Primer-probe group for detecting deafness gene and application of primer-probe group

Abstract

The invention belongs to the field of biomedicine, and relates to a primer-probe group for detecting deafness genes and application of the primer-probe group. The primer-probe group for detecting the deafness gene comprises the following steps: detecting IVS7-2At of an SLC26A4 gene; the method comprises the following steps: detecting 2168Agt of an SLC26A4 gene by using a primer-probe combination A for mutation of SLC26A4 gene A primer-probe combination B for detecting SLC26A4 gene 1229Cgt is used for detecting SLC26A4 gene 1229Cgt; the primer-probe combination C is used for detecting 1226Ggt of the SLC26A4 gene; a primer-probe combination D of A mutation is used for detecting 12s rRNA 1555 Agt; the primer-probe combination E is used for detecting 12s rRNA 1494 Cgt mutations and detecting 12s rRNA 1494 Cgt mutations; the invention relates to a primer-probe combination F for detecting T mutation. The kit provided by the invention only needs to carry out once PCR reaction, and has the advantages of high specificity, low cost and intuitive and easily interpreted result.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to a primer-probe set for detecting a deafness gene and an application thereof. Background Art

[0002] Deafness is the most common communication disorder, which has a significant impact on personal life and social development. About 60% of deafness is caused by genetic factors, and the rest is caused by environmental factors or the combined effects of environmental and genetic factors. Deafness is divided into congenital deafness, delayed deafness and drug-induced deafness according to the time and mechanism of disease occurrence; the two mutation sites of mitochondrial DNA 12sRNA 1555A>G and 1494C>T are closely related to drug-induced deafness. The SLC26A4 gene (also known as the PDS gene) is located on chromosome 7q31, has 21 exons, and encodes a multi-transmembrane protein Pendrin containing 780 amino acids. Pendrin is expressed in the inner ear, thyroid gland and kidney, and can mediate the transport of anions such as Cl-, I-, OH-, and HCO3-. Mutations in the SLC26A4 gene can cause recessive non-syndromic deafness (DFNB4, OMIM#600791), and in a small number of cases, they are accompanied by thyroid enlargement, which is called Pendred syndrome (PDS, OMIM274600).

[0003] The 1555A>G and 1494C>T mutation sites are located in the 12s rRNA gene, and the IVS7-2 A>G, 2168A>G, 1229C>T, and 1174A>T mutation sites are located in the SLC26A4 gene. The conventional fluorescent PCR method was used to detect these mutation sites, but the amplification specificity was poor.

[0004] Single nucleotide polymorphism (SNP) is widely distributed in the whole genome, with high density, genetic stability, and can be detected automatically. Therefore, SNP markers are currently studied more and have broad prospects. They are of great significance in genetic map construction, association analysis, molecular marker-assisted selection breeding, and planting resource screening. There are many detection methods for a large number of SNP sites, including gene chip technology, fluorescence energy transfer method, TaqMan probe technology, and pyrophosphate sequencing technology. Although these methods can type SNPs with high throughput, they all require special detection equipment or complex technology and are expensive. Allele-specific PCR (AS-PCR) makes up for the above defects. It only requires an electrophoresis experiment in a simple molecular laboratory. It is convenient and has a wider range of applicability. In theory, the base at the 3' end of the primer is particularly important for the extension of PCR. If the 3' end nucleotide of the primer is consistent with the SNP site, the DNA polymerase can amplify and obtain a specific PGR product. If it is inconsistent, there is no amplification product. In this way, SNP can be detected by the presence or absence of PCR products. However, this method is not widely used because the 3' end mismatch of the non-specific allele site cannot effectively and reliably distinguish the two alleles, but only reduces the extension efficiency. Summary of the invention

[0005] The present invention aims to provide a deafness gene detection kit with a simple method, high efficiency and good detection effect and its application. The kit can effectively reduce the amplification of wild-type templates and improve the detection ability of mutant DNA templates in wild-type background.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] A primer-probe set for detecting a deafness gene comprises: a primer-probe combination A for detecting an IVS7-2 A>G mutation in an SLC26A4 gene, a primer-probe combination B for detecting an 2168A>G mutation in an SLC26A4 gene, a primer-probe combination C for detecting an 1229C>T mutation in an SLC26A4 gene, a primer-probe combination D for detecting an 1226G>A mutation in an SLC26A4 gene, a primer-probe combination E for detecting a 12s rRNA 1555A>G mutation, and a primer-probe combination F for detecting a 12s rRNA 1494C>T mutation.

