A cytosine DNA glycosylase and a cytosine base editing system

Abstract

The present invention relates to the field of plant genetic engineering technology, and specifically provides a cytosine DNA glycosylase and a cytosine base editing system. The amino acid sequence of the cytosine DNA glycosylase mutant protein is shown in SEQ ID No. 4, and the rice cytosine base editing technology mediated by it can efficiently achieve C to G substitution, C to T substitution and indel, greatly reducing the base editing tool, simplifying the editing tool construction process, and improving the delivery efficiency to cells and the richness of variation, and has broad application prospects in promoting the directed evolution of endogenous genes in crops and the creation of new germplasm.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering and relates to a cytosine DNA glycosylase and a cytosine base editing system. Background Art

[0002] Single nucleotide polymorphisms (SNPs) mainly refer to DNA sequence polymorphisms caused by the variation of a single nucleotide at the genome level. They can be caused by the conversion or transversion of a single base, or by the insertion or deletion of a base. In agricultural organisms, SNPs are common in different varieties and populations, and many important agronomic traits are also determined by SNPs. Under natural conditions, SNPs mainly come from natural variation of genomic nucleotides, but this process is very slow and takes tens of thousands of years. In addition, SNPs can also be produced by chemical, physical and other mutagenesis techniques. The mutagenesis breeding developed from this has played a huge role in promoting the cultivation of new varieties of agricultural organisms and agricultural development. However, natural mutagenesis and physical and chemical mutagenesis are random and cannot achieve the generation of SNPs in specific genomic regions.

[0003] Base editing is a modern genetic engineering technology that achieves targeted mutations of specific nucleotides without generating double-strand breaks in DNA. It is also an artificial, precise and efficient SNP generation technology. Among them, the most widely developed and applied base editing technology is based on the CRISPR / Cas system. Its main principle is that a fusion protein composed of a base modification enzyme and a Cas9 nickase modifies the target base under the guidance of sgRNA. The modified base gradually achieves the expected base replacement after DNA replication and repair. Since its development, base editing technology has been successfully applied to a variety of crops due to its advantages such as high efficiency, independence from double-strand breaks in DNA, and the absence of donor DNA. It not only plays an important role in the functional correction of genes controlling key agronomic traits of crops, but also can generate a large number of SNPs in the directed evolution of endogenous genes in crops and provide a large number of genetic variation bases for the artificial creation of new germplasm, greatly accelerating the precision improvement of crops and germplasm innovation.

[0004] At present, the plant base editing systems mainly include: cytosine base editing technology, adenine base editing technology, guanine base editing technology and dual base editing technology. Among them, cytosine base editing technology is the earliest developed and most fully applied base editing technology. In the current cytosine base editing process, a fusion protein composed of Cas9 nickase and cytosine deaminase deaminates the target base cytosine C and forms uracil U under the guidance of sgRNA. In the subsequent DNA replication and repair, the wrong uracil will be regarded as thymine, thereby ultimately achieving the replacement of cytosine with thymine T (C-to-T). Around this technology, various cytosine deaminases have been excavated and transformed at home and abroad, such as rat-derived rAPOBEC1, human-derived hAPOBEC3A and hAID, and eel-derived CDA. During the cytosine base editing process, the G:U incorrect base pair will activate base excision repair, and uracil DNA glycosylase will remove the uracil formed by cytosine deamination to form an apyrimidine-free apurine site. Subsequently, four nucleotides (A, T, G, C) will be randomly introduced at this site during the cell DNA repair process, resulting in the replacement of cytosine C with the other three bases (C-to-T / G / A); in addition, AP endonuclease will also recognize the apyrimidine-free apurine site and cut the phosphodiester bond to form indel (base insertion or deletion). Therefore, in the basic composition of cytosine base editing technology, the introduction of uracil DNA glycosylase inhibitor UGI can inhibit the activity of uracil DNA glycosylase, thereby causing C to preferentially replace T; the introduction of uracil DNA glycosylase can promote the G:U incorrect base pair to produce apyrimidine-free apurine site, thereby achieving the replacement of C with the other three bases. The C-to-T replacement will help achieve precise gene editing and functional correction, while the C-to-T / G / A replacement will create a richer variety of base variation types, helping to achieve directed evolution of endogenous genes.

