Application of watermelon ClWRKY61 gene in influence on fruit size development

Abstract

The invention discloses application of a watermelon ClWRKY61 gene in influencing fruit size development, and belongs to the technical field of molecular biology. According to the application of the watermelon ClWRKY61 gene disclosed by the invention in influencing the fruit size development, the nucleotide sequence of the watermelon ClWRKY61 gene is as shown in SEQ ID NO. 1. The ClWRKY61 transcription factor is a positive regulatory factor for watermelon fruit enlargement, the gene can provide gene resources for creation of new germplasms of different fruit types and breeding of special new varieties, meanwhile, the market demand for watermelon fruit type diversification is met, and the gene has very important scientific and production application significance.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and more particularly to application of a watermelon ClWRKY61 gene in influencing fruit size development. Background Art

[0002] The WRKY transcription factor (TF) family is one of the largest families in higher plants and plays a key regulatory role in plant adaptation to abiotic stress. The family is characterized by a highly conserved WRKYGQK motif and a C2H2 or C2HC zinc finger structure. This conserved structure enables it to bind to the W-box, the sequence of which is (C / T)TGAC(T / C). According to the number of WRKY domains and zinc finger structures, WRKY transcription factors are divided into subfamilies I, II, and III, and subfamily II is further divided into IIa, IIb, IIc, IId, and IIe. Many members of the WRKY family, such as AhWRKY75 in peanut, GhWRKY17 in cotton, TaWRKY75-A in wheat, and SlWRKY8 in tomato, were found to be induced by salt stress. This suggests that WRKY transcription factors may play an important role in plant resistance to salt stress.

[0003] Watermelon (Citrullus lanatus) is an annual vine herb belonging to the genus Citrullus of the Cucurbitaceae family. It is an important horticultural crop and is widely cultivated around the world. Its fruit is mainly used as fresh food, and secondly can be used as wine, feed, etc. In 2022, the national watermelon planting area in my country was about 22.2723 million mu, accounting for 7% of the global vegetable production area, and the output was about 63.0231 million tons. Fruit size is an extremely important agronomic trait of watermelon. Especially with the improvement of living standards, consumers in different regions have shown uneven preferences for watermelons of different fruit sizes. However, little is known about the genetic basis and regulatory gene functions of watermelon fruit size variation, which limits the directional improvement of watermelon fruit size at the molecular level. Therefore, exploring the regulatory genes of watermelon fruit size can not only provide theoretical references for the directional improvement of excellent germplasm, but also lay a technical support for the selection and breeding of characteristic new varieties.

[0004] Therefore, providing an application of the watermelon ClWRKY61 gene in influencing fruit size development is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides an application of the watermelon ClWRKY61 gene in influencing the development of fruit size.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] Application of watermelon ClWRKY61 gene in influencing fruit size development, the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1.

[0008] Furthermore, the watermelon ClWRKY61 gene is used in positively regulating the development of fruit size, and the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1.

[0009] Further, the use of biological materials overexpressing the watermelon ClWRKY61 gene in increasing the size of watermelon fruit, wherein the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1;

[0010] The biological material is any one of the following:

[0011] A: expression cassette capable of overexpressing the ClWRKY61 gene;

[0012] B: a recombinant vector containing the expression cassette described in A;

[0013] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0014] Further, the use of biological materials overexpressing the watermelon ClWRKY61 gene in increasing the longitudinal diameter of watermelon, wherein the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1;

[0015] The biological material is any one of the following:

[0016] A: expression cassette capable of overexpressing the ClWRKY61 gene;

[0017] B: a recombinant vector containing the expression cassette described in A;

[0018] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0019] Furthermore, the use of biological materials with the watermelon ClWRKY61 gene knocked out in reducing the size of watermelon fruit is characterized in that the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1;

[0020] The biological material is any one of the following:

[0021] A: expression cassette capable of silencing the ClWRKY61 gene;

[0022] B: a recombinant vector containing the expression cassette described in A;

[0023] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0024] Furthermore, the use of biological materials with the ClWRKY61 gene knocked out in watermelon to reduce the longitudinal diameter of watermelon is characterized in that the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1;

[0025] The biological material is any one of the following:

[0026] A: expression cassette capable of silencing the ClWRKY61 gene;

[0027] B: a recombinant vector containing the expression cassette described in A;

[0028] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0029] Furthermore, the watermelon ClWRKY61 gene is used in watermelon fruit size breeding, and the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1.

