Application of RARRES1 in diagnosis and treatment of retinal injury diseases

Abstract

The invention provides an application of RARRES1 in diagnosis and treatment of retinal injury diseases. It is found for the first time that the RARRES1 is significantly down-regulated in the neovascular age-related macular degeneration, and overexpression of the RARRES1 can significantly inhibit apoptosis of ARPE-19 cells under H2O2 conditions and improve the cell viability of ARPE-19, provides a new direction for diagnosis and effective treatment of the neovascular age-related macular degeneration, and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of RARRES1 in diagnosing and treating retinal damage diseases. Background Art

[0002] The retina, also known as the peripheral brain, has the same origin as the brain and is the part that has direct contact with the outside world. The sensory layer on the retina is composed of three neurons, whose main function is to transmit visual information step by step to the visual center to form vision and be responsible for visual conduction. The types of cells included in the retina include: pigment epithelial cells, cone cells, rod cells, binuclear cells, ganglion cells and Muller cells, etc. They form a complex cell network with preliminary information processing functions. Damage to these retinal cells can cause many retinal-related lesions, affect visual conduction function, and lead to diseases such as glaucoma, age-related macular degeneration (AMD), retinal detachment and retinitis pigmentosa.

[0003] AMD is a degenerative blinding disease that progresses slowly, but once it develops into an exudative form, it can cause great damage to vision in a short period of time. Therefore, it is very important to find effective drugs to treat AMD in this field. Summary of the invention

[0004] To make up for the deficiencies of the prior art, the present invention provides the use of RARRES1 in diagnosing and treating retinal damage diseases.

[0005] To achieve the above purpose, the present invention adopts the following technical solution.

[0006] The first aspect of the present invention provides use of a reagent for detecting RARRES1 levels in the preparation of a product for diagnosing retinal damage diseases.

[0007] Furthermore, the diagnosis of retinal damage diseases includes diagnosing retinal damage diseases and distinguishing between cataracts and retinal damage diseases.

[0008] Furthermore, the retinal damage disease is selected from macular degeneration.

[0009] Furthermore, the macular degeneration is selected from age-related macular degeneration.

[0010] Furthermore, the age-related macular degeneration is selected from neovascular age-related macular degeneration.

[0011] Furthermore, the reagent is selected from a probe that specifically recognizes the RARRES1 gene, a primer that specifically amplifies the RARRES1 gene, or a binding agent that specifically binds to a protein encoded by the RARRES1 gene.

[0012] Furthermore, the primer sequences for specific amplification of the RARRES1 gene are shown in SEQ ID NOs: 1 and 2.

[0013] Furthermore, the product includes a chip, a test kit, a test paper or a nucleic acid membrane strip.

[0014] Furthermore, the kit also includes a detectable label.

[0015] Furthermore, the detectable labels include radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent moieties, magnetic particles, and bioluminescent moieties.

[0016] Furthermore, the kit also includes a buffer and a preservative.

[0017] Furthermore, the kit also includes instructions.

[0018] Furthermore, the chip includes a gene chip and a protein chip.

[0019] A second aspect of the present invention provides a product for diagnosing retinal damage diseases, the product comprising a reagent for detecting the level of RARRES1.

[0020] Furthermore, the product includes a chip, a test kit, a test paper or a nucleic acid membrane strip.

[0021] Furthermore, the kit includes reagents for detecting the expression level of RARRES1 gene or protein by RT-PCR method, qRT-PCR method, biochip detection method, Southern blotting method, in situ hybridization method, and immunoblotting method.

[0022] The third aspect of the present invention provides the use of a promoter of RARRES1 in the preparation of a pharmaceutical composition for treating retinal damage diseases.

[0023] Furthermore, the promoter is an agent that upregulates the expression or activity of RARRES1.

[0024] Furthermore, the promoter includes a RARRES1 overexpression vector or a RARRES1 protein.

[0025] Furthermore, the retinal damage disease is selected from macular degeneration.

[0026] Furthermore, the macular degeneration is selected from age-related macular degeneration.

[0027] Furthermore, the age-related macular degeneration is selected from neovascular age-related macular degeneration.

[0028] A fourth aspect of the present invention provides a pharmaceutical composition comprising a promoter of RARRES1.

[0029] Furthermore, the pharmaceutical composition also includes other drugs.

[0030] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable carrier.

[0031] The fifth aspect of the present invention provides the use of RARRES1 as a target in screening candidate drugs for treating retinal damage diseases.

[0032] Furthermore, the method for screening candidate drugs for treating retinal damage diseases includes: treating a culture system expressing or containing the RARRES1 gene or a protein encoded by it with a substance to be screened; and detecting the expression or activity of the RARRES1 gene or a protein encoded by it in the system; wherein, when the substance to be screened promotes the expression level or activity of the RARRES1 gene or a protein encoded by it, the substance to be screened is a candidate drug for treating retinal damage diseases.

[0033] Furthermore, the retinal damage disease is selected from macular degeneration.

[0034] Furthermore, the macular degeneration is selected from age-related macular degeneration.

[0035] Furthermore, the age-related macular degeneration is selected from neovascular age-related macular degeneration.

[0036] The sixth aspect of the present invention provides a method for screening candidate drugs for treating retinal damage diseases, the method comprising: treating a culture system expressing or containing the RARRES1 gene or a protein encoded by it with a substance to be screened; and detecting the expression or activity of the RARRES1 gene or a protein encoded by it in the system; wherein, when the substance to be screened promotes the expression level or activity of the RARRES1 gene or a protein encoded by it, the substance to be screened is a candidate drug for treating retinal damage diseases.

[0037] Furthermore, the retinal damage disease is selected from macular degeneration.