[0005] If C can be directly glycosylated and base excision repair activated to achieve C-to-T / G / A substitution and indel, the base editing tools will be greatly reduced, the editing tool construction process will be simplified, the delivery efficiency to cells and the richness of variation will be improved, and the directed evolution of endogenous genes in crops and the creation of new germplasm will be promoted. Summary of the invention

[0006] The technical problem to be solved by the present invention is to improve the efficiency of cytosine base editing by directly performing glycosylation modification on C and activating base excision repair, thereby achieving the expected cytosine base editing that cannot be achieved by current technology.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a mutant protein of OsUNG protein, the amino acid sequence of the OsUNG protein is shown in SEQ ID No. 3, the gene encoding the mutant protein is the OsUNG (N203D) mutant gene obtained by replacing the codon AAC at the 203rd position from the 5' end of the OsUNG gene with GAC, and the amino acid sequence of the mutant protein is shown in SEQ ID No. 4.

[0009] The second aspect of the present invention provides a fusion protein. In one embodiment of the present invention, a technician sequentially splices a nuclear localization polypeptide NLS1, a mutant protein, a connecting peptide, a Cas protein, and a nuclear localization polypeptide NLS2 in order from 5' to 3' to form a rice cytosine base editor rBE127d, wherein the amino acid sequence of the nuclear localization polypeptide NLS1 is shown in SEQ ID No. 6, the amino acid sequence of the mutant protein is shown in SEQ ID No. 4, the amino acid sequence of the connecting peptide is shown in SEQ ID No. 8, the amino acid sequence of the Cas protein is shown in SEQ ID No. 10, and the amino acid sequence of the nuclear localization polypeptide NLS2 is shown in SEQ ID No. 12.

[0010] Furthermore, the nucleic acid sequence encoding the polypeptide NLS1 is shown in SEQ ID No. 5.

[0011] Furthermore, the nucleic acid sequence encoding the mutant protein is shown in SEQ ID No. 2.

[0012] Furthermore, the nucleic acid sequence encoding the connecting peptide is shown as SEQ ID No. 7.

[0013] Furthermore, the nucleic acid sequence encoding the Cas protein is shown in SEQ ID No. 9.

[0014] Furthermore, the nucleic acid sequence encoding the nuclear localization polypeptide NLS2 is shown in SEQ ID No. 11.

[0015] The third aspect of the present invention provides the use of the mutant protein in rice genome editing, wherein the use is to replace C to G or C to T or to insert or delete bases on the rice genome.

[0016] The fourth aspect of the present invention provides the use of the above-mentioned fusion protein in rice genome editing, wherein the use is to replace C to G or C to T or to insert or delete bases on the rice genome.

[0017] Any of the following applications also falls within the protection scope of the present invention:

[0018] (1) Application of the above-mentioned mutant protein-related biological materials in rice single-base editing, wherein the biological materials are expression cassettes, recombinant vectors, recombinant microorganisms, transgenic rice cell lines, and transgenic rice tissues containing nucleic acid molecules encoding the mutant proteins;

[0019] (2) Application of the above-mentioned biological materials related to the cytosine base editor in single-base editing of rice, wherein the biological materials are expression cassettes, recombinant vectors, recombinant microorganisms, transgenic rice cell lines, and transgenic rice tissues containing nucleic acid molecules encoding the adenine base editor.

[0020] The expression cassette refers to a DNA capable of expressing the protein in a host cell, which may include not only a promoter for initiating transcription of the protein gene, but also a terminator for terminating transcription of the protein gene. The expression cassette may also include an enhancer sequence.