[0030] Through the above technical scheme, it can be known that compared with the prior art, the present invention discloses the application of the watermelon ClWRKY61 gene in affecting the development of fruit size. The present invention discovers a watermelon WRKY transcription factor ClWRKY61; at the same time, it is found that compared with the wild type (WT), the fruits of the ClWRKY61 knockout line plants are significantly smaller, while the fruits of the ClWRKY61 overexpression line are significantly larger. This shows that the ClWRKY61 transcription factor is a positive regulatory factor for the enlargement of watermelon fruits. The gene can provide gene resources for the creation of new germplasms with different fruit shapes and the breeding of new special varieties, while meeting the market demand for diversified watermelon fruit shapes, and has very important scientific and production application significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0032] Figure 1 The accompanying drawings are schematic diagrams of the ClWRKY61 gene structure, target structure and edited strain sequence information of the present invention;

[0033] Figure 2 The accompanying figure shows the expression level of the gene ClWRKY61 in the overexpression strain OEWRKY61 of the present invention;

[0034] Figure 3The accompanying drawings show the fruit size phenotypes of the knockout and overexpression strains of ClWRKY61 of the present invention;

[0035] Among them, A: WT; B: CR-WRKY61; C: OEWRKY61;

[0036] Figure 4 The accompanying figure shows the longitudinal diameter analysis of fruits of the ClWRKY61 knockout and overexpression strains of the present invention. DETAILED DESCRIPTION

[0037] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] CDS sequence of ClWRKY61:

[0039] ATGGATTGTTCCTGGCCTGACACCACGCCCTCCGATCGAAGAAAAGCAGCCGACGAACTGCTTCGTGGCCGTGAACTTGCACAACAACTACGAGCCTATCTACA GAGAACTTCCAATTCCGGT GGGACGGCTCCCAAGATCTGCTCTCCAGAATCCTAACCTCTTTCTCAAAACACTTTCCATCTTGAATCGCTGCGACTCCGATGACATAAATGGCTCTATTGTGGATTCACCCGAGGATCG TGCTAGTAGAAAATCCCAGGAATCTGGGGACAGTTGCAAGAGCTCCGATCGCAGGGGTTGCTATAAGAGAAGAAAGAGTTGCCAGAGTTGGGCGAGAGAGCTGCAGCCTGGTGGACGATGG GCAC GCGTGGAGGAAGTACGGGCAGAAGACCATTCTAAATGCGAAATACCCAAGAAACTATTACAGATGCACCCACAAATTCGACCAGGCCTGCCAAGCCACAAAGCAAGTCCAGCGACTGCAAGACCATCCCAAAATTCCGTACTACTTATTATGGCCATCACACCTGCTCCAATTTCCTCAAAGCTTCCGACATCGTGCTCGGCTCCTCCAATTTCGACGATTCCTGCGGAGTGCTCCT CAGTTTTGACACCCCCGCCGCACCCAACTTTTTACTCCAACAGGATGCTATGTTGGTCAAGAAGGAAGTTGCAATCGCCGAAAGCAGGGATGATGAGGCCGTATGTTCCCCCTCCGACTACATTAGTACGGCCGAGCCCTCGCCCGACGACCATCTCTCCGAGGTTTTCATGGGTTCCGTCGTCGACTTTGAGGATGATGTTTTACAATTCCAGTTTTGA; SEQ. ID NO.1.

[0040] Example 1 Construction of CRISPR / Cas9 editing vector PBSE402-ClWRKY61

[0041] 1) Editing site selection of gene ClWRKY61

[0042] According to the CDS sequence of ClWRKY61 (as shown in SEQ ID NO.1) and the target site online design website CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2), the target site for gene editing was designed, and two editing sites (Target1 and Target2) were designed. Among them, the targets Target1 and Target2 are located on the first and second exons of the gene ClWRKY61, respectively.