[0008] In one preferred embodiment, the primer-probe combination A for detecting the IVS7-2 A>G mutation of the SLC26A4 gene includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO: 1, the sequence of the wild blocking primer is shown in SEQ ID NO: 2, the sequence of the mutant upstream primer is shown in SEQ ID NO: 3, the sequence of the downstream primer is shown in SEQ ID NO: 4, and the sequence of the probe is shown in SEQ ID NO: 5.

[0009] In one preferred embodiment, the primer-probe combination C for detecting 1229C>T of the SLC26A4 gene includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO:6, the sequence of the wild blocking primer is shown in SEQ ID NO:7, the sequence of the mutant upstream primer is shown in SEQ ID NO:8, the sequence of the downstream primer is shown in SEQ ID NO:9, and the sequence of the probe is shown in SEQ ID NO:10.

[0010] In one preferred embodiment, the primer-probe combination B for detecting the 2168A>G mutation of the SLC26A4 gene includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO: 11, the sequence of the wild blocking primer is shown in SEQ ID NO: 12, the sequence of the mutant upstream primer is shown in SEQ ID NO: 13, the sequence of the downstream primer is shown in SEQ ID NO: 14, and the sequence of the probe is shown in SEQ ID NO: 15.

[0011] In one preferred embodiment, the primer-probe combination D for detecting 1226G>A of the SLC26A4 gene includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO: 16, the sequence of the wild blocking primer is shown in SEQ ID NO: 17, the sequence of the mutant upstream primer is shown in SEQ ID NO: 18, the sequence of the downstream primer is shown in SEQ ID NO: 19, and the sequence of the probe is shown in SEQ ID NO: 20.

[0012] In one preferred embodiment, the primer-probe combination E for detecting 12s rRNA 1555A>G includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO:24, the sequence of the wild blocking primer is shown in SEQ ID NO:25, the sequence of the mutant upstream primer is shown in SEQ ID NO:26, the sequence of the downstream primer is shown in SEQ ID NO:27, and the sequence of the probe is shown in SEQ ID NO:28.

[0013] In one preferred embodiment, the primer-probe combination F for detecting 12s rRNA 1494C>T includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO:29, the sequence of the wild blocking primer is shown in SEQ ID NO:30, the sequence of the mutant upstream primer is shown in SEQ ID NO:31, the sequence of the downstream primer is shown in SEQ ID NO:32, and the sequence of the probe is shown in SEQ ID NO:33.

[0014] In one preferred embodiment, the primer-probe set for detecting the deafness gene also includes an internal reference primer-probe set.

[0015] In one preferred embodiment, the sequence of the internal reference primer-probe set includes: an internal reference upstream primer, an internal reference downstream primer and an internal reference probe, the sequence of the internal reference upstream primer is shown in SEQ ID NO:21, the sequence of the internal reference downstream primer is shown in SEQ ID NO:22, and the sequence of the internal reference probe is shown in SEQ ID NO:23.

[0016] The present invention also claims to protect the use of the primer-probe set for detecting the deafness gene in preparing a reagent for detecting the deafness gene.

[0017] A deafness gene detection kit comprises any one or more of primer-probe sets AF.

[0018] In one preferred embodiment, the kit further includes: a positive quality control and a negative quality control.

[0019] In a preferred embodiment, the negative control is a wild-type plasmid as shown in SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, and SEQ ID NO:50.

[0020] In a preferred embodiment, the positive quality control is a mutant plasmid as shown in SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, and SEQ ID NO:51.

[0021] In one preferred embodiment, in the kit, primer-probe sets AF are pre-mixed in a PCR reaction tube.

[0022] In one preferred embodiment, the kit includes: 0.08 μl of the optimal primer corresponding to the mutation site, 0.1 μl of the optimal probe corresponding to the mutation site, 0.2 μl of dNTPs, 6 μl of buffer (Tris-HCl, pH 8.3), 3 mM MgCl2, 0.4 μl of Taq DNA polymerase, and the remainder is nuclease-free water.

[0023] A method for identifying a deafness gene mutation, characterized in that it comprises the following steps: using a sample DNA to be tested as a template, performing PCR with the primer-probe set for detecting the deafness gene, obtaining a FAM channel detection value and a HEX / VIC channel detection value, the amplification curve is an "S" type, and a Ct value <35 indicates that the detection result is positive; when the HEX / VIC channel detection value is positive and the FAM channel detection value is positive, it indicates that the detected sample is a mutant sample; when the FAM channel detection value and the HEX / VIC channel detection value are both negative, it indicates that it is an invalid sample; when the FAM channel detection value is negative and the HEX / VIC channel detection value is positive, it indicates that it is a wild-type sample.

[0024] In one preferred embodiment, the amplification curve is not "S" shaped, or the Ct value > 37 indicates that the test result is negative.