[0021] In a fifth aspect, the present invention provides a method for replacing C to G or C to T or indel in the rice genome, the specific steps are as follows: introducing a DNA molecule expressing the cytosine base editor and sgRNA into rice to obtain a rice material containing a site-directed mutation of C to G or C to T or indel. In one embodiment of the present invention, a technician performs a site-directed mutation of an endogenous target gene in rice. OsFLS2 For cytosine base editing, primers gOsFLS2-F1 and gOsFLS2-R1 containing gRNA sequences that matched the end connection of the BsaI restriction site were first designed. After the primers were synthesized, gOsFLS2-F1 / gOsFLS2-R1 were phosphorylated using T4 polynucleotide kinase and annealed to form a double strand. Then, the gOsFLS2-F1 / gOsFLS2-R1 dimer was cloned into the BsaI restriction site of the pENTR4:sgRNA vector (CN202111388739.0) to obtain pENTR4:sgRNA-gOsFLS2. pENTR4:sgRNA-gOsFLS2 was linearized by ApaI digestion, and pUbi:rBE127d was fused with pENTR4:sgRNA-gOsFLS2 to obtain pUbi:rBE127d-sgRNA-gOsFLS2. pUbi:rBE127d-sgRNA-gOsFLS2 was transformed into rice by Agrobacterium transformation.

[0022] Beneficial effects of the present invention:

[0023] The present invention obtains a mutant protein OsUNG (N203D) by artificially mutating the OsUNG protein, and uses it to develop a cytosine base editing system. The rice cytosine base editing technology mediated by the fusion of the mutant protein OsUNG (N203D) of the present invention and SpCas9 (D10A) can efficiently achieve C to G substitution, C to T substitution and indel, greatly reducing the base editing tools, simplifying the editing tool construction process, improving the efficiency of cytosine base editing technology and broadening its application range, and has broad application prospects in promoting the directed evolution of endogenous genes in crops and the creation of new germplasm, and provides a set of important gene function research and correction tools for researchers in the field of plant research and crop genetic improvement. The present invention can improve the efficiency of cytosine base editing and can accurately mediate base mutations at target sites, and can be widely used in rice and even other plant cells. DETAILED DESCRIPTION

[0024] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0025] Example 1: Artificial modification of OsUNG (N203D) protein

[0026] Based on the rice codon optimization, the OsUNG gene (SEQ ID No. 1) was obtained by replacing the codon AAC at position 203 from the 5' end with GAC to obtain the OsUNG (N203D) mutant gene (SEQ ID No. 2). The base sequence of the OsUNG (N203D) mutant gene is shown in SEQ ID No. 2, and the amino acid sequence encoded by it is shown in SEQ ID No. 4.

[0027] Example 1: Construction of Rice Cytosine Base Editing Tool Vector

[0028] NLS1 (Seq ID No. 5), OsUNG (Seq ID No. 1), Linker (Seq ID No. 7), SpCas9(D10A) (Seq ID No. 9), and NLS2 (Seq ID No. 11) were sequentially spliced ​​from 5' to 3' to form the rice cytosine base editor rBE127. Qingke Biotechnology Co., Ltd. (Beijing) was commissioned to artificially synthesize rBE127 and ligated to the pUC57 plasmid vector to obtain the positive plasmid pUC57-rBE127. pUC57-rBE127 was double-digested with SpeI / ACC65I to recover the 5.2 kb rBE127 gene fragment, and pUbi:SpCas9 was double-digested with SpeI / ACC65I to recover the 12 kb backbone fragment. The recovered 5.2 kb rBE127 gene fragment was ligated with the recovered 12 kb backbone fragment to obtain the plasmid pUbi:rBE127.