[0043] Target1 sequence: GAGAACTTCCAATTCCGGT; SEQ ID NO.2;

[0044] Target2 sequence: GTACTTCCTCCACGCGTGC; SEQ ID NO.3.

[0045] 2) Construction of CRISPR / Cas9 editing vector

[0046] (1) PCR amplification:

[0047] According to the above two sets of target sequences, the adapter primers Target1F / Target2R were synthesized, and the intermediate vector pCBC-DT1T2 diluted 100 times was used as a template. The high-fidelity enzyme PrimeStarMax Premix (TaKaRa) was used for PCR amplification. The amplification system was: PrimeStarMax Premix (2×) 25μL, template 2.5μL, upstream and downstream primers 2.5μL each, ddH2O 17.5μL. The PCR reaction program was: 98℃10s, 58℃5s, 72℃15s, 38 cycles; 72℃5min.

[0048] The target sequence adapter primer (underlined is the target sequence) is as follows:

[0049] Target1 sequence primer: Target1F

[0050] ATATATGGTCTCGATTG GAGAACTTCCAATTCCGGT GTTTTAGAGC TAGAAATAGC;SEQ IDNO.4;

[0051] Target2 sequence primer: Target2R

[0052] ATTATTGGTCTCGAAAC GTACTTCCTCCACGCGTGC CAATCTCTTA GTCGACTCTAC; SEQ ID NO.5.

[0053] (2) Vector digestion:

[0054] The CRISPR / Cas9 vector PBSE402 was digested with restriction endonuclease BsaI (NEWENGLAND BioLabs). The digestion system was: PBSE402 2 μg, CutSmart buffer 5 μL, BsaI 1 μL, ddH2O to 50 μL. Digestion was performed at 37°C for 2 h, and gel recovery was performed after electrophoresis detection.

[0055] PCR product and vector connection: The PCR amplified product was connected to the vector PBSE402 after restriction digestion by homologous recombination. The connection system is: the molar ratio of vector to insert fragment is about 1:2; 5× reaction buffer 4μL; NovoRec Plus recombinase 1μL; ddH2O is made up to 20μL. 50℃, connection for 10min.

[0056] (3) Recombinant plasmid transformation:

[0057] Take 5 μl of the ligation product and heat-shock transform it into E. coli competent DH5a, apply it to LB solid culture plate containing 50 mg / L kanamycin, and culture it overnight at 37° C. Use primers U626-IDF / U629-IDR to detect the positive colony.

[0058] The specific primer sequences are as follows:

[0059] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; SEQ ID NO.6;

[0060] U629-IDR: AGCCCTCTTTCTTTCGATCCATCAAC; SEQ ID NO.7.

[0061] After sequencing was correct, the recombinant plasmid was extracted and transformed into Agrobacterium competent cells EHA105. After PCR verification, it was used for watermelon genetic transformation. The steps of Agrobacterium transformation are as follows:

[0062] Take 1 μl of recombinant plasmid and add it to Agrobacterium EHA105 competent cells, insert it into an ice box for 5 minutes, then put it into liquid nitrogen for quick freezing for 5 minutes, put it into a 37℃ water bath for 5 minutes, add 400 μl of antibiotic-free medium to each tube for recovery, and transfer it to a shaker at 200 rpm and 28℃ for shaking. Take 100 μl of the recovered bacterial solution and spread it on LB solid medium containing antibiotics, dry it at room temperature, and after the bacterial solution is fully absorbed, turn the culture dish upside down and culture it in a 28℃ incubator for 2-3 days.

[0063] Example 2 Construction of overexpression vector pCAMBIA1305-ClWRKY61

[0064] (1) PCR amplification:

[0065] Specific primers OE-ClWRKY61-F / R were designed according to the reference sequence of ClWRKY61, and PCR amplification was performed using the cDNA of watermelon germplasm 'YL' as a template and the high-fidelity enzyme PrimeStarMax Premix (TaKaRa).

[0066] The specific primer sequences are as follows:

[0067] OE-ClWRKY61-F:

[0068] ACGGGGGACTCTAGAGGATCC ATGGATTGTTCCTGGCCT ; SEQ ID NO.8;

[0069] OE-ClWRKY61-R:

[0070] CACCAATTCACACGTGTTAGTGGTGGTGGTGGTGGTG AAACTGGA ATTGTAAAACATCA ; SEQ ID NO.9.