[0025] AS-PCR is the main technical means for mutation detection. By designing three primers, two of which differ only in the 3' terminal base (complementary to the corresponding polymorphic sites), and sharing a common allele reverse primer (LocusSpecific Primer, LSP), PCR reaction is carried out in the same reaction system to produce two products with differences in the mutation site. The presence of these two products is identified to complete the sample typing. Using AS-PCR based on fluorescence signals for typing detection has the advantages of accuracy, rapidity, high throughput, low cost, no pollution, low equipment requirements and easy operation.

[0026] The AS-PCR method adopted in the present invention does not require expensive detection instruments or complicated experimental procedures. It only requires the design of specific primers and combines them with QPCR technology to achieve high-throughput sequencing of the SNP sites of the gene to be tested.

[0027] The detection results of the method of the present invention were compared with the results of the direct sequencing method, and the results showed that the two were completely consistent, which shows that the detection sensitivity of the method for the SNP site genotype is the same as the gold standard. Because it does not require expensive detection instruments, it can be carried out in small laboratories and hospital laboratories, which meets the requirements of high sensitivity, convenience and speed in clinical testing. Therefore, this method can be used in clinical hospital laboratories to detect the genotype of the deafness 12srRNA gene and the mutation site, and the genotype of the deafness SLC26A4 gene and the mutation site, providing a simple and convenient detection method for clinical exploration of deafness genes.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] 1. High specificity

[0030] Since the primers used in AS-PCR are from a set of primer combinations with artificially added mismatch mutation sites at the 3' end and its vicinity, the primers that are screened out to distinguish the alleles at a single site ensure its high specificity.

[0031] 2. Short detection time, low cost, intuitive and easy to interpret results

[0032] AS-PCR combined with QPCR only requires one PCR reaction, which is time-saving. AS-PCR technology only requires optimization of the upstream primers, which is low-cost and has intuitive and easy-to-read results compared to the fluorescent quantitative PCR technology using MGB probes. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the amplification result obtained from the 12s rRNA-1555A>G wild-type sample;

[0034] Figure 2 This is the amplification result obtained from the 12s rRNA-1555A>G mutant sample.

[0035] Figure 3 This is the result of detecting the 1229 mutant type;

[0036] Figure 4 This is the result of detecting the wild type 1229. DETAILED DESCRIPTION

[0037] The present invention will be described in detail below with reference to the accompanying drawings and in combination with embodiments. It should be noted that the embodiments and features in the embodiments of the present invention can be combined with each other without conflict.

[0038] Example 1

[0039] Mutant plasmids and wild-type plasmids were designed based on the complete sequences and mutation positions of the SLC26 A4 human gene and 12s rRNA human gene. The specific sequence information is as follows:

[0040] The specific sequence information of the human SLC26 A4 gene can be found in NCBI Reference Sequence:AY402534.1;NG_008489.1, and the mutation location information is as follows:

[0041] 1141-1200gggaaccagg aattcattgc ctttgggatc agcaacatct tctcaggattcttctcttgt (1174 position) (SEQ ID NO: 34);

[0042] 1201-1260tttgtggcca ccactgctct ttcccgcacg gccgtccagg agagcactggaggaaagaca (position 1229) (SEQ ID NO: 35);

[0043] 2161-2220acggtccatg atgctatact ctatctacag aaccaagtga aatctcaagagggtcaaggt (2168 position) (SEQ ID NO: 36);

[0044] 27781-27840aaaaccaatg gagtttttaa catcttttgttttatttcag acgataattgctactgccat(IVS7-2) (SEQ ID NO: 37).

[0045] For the specific sequence information of the 12s rRNA human gene, see NCBI Reference Sequence: NC_012920.1. The mutation location information is as follows:

[0046] 1.1 Mutation location information

[0047] 1441agtagagtgc ttagttgaac agggccctga agcgcgtaca caccgcccgt caccctcctc (1494 site) (SEQ ID NO: 38)

[0048] 1501aagtatactt caaaggacat ttaactaaaa cccctacgca tttatataga ggagacaagt (1555 position) (SEQ ID NO: 39).