[0029] NLS1 (Seq ID No. 5), OsUNG (N203D) (Seq ID No. 2), Linker (Seq ID No. 7), SpCas9 (D10A) (Seq ID No. 9), and NLS2 (Seq ID No. 11) were sequentially spliced ​​from 5' to 3' to form the rice cytosine base editor rBE127d, which was then artificially synthesized by Qingke Biotechnology Co., Ltd. (Beijing) and ligated to the pUC57 plasmid vector to obtain the positive plasmid pUC57-rBE127d. pUC57-rBE127d was double-digested with SpeI / ACC65I to recover the 5.2 kb rBE127d gene fragment, and pUbi:SpCas9 was double-digested with SpeI / ACC65I to recover the 12 kb backbone fragment. The recovered 5.2 kb rBE127d gene fragment was ligated with the recovered 12 kb backbone fragment to obtain plasmid pUbi:rBE127d.

[0030] Example 3: Rice endogenous target gene OsFLS2 and UsSPS1 Cytosine base editing

[0031] Gene OsFLS2 (Gene accession number LOC_Os04g52780), UsSPS1 (Gene accession number LOC_Os01g69030) and OsCERK1The transcript and genomic sequences of (gene accession number LOC_Os08g42580) were obtained from the MSU / TIGR Rice Genome Database ( http: / / rice.plantbiology.msu.edu / ).

[0032] for OsFLS2 gene, design a gRNA sequence that matches the end connection of the BsaI restriction site ( CCC The primers for the 5′ end of the primer pair CGTCGTGCACTGCGACGTCA (the underlined part is NGG PAM) were gOsFLS2-F1 (gtgtGACGTCGCAGTGCACGACG, with a BsaI-cut sticky end gtgt introduced at the 5′ end) and gOsFLS2-R1 (aaacCGTCGTGCACTGCGACGTC, with a BsaI-cut sticky end aaac introduced at the 5′ end).

[0033] for UsSPS1 Gene, designed to contain a gRNA sequence that matches the end of the BsaI restriction site (CCCAAGTGGGGGCGCATTCA AGG The primers for the two primers (the underlined part is NGG PAM) were gOsSPS1-F1 (gtgtGGACCCCCGCTCGCCGTCGA, with a BsaI-digested sticky end gtgt introduced at the 5' end) and gOsSPS1-R1 (aaacTCGACGGCGAGCGGGGGTCc, with a BsaI-digested sticky end aaac introduced at the 5' end).

[0034] for OsCERK1 Gene, designed to contain a gRNA sequence that matches the end connection of the BsaI restriction site (GGATCCCAAGGAAGGCCTT AGG The primers for the 5′ end of the PCR product (with the underlined portion being NGG PAM) were gOsCERK11-F1 (gtgtGGATCCCAAGGAAGGCCTT, with a BsaI-cut sticky end gtgt introduced at the 5′ end) and gOsCERK1-R1 (aaacAAGGCCTTCCTTGGGATCC, with a BsaI-cut sticky end aaac introduced at the 5′ end).

[0035] After synthesizing the primers, gOsFLS2-F1 / gOsFLS2-R1, gOsSPS1-F1 / gOsSPS1-R1 and gOsCERK1-F1 / gOsCERK1-R1 were phosphorylated using T4 polynucleotide kinase and annealed to form double strands. Then, the gOsFLS2-F1 / gOsFLS2-R1, gOsSPS1-F1 / gOsSPS1-R1 and gOsCERK1-F1 / gOsCERK1-R1 dimers were cloned into the BsaI restriction site of the pENTR4:sgRNA vector (CN202111388739.0), respectively. The sequencing results showed that they were correct, and pENTR4:sgRNA-gOsFLS2, pENTR4:sgRNA-gOsSPS1 and pENTR4:sgRNA-gOsCERK1 were obtained, respectively. pENTR4:sgRNA-gOsFLS2, pENTR4:sgRNA-gOsSPS1 and pENTR4:sgRNA-gOsCERK1 were linearized by ApaI digestion, and pUbi:rBE127 was fused with pENTR4:sgRNA-gOsFLS2, pENTR4:sgRNA-gOsSPS1 and pENTR4:sgRNA-gOsCERK1 using the Gateway™ LR Clonase™ II Enzyme mix kit (Cat. No. 11791-100, purchased from Invitrogen, USA) to obtain pUbi:rBE127-sgRNA-gOsFLS2, pUbi:rBE127-sgRNA-gOsSPS1 and pUbi:rBE127-sgRNA-gOsCERK1, respectively. Similarly, pUbi:rBE127d was fused with pENTR4:sgRNA-gOsFLS2, pENTR4:sgRNA-gOsSPS1 and pENTR4:sgRNA-gOsCERK1, respectively, to obtain pUbi:rBE127d-sgRNA-gOsFLS2, pUbi:rBE127d-sgRNA-gOsSPS1 and pUbi:rBE127d-sgRNA-gOsCERK1, respectively.