[0071] The amplification system was: PrimeStarMax Premix (2×) 25μL, template 2.5μL, upstream and downstream primers 2.5μL each, ddH2O 17.5μL. The PCR reaction program was: 98℃10s, 58℃5s, 72℃15s, 38 cycles; 72℃5min. After the PCR was completed, 5μL 10× loading buffer was added to the reaction mixture, and then agarose gel was prepared and electrophoresis was performed. The correct band was then detected and the PCR product was recovered using a DNA purification recovery kit (Tiangen).

[0072] (2) Vector digestion:

[0073] The overexpression vector pCAMBIA1305 was digested with restriction endonucleases BamHI and PmlI (NEWENGLAND BioLabs). The digestion system was: pCAMBIA1305 4 μg, CutSmart buffer 5 μL, BamHI 1 μL, PmlI 1 μL, ddH2O to 50 μL. Digestion was performed at 37°C for 2 h, and gel recovery was performed after electrophoresis detection.

[0074] PCR product and vector connection: The PCR amplified product was connected to the vector pCAMBIA1305 after restriction digestion by homologous recombination. The connection system is: the molar ratio of vector to insert fragment is about 1:2; 4μL of 5× reaction buffer; 1μL of NovoRec Plus recombinase; ddH2O is added to 20μL. 50℃, connection for 10min.

[0075] (3) Recombinant plasmid transformation:

[0076] Take 5 μl of the ligation product and heat-shock transform it into Escherichia coli competent DH5a, apply it to LB solid culture plates containing 50 mg / L kanamycin, and culture it at 37°C overnight. Use gene-specific primers OE-ClWRKY61-F / R to detect the colony positively. After sequencing is correct, extract the recombinant plasmid and transform it into Agrobacterium competent cells EHA105. After PCR verification, it is used for watermelon genetic transformation. The steps of Agrobacterium transformation are as follows:

[0077] Take 1 μl of recombinant plasmid and add it to Agrobacterium EHA105 competent cells, insert it into an ice box for 5 minutes, then put it into liquid nitrogen for quick freezing for 5 minutes, put it into a 37℃ water bath for 5 minutes, add 400 μl of antibiotic-free medium to each tube for recovery, and transfer it to a shaker at 200 rpm and 28℃ for shaking. Take 100 μl of the recovered bacterial solution and spread it on LB solid medium containing antibiotics, dry it at room temperature, and after the bacterial solution is fully absorbed, turn the culture dish upside down and culture it in a 28℃ incubator for 2-3 days.

[0078] Example 3

[0079] 1) Genetic transformation of watermelon:

[0080] Take the plump seeds of watermelon germplasm 'YL', soak them in 50-55℃ distilled water for about 30 minutes, peel off the seed shell, wash the peeled kernels with 75% alcohol for about 30 seconds in a clean bench, wash them twice with sterile water, and then soak them in 3% sodium hypochlorite for 15 minutes, wash them with sterile water 5-7 times, dry them, sow them in MS solid culture medium, and culture them in the dark at 25℃ for 3 days.

[0081] After the seeds germinate, they are taken out, the two ends of the cotyledons are cut off, and the remaining cotyledons are divided into 8 pieces for easy infection. During this period, the single colony of EHA105 containing the CRISPR / Cas9 vector PBSE402-ClWRKY61 and the overexpression vector pCAMBIA1305-ClWRKY61 are picked into LB liquid medium containing 50 mg / L kanamycin and 20 mg / L rifampicin, and the bacterial solution is shaken to an OD of 600 =0.8, resuspend the bacterial solution in MS culture medium (MS5194.43g / L, sucrose 30g / L, 6-BA 1.5mg / L) to a final concentration of OD 600 = 0.2 to obtain a bacterial suspension. The cut cotyledons were soaked in the bacterial suspension for 15 min, taken out and dried, and then co-cultured in a co-culture medium (CM: MS519 4.43 g / L, sucrose 30 g / L, G3251 (PhytoTech Labs) 3 g / L, 6-BA 1.5 mg / L) padded with filter paper and cultured at 25°C in the dark for 3 days.