[0049] Based on the above-mentioned SLC26 A4 human gene, 12s rRNA human gene full sequence and mutation position, the designed mutant plasmid and wild-type plasmid are as follows:

[0050] SLC26A4-IVS7-2A>G:

[0051] wild type:

[0052] tgatcggtttagacacaaaatcccagtccctattcctatagaagtaattgtggtaagtagaatatgtagttagaaagttcagcattatttggttgacaaacaagg aattattaaaaccaatggagtttttaacatcttttgttttatttcagacgataattgctactgccatttcatatggagccaacctggaaaaaaattacaatgctggcattgttaaatccatcccaagggggtgagtgtggtgttcctcttagtactaatacattaagtcagtaagtcagtcttttttatttaaat(SEQ ID NO:40)

[0053] Mutation type:

[0054] Tgatcggtttagacacaaaatcccagtccctattcctatagaagtaattgtggtaagtagaatatgtagttagaaagttcagcattatttggttgacaaacaag gaattattaaaaccaatggagtttttaacatcttttgttttatttcGgacgataattgctactgccatttcatatggagccaacctggaaaaaaattacaatgctggcattg ttaaatccatcccaagggggtgagtgtggtgttcctcttagtactaatacattaagtcagtaagtcagtcttttttatttaaat(SEQ ID NO:41)

[0055] SLC26A4-1229C>T:

[0056] Wild type:

[0057] cctgtgagcttgttctcggagatgctggctgcatcattttccatcgctgtggtggcttatgctattgcagtgtcagtaggaaaagtatatgccaccaagtatgattacaccatcgatgggaaccaggaattcattgcctttgggatcagcaacatcttctcaggattcttctcttgttttgtggccaccactgctctttcccgcacggccgtccaggagagcactggaggaaagacacaggttgctggcatcatctctgctgcgattgtgatgatcgccattcttgccctggggaagcttctggaacccttgcagaagtcggtcttggcagctgttgtaattgccaacctgaaagg(SEQ ID NO:42)

[0058] Mutant type:

[0059] cttatgctattgcagtgtcagtaggaaaagtatatgccaccaagtatgattacaccatcgatgggaaccaggaattcattgcctttgggatcagcaacatctt ctcaggattcttctcttgttttgtggccaccactgctctttcccgcaTggccgtccaggagagcactggaggaaagacacaggttgctggcatcatctctgctgcg attgtgatgatcgccattcttgccctggggaagcttctggaacccttgcagaagtcggtcttggcagctgttgtaattgccaacctgaaag(SEQ ID NO:43)

[0060] SLC26A4 - 2168A>G:

[0061] Wild type:

[0062] tgagatcactgcgggtgattgtcaaagaattccaaagaattgatgtgaatgtgtattttgcatcacttcaagattatgtgatagaaaagctggagcaatgcgg gttctttgacgacaacattagaaaggacacattctttttgacggtccatgatgctatactctatctacagaaccaagtgaaatctcaagagggtcaaggttccattttag aaacgatcactctcattcaggattgtaaagatacccttgaattaatagaaacagagctgacggaagaagaacttgatgtccaggatg(SEQ ID NO:44)

[0063] Mutant type:

[0064] tgagatcactgcgggtgattgtcaaagaattccaaagaattgatgtgaatgtgtattttgcatcacttcaagattatgtgatagaaaagctggagcaatgcgg gttctttgacgacaacattagaaaggacacattctttttgacggtccGtgatgctatactctatctacagaaccaagtgaaatctcaagagggtcaaggttccatttta gaaacgatcactctcattcaggattgtaaagatacccttgaattaatagaaacagagctgacggaagaagaacttgatgtccaggatg(SEQ ID NO:45)

[0065] SLC26A4 - 1226G>A:

[0066] Wild - type:

[0067] Tggcttatgctattgcagtgtcagtaggaaaagtatatgccaccaagtatgattacaccatcgatgggaaccaggaattcattgcctttgggatcagcaaca tcttctcaggattcttctcttgttttgtggccaccactgctctttcccgcacggccgtccaggagagcactggaggaaagacacaggttgctggcatcatctctgctg cgattgtgatgatcgccattcttgccctggggaagcttctggaacccttgcagaagtcggtcttggcagctgttgtaattgccaacctga(SEQ ID NO:46)

[0068] Mutant type:

[0069] Tggcttatgctattgcagtgtcagtaggaaaagtatatgccaccaagtatgattacaccatcgatgggaaccaggaattcattgcctttgggatcagcaaca tcttctcaggattcttctcttgttttgtggccaccactgctctttcccAcacggccgtccaggagagcactggaggaaagacacaggttgctggcatcatctctgctg cgattgtgatgatcgccattcttgccctggggaagcttctggaacccttgcagaagtcggtcttggcagctgttgtaattgccaacctga(SEQ ID NO:47)

[0070] 12s rRNA - 1494C>T:

[0071] Wild type:

[0072] Tgaggtggcaagaaatgggctacattttctaccccagaaaactacgatagcccttatgaaacttaagggtcgaaggtggatttagcagtaaactaagagtagagtgcttagttgaacagggccctgaagcgcgtacacaccgcccgtcaccctcctcaagtatacttcaaaggacatttaactaaaacccctacgcatttatatagaggagacaagtcgtaacatggtaagtgtactggaaagtgcacttggacgaaccagagtgtagcttaacacaaagcacccaacttacacttaggagatttcaacttaacttgaccgctctgagctaaacctagccccaaacccactccaccttacta(SEQ ID NO:48)