[0036] pUbi:rBE127-sgRNA-gOsFLS2, pUbi:rBE127d-sgRNA-gOsFLS2, pUbi:rBE127-sgRNA-gOsSPS1, pUbi:rBE127d-sgRNA-gOsSPS1, pUbi:rBE127-sgRNA-gOsCERK1 and pUbi:rBE127d-sgRNA-gOsCERK1 were transformed into japonica rice variety Kitaake by Agrobacterium transformation, and then DNA was extracted from T0 generation regenerated rice plants by CTAB method.

[0037] For pUbi:rBE127-sgRNA-gOsFLS2 and pUbi:rBE127d-sgRNA-gOsFLS2, OsFLS2 The target site DNA sequence of the gene was designed and used for identification of specific PCR primers: OsFLS2-HT-F1a (ggagtgagtacggtgtgcCGTCGCGGTGGACGGTCAGG) and OsFLS2-HT-R1a (gagttggatgctggatggACGCCCAGCATGCGCGCGGT). The genomic DNA of the corresponding T0 generation regenerated rice plants was used as a template for PCR amplification, and the PCR products were sequenced to analyze and compare the events and efficiency of target site gene editing.

[0038] For pUbi:rBE127-sgRNA-gOsSPS1 and pUbi:rBE127d-sgRNA-gOsSPS1, UsSPS1 The target site DNA sequence of the gene was designed and used for identification of specific PCR primers: OsSPS1-HT-F1a (ggagtgagtacggtgtgcCATGATCCTCTGCACCGAGT) and OsSPS1-HT-R1a (gagttggatgctggatggCCGGACATACCTCACCAGGA). The genomic DNA of the corresponding T0 generation regenerated rice plants was used as a template for PCR amplification, and the PCR products were sequenced to analyze and compare the events and efficiency of target site gene editing.

[0039] For pUbi:rBE127-sgRNA-gOsCERK1 and pUbi:rBE127d-sgRNA-gOsCERK1, OsCERK1The target site DNA sequence of the gene was designed and used for identification of specific PCR primers: OsCERK1-HT-F1a (ggagtgagtacggtgtgcAAGGGGCTGGTTTATCTGGTG) and OsCERK1-HT-R1a (gagttggatgctggatggTGCATGGTTTTAACCTTGAGAATG). The genomic DNA of the corresponding T0 generation regenerated rice plants was used as a template for PCR amplification, and the PCR products were sequenced to analyze and compare the events and efficiency of target site gene editing.

[0040] Base editing is as follows (Table 1):

[0041] Table 1. Comparison of editing types and editing efficiencies of cytosine base editing tools rBE127 and rBE127d

[0042]

[0043] (1) Rice cytosine base editor rBE127 OsFLS2 The efficiency of target base C to G substitution, C to A substitution, C to T substitution and indel (base insertion or deletion) was 0%, and no editing events were detected in 49 independent transgenic rice lines; the rice cytosine base editor rBE127d OsFLS2 The efficiency of target base C to G substitution was 16.67%, C to A substitution was 0%, C to T substitution was 20.83% and indel efficiency was 41.67%. Among 48 independent transgenic rice lines, 8 lines were detected to contain the expected C to G substitution, 0 lines contained the expected C to A substitution, 10 lines contained the expected C to T substitution and 20 lines contained indel.