[0082] After 3 days of co-cultivation, the cotyledon blocks were removed and washed with sterile water to remove excess Agrobacterium liquid on the surface (washed about 5-7 times) until the sterile water was clear. After being taken out and dried, they were placed on recovery medium (RM: MS5194.43g / L, sucrose 30g / L, G32513g / L, 6-BA 1.5mg / L, Timentin 200mg / L) for recovery culture at 28°C for 7 days.

[0083] After 7 days, the cotyledons of the recovery culture were transferred to MS medium (selective medium SM) containing 1.5 mg / L 6-BA, 200 mg / L Timentin and 1.4 mg / L Basta for selection culture, and subcultured at 28°C for 3-4 weeks, with subculture every 7 days. After that, the explants with obvious buds were transferred to bud elongation medium (containing 4.43 g / L MS524, 30 g / L sucrose, 3 g / LG3251, 1 g / L inositol, 500 μL / L SH organic solution, 0.01 mg / L NAA, 0.1 mg / L 6-BA, 200 mg / L Timentin and 1.4 mg / L Basta), and the culture conditions were 28°C, 8 h / d in the dark, 16 h / d in the light, and the light intensity was 8000 Lx. The selected buds were cut off (note that the incision should not contain callus), and transferred to MS medium containing 0.5 mg / L IBA and 200 mg / L Timentin for rooting culture at 28°C until rooting.

[0084] SH organic solution contains 10g / L nicotinic acid, 10g / L VB1, and 1g / L VB6.

[0085] When the regenerated seedlings have roots and grow to 4-5 true leaves, take them out of the culture bottle, slowly rinse off the culture medium at the roots with clean water, transplant them to the substrate that has been sterilized at high temperature and high pressure in advance, water them thoroughly and keep them warm and moist. After 3-4 days, you will see water droplets on the cover of the hole tray, and gradually open the cover to harden the seedlings.

[0086] 2) Detection of gene-edited plants:

[0087] The PBSE402 vector carries a GFP fluorescent tag, and the CTAB method is used to extract the DNA of the watermelon regenerated seedlings with GFP fluorescence. The steps are as follows: take a small part of the young leaves, quickly grind them into powder in liquid nitrogen, and put them in a 1.5 ml centrifuge tube; add preheated 800 μl CTAB extraction buffer, and water bath at 65°C for 30 minutes; add an equal volume of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, and centrifuge at 8000r / min for 10 minutes after mixing; transfer the supernatant to a new centrifuge tube, add 2 / 3 volume of isopropanol, and gently mix by turning upside down; centrifuge at 10000r / min for 10 minutes; pour out the supernatant, rinse the precipitate twice with 75% volume ethanol, and then drain the remaining liquid after pouring it out. After drying for 3 minutes, dissolve it with 100μl ddH2O (containing 0.1% RNase), and store it at 4°C for later use.

[0088] Using the extracted DNA as template, the edited lines used target 1 primer CRJC-W61F / R to perform PCR amplification on the sequences of the two target sites, respectively. The positive control was the recombinant plasmid, and the negative control was the non-transgenic plant DNA.

[0089] The specific primer sequences are as follows:

[0090] CRJC-W61F: ATGGATTGTTCCTGGCCTGA; SEQ ID NO.10;

[0091] CRJC-W61R: TCAAAACTGGAATTGTAAAACATCA; SEQ ID NO.11.

[0092] The amplification system was: 2×Taq PCR StarMix with loading Dye 10μL, template 1μL, upstream and downstream primers 1μL each, ddH2O 7μL. The PCR reaction program was: 94℃3min; 94℃30s, 58℃30s, 72℃1min, 30 cycles; 72℃5min. The PCR products were recovered according to the band size and TA cloned. After the bacterial solution PCR was positive, the clones were selected for testing to confirm the editing event. The results are shown in Figure 1 A total of two gene-edited plants, crwrky61-1 and crwrky61-2, were obtained, with 264bp and 265bp missing between Target1 and Target2, respectively.