[0073] Mutant type:

[0074] tgaggtggcaagaaatgggctacattttctaccccagaaaactacgatagcccttatgaaacttaagggtcgaaggtggatttagcagtaaactaagagta gagtgcttagttgaacagggccctgaagcgcgtacacaccgcccgtcacTctcctcaagtatacttcaaaggacatttaactaaaacccctacgcatttatataga ggagacaagtcgtaacatggtaagtgtactggaaagtgcacttggacgaaccagagtgtagcttaacacaaagcacccaacttacacttagga(SEQ IDNO:49)

[0075] 12s rRNA - 1555A>G:

[0076] Wild type:

[0077] Tgaggtggcaagaaatgggctacattttctaccccgaaaactacgatagcccttatgaaacttaagggtcgaaggtggatttagcagtaaactaagagtagagtgcttagttgaacagggccctgaagcgcgtacacaccgcccgtcaccctcctcaagtatacttcaaaggacatttaact aaaacccctacgcatttatatagaggagacaagtcgtaacatggtaagtgtactggaaagtgcacttggacgaaccagagtgtagcttaacacaaagcacccaacttacacttaggagatttcaacttaacttgaccgctctgagctaaacctagccccaaacccactccaccttacta(SEQ ID NO:50)

[0078] Mutation type:

[0079] cttaagggtcgaaggtggatttagcagtaaactaagagtagagtgcttagttgaacagggccctgaagcgcgtacacaccgcccgtcaccctcctcaagtatacttcaaaggacatttaactaaaacccctacgcatttatatagaggagGc aagtcgtaacatggtaagtgtactggaaagtgcacttggacgaaccagagtgtagcttaacacaaagcacccaacttacacttaggagatttcaacttaacttgaccgctctgagctaaacctagccccaaacccactccaccttact(SEQ ID NO:51).

[0080] Primer design

[0081] Specific primers and probes were designed according to the mutant plasmid, wild-type plasmid and mutation site. The optimal primer and probe combination is listed below, as shown in Table 1.

[0082] Table 1 The optimal primer and probe combination in the present invention

[0083]

[0084]

[0085] However, the above table only shows the optimal primer and probe combinations after screening. There are many combinations of primers and probes actually designed, far more than what is described in Table 1.

[0086] Taking 12S rRNA-1555A>G as an example, 13 primers and probe sequences were selected from the combination that conforms to the AS-PCR and qPCR primer and probe design principles, including 2 wild-type upstream primers, 2 mutant upstream primers, 4 universal downstream primers, 3 universal probes, and 2 wild-type blocking primers. Detailed information is shown in the table below:

[0087] Table 2 Primers and probes for 12s rRNA-1555A>G

[0088]

[0089] PCR amplification was performed using the primers and probes listed in Table 2

[0090] In this experiment, the GC content of the primer probe amplification sequence is relatively high. In order to improve the amplification efficiency and specificity, Enhancer (Tiangen Biochemical Technology (Beijing) Co., Ltd., RP202) was added to the system for amplification.

[0091] The PCR reaction system was a 25 system, including: 5 μl DNA template, 0.08 μl primer, 0.1 μl probe, 0.2 μl dNTPs, 6 μl buffer (Tris-HCl, pH 8.3), 0.1 μl Tap enzyme, 3 mM MgCl2, and the remainder was nuclease-free water.

[0092] PCR amplification conditions were: 95°C pre-denaturation for 3 min, 95°C denaturation for 5 s, 63°C annealing for 31 s, for a total of 40 cycles; 63°C for 31 s (collecting fluorescence)

[0093] Results Analysis

[0094] Based on the above primer probes, 12 sets of primer-probe combination verification experiments were conducted, and the experimental results are as follows:

[0095] Table 3 Results of the validation experiment of 12 sets of primer-probe combinations

[0096]

[0097]

[0098] According to the sequence of the target DNA and the corresponding design principles, hundreds of primer pairs were obtained. Based on experience, 12 primer-probe sets were selected. After multiple screenings and experiments, it was found that the amplification effect of primer-probe combination 6 was the best. The 12s rRNA-1555A>G deafness mutation site can be effectively amplified by the primer-probe combination 6 reaction system. The amplification results are as follows: Figure 1 and Figure 2 As shown, the nature of the curve is obvious.