[0044] (2) Rice cytosine base editor rBE127 UsSPS1 The efficiency of target base C to G substitution, C to A substitution, C to T substitution and indel (base insertion or deletion) was 0%, and no editing events were detected from 48 independent transgenic rice lines; the rice cytosine base editor rBE127d UsSPS1 The efficiency of target base C to G substitution was 23.40%, C to A substitution was 0%, C to T substitution was 23.40% and indel efficiency was 70.21%. Among 47 independent transgenic rice lines, 11 lines contained the expected C to G substitution, 0 lines contained the expected C to A substitution, 11 lines contained the expected C to T substitution and 33 lines contained indel.

[0045] (3) Rice cytosine base editor rBE127 OsCERK1The efficiency of target base C to G substitution, C to A substitution, C to T substitution and indel (base insertion or deletion) was 0%, and no editing events were detected from 48 independent transgenic rice lines; the rice cytosine base editor rBE127d OsCERK1 The efficiency of target base C to G substitution was 27.08%, C to A substitution was 0%, C to T substitution was 20.83% and indel efficiency was 66.67%. From 48 independent transgenic rice lines, 13 lines were detected to contain the expected C to G substitution, 0 line contained the expected C to A substitution, 10 lines contained the expected C to T substitution and 32 lines contained indel.

[0046] In summary, the OsUNG (N203D)-mediated rice cytosine base editing technology in the present invention can efficiently achieve C to G substitution, C to T substitution and indel, that is, induce abundant nucleotide variations in the target site.

[0047] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A mutant protein of OsUNG protein, characterized in that: The amino acid sequence of the OsUNG protein is shown in SEQ ID No. 3, and the amino acid sequence of the mutant protein is shown in SEQ ID No.

4. The operation performed on the coding gene of the OsUNG protein is: replacing the codon AAC at position 203 from the 5' end with GAC.

2. A fusion protein, characterized in that: The fusion protein is formed by sequentially connecting the nuclear localization polypeptide NLS1, the mutant protein, the connecting peptide, the Cas protein, and the nuclear localization polypeptide NLS2; Among them, the amino acid sequence of the nuclear localization polypeptide NLS1 is shown in SEQ ID No. 6, the amino acid sequence of the mutant protein is shown in SEQ ID No. 4, the amino acid sequence of the connecting peptide is shown in SEQ ID No. 8, the amino acid sequence of the Cas protein is shown in SEQ ID No. 10, and the amino acid sequence of the nuclear localization polypeptide NLS2 is shown in SEQ ID No.

12.

3. A fusion protein according to claim 2, characterized in that: The nucleic acid sequence encoding the polypeptide NLS1 is shown in SEQ ID No.

5.

4. A fusion protein according to claim 2, characterized in that: The nucleic acid sequence encoding the mutant protein is shown in SEQ ID No.

2.

5. A fusion protein according to claim 2, characterized in that: The nucleic acid sequence encoding the connecting peptide is shown in SEQ ID No.

7.

6. A fusion protein according to claim 2, characterized in that: The nucleic acid sequence encoding the Cas protein is shown in SEQ ID No.

9.

7. A fusion protein according to claim 2, characterized in that: The nucleic acid sequence encoding the nuclear localization polypeptide NLS2 is shown in SEQ ID No.

11.

8. Use of the mutant protein according to claim 1 in rice genome editing, characterized in that: The application is to perform site-directed mutation of C on the rice genome into G, or site-directed mutation of C into T, or base insertion or deletion.

9. Use of the fusion protein according to claim 2 in rice genome editing, characterized in that: The application is to perform site-directed mutation of C on the rice genome into G, or site-directed mutation of C into T, or base insertion or deletion.

Images