[0093] 3) Detection of overexpression plants:

[0094] Using the cDNA reverse transcribed from the extracted RNA as a template, the overexpression strain was tested for expression using primers qRTPCR-ClWRKY61-F / R.

[0095] The specific primer sequences are as follows:

[0096] qRTPCR-ClWRKY61-F:TCGTGCTCGGCTCCTCCAAT; SEQ ID NO.12;

[0097] qRTPCR-ClWRKY61-R: TCATCCCTGCTTCGGCGATTG; SEQ ID NO. 13.

[0098] Results Figure 2 , a total of one overexpression strain OEWRKY61 was obtained. qRT-PCR analysis showed that the expression level of gene ClWRKY61 in the overexpression strain OEWRKY61 was significantly higher than that in the wild-type plant (about 27 times).

[0099] The expression levels of ClWRKY61 gene in overexpression and wild-type strains were analyzed statistically using Student's t test (**, P < 0.01).

[0100] 4) Phenotypic observation of transgenic watermelon plants:

[0101] The seeds of wild type (WT), overexpression strain OEWRKY61, and edited plant crwrky61-1 were soaked for 6 hours and then germinated in a dark environment at 28℃ for about 30 hours. After the seeds turned white, they were sown in nutrient pots (8×7×7cm) individually. The seedlings grew at 28℃ / 18℃ (day / night) and 18h / 6h (light / darkness), and watered regularly and quantitatively every day. When the seedlings grew to three leaves and one heart, they were transplanted to the field and managed normally. After flowering, they were strictly self-pollinated and the pollination time was recorded. After the fruits matured (35-40 days of growth), the fruits of each strain were taken for phenotypic observation and photography, and the longitudinal diameter was measured with a ruler. After measuring at least three fruits for each strain, data analysis was performed using SPSS software.

[0102] The results show that ( Figure 3 ), under normal growth conditions, the fruit of the knockout strain was significantly smaller than that of the wild type (WT), while that of the overexpression strain was larger than that of the wild type (WT); at the same time, the longitudinal diameter data showed that ( Figure 4 ), the longitudinal diameter of the fruit of the knockout strain was reduced by about 33.33% compared with the wild type, while the longitudinal diameter of the overexpression strain was increased by 36.67%. The longitudinal diameters of WT, OEWRKY61, and crwrky61-1 (CR-WRKY61) were 37.50±3.04cm, 51.25±3.03cm, and 25.10±0.71cm, respectively.

[0103] The significance was analyzed by one-way ANOVA method and Duncan test (P<0.05).

[0104] In summary, the present invention provides the watermelon WRKY transcription factor ClWRKY61 and clarifies its biological function in the development of watermelon fruit size, providing genetic resources for the improvement of fruit size traits of excellent watermelon germplasm, and laying a foundation for the breeding of new varieties with different fruit sizes for different market demands.

[0105] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of watermelon ClWRKY61 gene in influencing fruit size development, characterized in that: The nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.

1.

2. Application of watermelon ClWRKY61 gene in positively regulating fruit size development, characterized in that: The nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.

1.

3. Application of biological materials overexpressing watermelon ClWRKY61 gene in increasing watermelon fruit size, characterized in that: The nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1; The biological material is any one of the following: A: expression cassette capable of overexpressing the ClWRKY61 gene; B: a recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

4. Application of biological materials overexpressing the ClWRKY61 gene of watermelon in increasing the longitudinal diameter of watermelon, characterized in that: The nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1; The biological material is any one of the following: A: expression cassette capable of overexpressing the ClWRKY61 gene; B: a recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

5. Application of biological materials with knockout watermelon ClWRKY61 gene in reducing watermelon fruit size, characterized in that: The nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1; The biological material is any one of the following: A: expression cassette capable of silencing the ClWRKY61 gene; B: a recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

6. Application of biological materials with knockout watermelon ClWRKY61 gene in reducing the longitudinal diameter of watermelon, characterized in that: The nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1; The biological material is any one of the following: A: expression cassette capable of silencing the ClWRKY61 gene; B: a recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

7. Application of watermelon ClWRKY61 gene in watermelon fruit size breeding, characterized in that: The nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1.

Images