[0099] Similarly, for the SLC26A4 IVS7-2 A>G mutation, 17 primers and probe sequences were selected, including 2 wild-type upstream primers, 2 mutant upstream primers, 7 universal downstream primers, 4 universal probes, and 2 wild blocking primers, and multiple sets of primer-probe combination verification experiments were performed, and the amplification system and process were the same as above. The results showed that the primer-probe combination shown in SEQ ID NO:1-SEQ ID NO:5 can effectively amplify the GJB2 109G>A deafness mutation site, and the amplification effects of the other combinations were poor.

[0100] 21 primers and probe sequences were selected for the SLC26A4 2168A>G mutation, including 3 wild-type upstream primers, 3 mutant upstream primers, 8 universal downstream primers, 4 universal probes, and 3 wild blocking primers. Multiple sets of primer-probe combination verification experiments were performed, and the amplification system and process were the same as above. The results showed that the primer-probe combination shown in SEQ ID NO:11-SEQ ID NO:15 can effectively amplify the GJB2 109G>A deafness mutation site, and the amplification effects of the other combinations were poor.

[0101] 21 primers and probe sequences were selected for the SLC26A4 1229C>T mutation, including 3 wild-type upstream primers, 3 mutant upstream primers, 6 universal downstream primers, 6 universal probes, and 3 wild blocking primers. Multiple sets of primer-probe combination verification experiments were performed, and the amplification system and process were the same as above. The results showed that the primer-probe combination shown in SEQ ID NO:6-SEQ ID NO:10 can effectively amplify the GJB2 109G>A deafness mutation site, and the amplification effects of the other combinations were poor.

[0102] 15 primers and probe sequences were selected for the SLC26A4 1226A>T mutation, including 2 wild-type upstream primers, 2 mutant upstream primers, 5 universal downstream primers, 4 universal probes, and 2 wild blocking primers. Multiple sets of primer-probe combination verification experiments were performed, and the amplification system and process were the same as above. The results showed that the primer-probe combination shown in SEQ ID NO:16-SEQ ID NO:20 can effectively amplify the GJB2 109G>A deafness mutation site, and the amplification effects of the other combinations were poor.

[0103] 21 primers and probe sequences were selected for the 12s rRNA 1494C>T mutation, including 2 wild-type upstream primers, 2 mutant upstream primers, 7 universal downstream primers, 8 universal probes, and 2 wild blocking primers. Multiple sets of primer-probe combination verification experiments were performed, and the amplification system and process were the same as above. The results showed that the primer-probe combination shown in SEQ ID NO:29-SEQ ID NO:33 can effectively amplify the GJB2 109G>A deafness mutation site, and the amplification effects of the other combinations were poor.

[0104] Example 2

[0105] Deafness clinical sample test kit of the present invention

[0106] (1) Experimental Materials

[0107] Ten negative clinical samples and ten positive clinical samples identified by sequencing method, Tiangen Nucleic Acid Extraction Kit (DP-304).

[0108] (2) Detection method

[0109] Sample extraction

[0110] The nucleic acid of the sample was extracted using a whole blood nucleic acid extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) according to the instructions, and the nucleic acid concentration and purity were detected by spectrophotometer (DNA concentration ≥ 10 ng / μl, OD260 / OD280 ratio between 1.8 and 2.0).

[0111] (3) Preparation of kit

[0112] Preparation of positive control

[0113] It is an artificially synthesized mutant plasmid synthesized by an external company and prepared as a positive control plasmid. It has the characteristics of stability, non-biological infectivity, true simulation of human genome DNA structure, and resistance to RNase.

[0114] The positive quality control is a mutant plasmid as shown in SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 345, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51. The mutant plasmids were mixed and diluted to 1.00E+09 copies / ml using sterile TE to prepare a positive quality control and stored at -20±5°C.

[0115] Preparation of negative control

[0116] It is an artificially synthesized wild-type plasmid synthesized by an external company and prepared as a negative control plasmid. It has the characteristics of being stable, non-biologically infective, able to truly simulate the human genome DNA structure, and resistant to RNase.

[0117] Negative control: Negative control is the wild-type plasmids shown in SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, and SEQ ID NO: 50. The wild-type plasmids were mixed and diluted to 1.00E+09 copies / ml using sterile TE to prepare negative control 1, and stored at -20±5°C.

[0118] The kit includes the reaction solutions of the above 6 mutation sites, and the reaction solutions include: 0.08 μl of the optimal primer corresponding to the mutation site, 0.1 μl of the optimal probe corresponding to the mutation site, 0.2 μl of dNTPs, 6 μl of buffer (Tris-HCl, pH 8.3), 3 mM MgCl2, and the remainder is nuclease-free water.

