30 min, the temperature was reduced to 55°C, the pH was adjusted to 10.0, 7.5 U / g of γ-CGTase was added, and 3% (w / v) cyclododecanone was added to the reaction system. The reaction was carried out in a constant temperature water bath at 150 rpm for 6 h. The total CD conversion rate was about 65% (w / w), of which γ-CD accounted for ≥95%, β-CD accounted for no more than 5%, and α-CD accounted for very low or undetectable levels.

[0155] The distribution of various cyclodextrin components in the product generated by starch conversion by the γ-CGTase produced by the recombinant engineering bacteria constructed in the present invention is as follows: Figure 6 As shown, among all the cyclodextrins converted from starch, γ-CD accounted for the highest proportion, up to 98.12%, while β-CD accounted for only 1.82% and α-CD was not detected.

[0156] This experiment shows that the recombinant γ-CGTase expressed in this patent has extremely high product specificity, laying a good foundation for the subsequent large-scale preparation of γ-cyclodextrin.

[0157] discuss

[0158] The inventors carried out point mutation on the original amino acid sequence of CGTase derived from Bacillus clarkii 7364 strain.

[0159] The CGTase that has undergone the above mutation has better product specificity (when the enzyme is used to convert starch to produce a cyclodextrin mixture, γ-cyclodextrin accounts for at least 95% of all the cyclodextrins produced, and can even be stabilized at more than 97%; α-cyclodextrin is almost completely not produced, and the rest is β-cyclodextrin. In addition, the starch conversion rate index of the enzyme in the above conversion process is also significantly higher than the generally reported level.

[0160] In addition, the tool for introducing exogenous genes used in the present invention is a recombinant plasmid. The exogenous genes carried by the recombinant plasmid will be integrated into the host's nuclear genome by gene recombination and become part of the host's own genome. It will replicate along with the host cell's own replication. Its stability is several orders of magnitude higher than that of common free plasmid engineered bacteria, and no antibiotics need to be added during daily use.

[0161] The inventors selected Pichia pastoris as the host bacteria. After the enzyme is synthesized, it will be secreted outside the cell, which directly eliminates the need for cell wall breaking and homogenization. More interestingly, the selected host itself has the characteristic of extremely low protein excretion ability. Therefore, in addition to the above-mentioned γ-CGT enzyme, almost no other impurity proteins can be detected in its fermentation clear liquid, so that a relatively pure γ-CGT enzyme crude enzyme liquid can be obtained by simply separating the bacteria from the fermentation liquid by centrifugation or filtration, which can be directly used for subsequent starch conversion without further purification operations.

[0162] Strain preservation The Pichia sp. of the present invention was deposited in the China General Microbiological Culture Collection Center (CGMCC) (Beijing, China) on May 8, 2023, with the deposit number: CGMCC NO.27287. All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A method for producing γ-cyclodextrin, characterized in that: Includes steps: (a) in the presence of a mutant of γ-cyclodextrin glucosyltransferase, subjecting substrate starch to an enzymatic hydrolysis reaction, thereby forming γ-cyclodextrin; The mutant has the following mutation: S561A, wherein the site is based on the wild-type alkaliphilic Bacillus clarkii 7364 γ-cyclodextrin glucosyltransferase sequence shown in SEQ ID NO:

3.

2. An isolated or purified γ-cyclodextrin glucosyltransferase mutant, characterized in that: The mutants are: a γ-cyclodextrin glucosyltransferase mutant having S561A; Wherein, the amino acid numbering is based on the amino acid sequence of wild-type Bacillus clarkii7364 shown in SEQ ID NO:

3.

3. An isolated polynucleotide, characterized in that The polynucleotide encodes the γ-cyclodextrin glucosyltransferase mutant according to claim 2.

4. A carrier, characterized in that The vector contains the polynucleotide according to claim 3.

5. A genetically engineered host cell, characterized in that The host cell contains the vector according to claim 4, or the polynucleotide according to claim 3 is integrated into its genome.

6. The host cell according to claim 5, characterized in that The host cell is Pichia pastoris.

7. The host cell according to claim 6, characterized in that The host cell is a genetically engineered Pichia sp., with a preservation number of CGMCC NO.27287.

8. Use of the γ-cyclodextrin glucosyltransferase mutant according to claim 2, characterized in that: It is used in enzymatic reactions.

9. Use of the genetically engineered host cell according to claim 5, characterized in that: Used to produce γ-cyclodextrin glucosyltransferase.

10. A reaction system for enzymatic hydrolysis, characterized in that: The reaction system comprises: (Z1) an enzyme, wherein the enzyme is: the γ-cyclodextrin glucosyltransferase mutant according to claim 2; and (Z2) Starch substrate.

Images