[0119] (4) PCR amplification

[0120] Take out the reaction solution, Tap enzyme and negative and positive quality controls from the kit, add 5μl to the sample to be tested, negative quality control, and positive quality control, and add 0.4μl of Tap enzyme. After melting and mixing at room temperature, centrifuge at 2000rpm for 10s, mix thoroughly into PCR-mix, and centrifuge for a moment for later use. Add the mixed negative and positive quality controls and samples to the packaged reagents, add 5μl of sample to each PCR tube, and mix by pipetting 3-5 times (pipette gently to avoid bubbles). The test results of the negative and positive quality control systems are used as negative and positive controls. The total volume of each reaction system is 25μl, and the reaction system is as follows:

[0121] Table 4 PCR reaction system

[0122] Component name Single serving Reaction solution 19.6μl Tap enzyme 0.4μl Negative quality control / positive quality control / samples to be tested 5μl Overall system 25μl

[0123] The tube was capped, the mixed liquid was centrifuged at 2000 rpm for 10 seconds, and then moved to the amplification area for amplification. The instrument used was ABI7500, and the amplification used FAM and HEX channels. The amplification reaction conditions were: 95°C for 3 minutes, 95°C for 5 seconds, 63°C for 31 seconds, for a total of 40 cycles; 63°C for 31 seconds (collecting fluorescence).

[0124] (3) Experimental results

[0125] The judgment criteria are shown in Table 5.

[0126] Table 5 Judgment criteria

[0127] Reference value range FAM channel detection value HEX / VIC channel detection value Wild-type samples (-) (+) Mutant samples (+) (+) Invalid sample (-) (-)

[0128] Among them, 1. "(+)" indicates that the amplification curve is "S" type and the Ct value is <35;

[0129] 2. "(-)" indicates that the amplification curve is not "S" type, or the Ct value is >37;

[0130] 3. “Invalid samples” refer to unqualified samples caused by DNA extraction failure or improper sample collection, storage, and transportation;

[0131] 4. If the amplification curve is "S" type and 35≤Ct value≤37, it is necessary to re-extract DNA for testing. If the result is still the same, the DNA needs to be concentrated and tested again. Ct<35 is interpreted as (+), otherwise it is interpreted as (-).

[0132] The test results are shown in Tables 6 and 7:

[0133] Table 6 Test results of the deafness mutation detection kit

[0134]

[0135] According to the experimental results: the positive sample test kits all showed positive results, and the negative sample test kits all showed negative results, indicating that the test results of the deafness mutation detection kit are 100% accurate.

[0136] Table 7 Detection numerical results of the deafness mutation detection kit

[0137]

[0138]

[0139] As can be seen from Table 8, the specificity of the kit of the present invention is 100%, and the concentration is 1×10 6 Copies / ml can be detected with high sensitivity.

[0140] Taking the 1229 site as an example, the results of the 1229 mutant type detection are as follows Figure 3 As shown, the results of the detection of 1229 wild type are as follows Figure 4 shown.

[0141] Through multiple clinical tests, experiments have proved that the kit of the present invention has the following advantages:

[0142] 1. Detection limit: Sample DNA concentration 1ng / μl. For mutant samples with a concentration of 1ng / μl, all test results are mutant.

[0143] 2. Reference material compliance rate: The national negative reference and positive reference outside the scope of the test kit were tested, and the results were wild type or invalid amplification; the national positive reference within the scope of the test kit were all mutant at the corresponding site. The 12 positive references in the company reference were tested, and the results were all mutant at the corresponding site; the 4 negative references in the company reference were tested, and the results were all wild type or invalid amplification; the 4 precision references in the company reference were tested 10 times each, and the results were consistent and of the corresponding genotype.

[0144] 3. Accuracy: The test results of mutant samples are mutant and consistent with the corresponding type.

[0145] 4. Specificity: When this kit was used to detect normal human genomic DNA, the results of each site were wild type; when it was used to detect non-human genomic (salmon sperm DNA) samples, the results of each site were invalid amplification; when it was used to detect 5 mutant samples including GJB2 gene 35del G, SLC26A4 gene 2027T>A, IVS15+5G>A, GJB3 gene 547G>A, and mitochondrial gene 1095T>C, the results of each site were wild type.

[0146] 5. Precision: Intra-batch coefficient of variation (CV) ≤ 5.0%; Inter-batch coefficient of variation (CV) ≤ 5.0%.

[0147] 6. Interference study: The interfering substances present in the sample do not affect the detection of the kit within the following ranges: triglycerides (30mmol / L), bilirubin (480μmol / L), hemoglobin (600g / L), anticoagulants (0.75mg / mL~3mg / L), cholesterol (40.0mmol / L), gentamicin (24mg / mL), streptomycin (64mg / mL), kanamycin (30μg / mL), tobramycin (4μg / mL).

[0148] 7. Clinical trials: A number of clinical samples were verified, and the results showed that compared with similar products and the SANGER gene sequencing method, the detection limit, specificity and overall compliance rate of this product were all 100%.

[0149] The contents explained in the above embodiments should be understood as these embodiments are only used to more clearly illustrate the present invention, and are not used to limit the scope of the present invention. After reading the present invention, various equivalent forms of modifications to the embodiments made by those skilled in the art fall within the scope defined by the claims attached to the present invention.

Claims

1. A primer-probe set for detecting a deafness gene, characterized in that: include: Primer-probe combination A for detecting IVS7-2 A>G mutation in the SLC26A4 gene, primer-probe combination B for detecting 2168A>G mutation in the SLC26A4 gene, primer-probe combination C for detecting 1229C>T mutation in the SLC26A4 gene, primer-probe combination D for detecting 1226G>A mutation in the SLC26A4 gene, primer-probe combination E for detecting 12s rRNA 1555 A>G mutation, and primer-probe combination F for detecting 12s rRNA 1494 C>T mutation.

2. The primer-probe set for detecting the deafness gene according to claim 1, characterized in that: The primer-probe combination A for detecting the IVS7-2 A>G mutation of the SLC26A4 gene includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe. The sequence of the wild upstream primer is shown in SEQ ID NO: 1, the sequence of the wild blocking primer is shown in SEQ ID NO: 2, the sequence of the mutant upstream primer is shown in SEQ ID NO: 3, the sequence of the downstream primer is shown in SEQ ID NO: 4, and the sequence of the probe is shown in SEQ ID NO:

5.

3. The primer-probe set for detecting a deafness gene according to claim 1, characterized in that: The primer-probe combination C for detecting SLC26A4 gene 1229C>T includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO:6, the sequence of the wild blocking primer is shown in SEQ ID NO:7, the sequence of the mutant upstream primer is shown in SEQ ID NO:8, the sequence of the downstream primer is shown in SEQ ID NO:9, and the sequence of the probe is shown in SEQ ID NO:

10.

4. The primer-probe set for detecting a deafness gene according to claim 1, characterized in that: The primer-probe combination B for detecting the 2168A>G mutation of the SLC26A4 gene includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe. The sequence of the wild upstream primer is shown in SEQ ID NO: 11, the sequence of the wild blocking primer is shown in SEQ ID NO: 12, the sequence of the mutant upstream primer is shown in SEQ ID NO: 13, the sequence of the downstream primer is shown in SEQ ID NO: 14, and the sequence of the probe is shown in SEQ ID NO:

15.

5. The primer-probe set for detecting a deafness gene according to claim 1, characterized in that: The primer-probe combination D for detecting SLC26A4 gene 1226G>A includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO: 16, the sequence of the wild blocking primer is shown in SEQ ID NO: 17, the sequence of the mutant upstream primer is shown in SEQ ID NO: 18, the sequence of the downstream primer is shown in SEQ ID NO: 19, and the sequence of the probe is shown in SEQ ID NO:

20.

6. The primer-probe set for detecting a deafness gene according to claim 1, characterized in that: The primer-probe combination E for detecting 12s rRNA1555 A>G includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO:24, the sequence of the wild blocking primer is shown in SEQ ID NO:25, the sequence of the mutant upstream primer is shown in SEQ ID NO:26, the sequence of the downstream primer is shown in SEQ ID NO:27, and the sequence of the probe is shown in SEQ ID NO:

28.

7. The primer-probe set for detecting a deafness gene according to any one of claims 1 to 6, characterized in that: The primer-probe combination F for detecting 12srRNA 1494 C>T includes: a wild upstream primer, a wild blocking primer, a mutant upstream primer, a downstream primer and a probe, the sequence of the wild upstream primer is shown in SEQ ID NO:29, the sequence of the wild blocking primer is shown in SEQ ID NO:30, the sequence of the mutant upstream primer is shown in SEQ ID NO:31, the sequence of the downstream primer is shown in SEQ ID NO:32, and the sequence of the probe is shown in SEQ ID NO:

33.

8. Use of the primer-probe set for detecting a deafness gene according to claim 1 in preparing a reagent for detecting a deafness gene.

9. A deafness gene detection kit, characterized in that: Includes any one or more of primer-probe sets AF.

10. The deafness gene detection kit according to claim 9, characterized in that: The kit also includes: positive quality control and negative quality control; preferably, the negative quality control is a wild-type plasmid as shown in SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, and SEQ ID NO:50; the positive quality control is a mutant plasmid as shown in SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, and SEQ ID NO:51.

Images