[0038] Furthermore, the macular degeneration is selected from age-related macular degeneration.

[0039] Furthermore, the age-related macular degeneration is selected from neovascular age-related macular degeneration.

[0040] The seventh aspect of the present invention provides a method for regulating the levels of any one or more of the following substances in vitro, the method comprising administering RARRES1, and the substances include: VEGFA, VEGFR2, IL-1, IL-6, IL-8, MCP-1, Occludin, JNK, Nrf2, and SIRT1.

[0041] Furthermore, the substance is a substance in ARPE-19 cells.

[0042] Furthermore, the method is a non-therapeutic method.

[0043] The eighth aspect of the present invention provides the use of RARRES1 in the preparation of products that regulate any one or more of the following substances, including: VEGFA, VEGFR2, IL-1, IL-6, IL-8, MCP-1, Occludin, JNK, Nrf2, and SIRT1.

[0044] Furthermore, the substance is a substance in ARPE-19 cells.

[0045] The ninth aspect of the present invention provides the use of RARRES1 in constructing a computational model for diagnosing retinal damage diseases.

[0046] Furthermore, the diagnosis of retinal damage diseases includes diagnosing retinal damage diseases and distinguishing between cataracts and retinal damage diseases.

[0047] Furthermore, the retinal damage disease is selected from macular degeneration.

[0048] Furthermore, the macular degeneration is selected from age-related macular degeneration.

[0049] Furthermore, the age-related macular degeneration is selected from neovascular age-related macular degeneration.

[0050] Advantages and beneficial effects of the present invention: The present invention discovers for the first time that RARRES1 is significantly downregulated in neovascular age-related macular degeneration, and overexpression of RARRES1 can significantly inhibit the apoptosis of ARPE-19 cells under H2O2 conditions and increase the cell viability of ARPE-19, providing a new direction for the diagnosis and effective treatment of neovascular age-related macular degeneration and having broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 are proteomics research and bioinformatics analysis diagrams, among which 1A is a volcano map of identified proteins (red and green dots represent proteins that are significantly upregulated and downregulated in n AMD compared with the cataract group, respectively, P value<0.05, and log2 fold change over 1.2 in Student's t-test), 1B is a biological process analysis diagram, 1C is a molecular function analysis diagram, 1D is a cellular component analysis diagram, and 1E is a GO function enrichment diagram of differentially expressed proteins under the KEGG pathway category (P value <0.05); Figure 2 is a validation diagram of RARRES1 expression level, wherein 2A is HE staining and choroidal flat mount of laser-induced CNV mouse model, 2B is a diagram of RARRES1 protein level in CNV group and control group, 2C is a diagram of RARRES1 transcription level in CNV group and control group, 2D is a diagram of RARRES1 protein level in ARPE-19 cells after treatment with different concentrations of H2O2 solution, 2E is a diagram of RARRES1 transcription level in ARPE-19 cells after treatment with different concentrations of H2O2 solution, 2F is an immunofluorescence localization diagram of RARRES1 in ARPE-19 cells and a comparison diagram of protein levels between H2O2-induced ARPE-19 cells and control group (scanning bar = 50 μm. *P < 0.05, **P < 0.01, ***P < 0.001); Figure 3 3A is a graph showing the effect of RARRES1 in ARPE-19 cells, 3B is a graph showing the cell viability of ARPE-19 cells, 3C is a graph showing the level of ROS (scan bar = 100 μm), 3D is a graph showing the transcription levels of VEGFA, VEGFR2, IL-1, IL-6, IL-8, TNF-α, and MCP-1, and 3E is a graph showing the protein level of Occludin; Figure 4 4A is a diagram showing the effect of knocking down RARRES1 on the JNK, Nrf2, and SIRT1 pathways of ARPE-19 cells, and 4B is a diagram showing the effect of overexpressing RARRES1 on the JNK, Nrf2, and SIRT1 pathways of ARPE-19 cells. DETAILED DESCRIPTION

[0052] The definitions of some terms used in this specification are provided below. Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0053] The present invention provides the use of a reagent for detecting RARRES1 level in preparing a product for diagnosing retinal damage diseases.

[0054] In some embodiments, the retinal damaging diseases include macular degeneration, retinal detachment, diabetic retinopathy, retinal blood vessel occlusion, and retinitis pigmentosa.

[0055] In a preferred embodiment, the retinal damaging disease is selected from macular degeneration.

[0056] In some embodiments, the macular degeneration includes age-related macular degeneration and genetic-related macular degeneration.

[0057] In a more preferred embodiment, the macular degeneration is selected from age-related macular degeneration.

[0058] In some embodiments, the age-related macular degeneration includes neovascular age-related macular degeneration (also known as wet age-related macular degeneration, exudative age-related macular degeneration), dry age-related macular degeneration.

[0059] In a specific embodiment, said age-related macular degeneration is selected from neovascular age-related macular degeneration.

[0060] The reagent is selected from a probe that specifically recognizes the RARRES1 gene, a primer that specifically amplifies the RARRES1 gene, or a binding agent that specifically binds to a protein encoded by the RARRES1 gene.

[0061] In some embodiments, RARRES1 includes wild-type, mutant or fragments thereof. The term encompasses full-length, unprocessed RARRES1, as well as any form of RARRES1 derived from processing in cells, and variants of RARRES1 (e.g., splice variants or allelic variants). The term encompasses, for example, human RARRES1 as well as RARRES1 from any other vertebrate source, including mammals, such as primates and rodents (e.g., mice and rats), Gene ID: 5918.

[0062] In some embodiments, the probe that specifically recognizes RARRES1 can be DNA, RNA, DNA-RNA chimera, PNA or other derivatives. The length of the probe is not limited, as long as it completes specific hybridization and specifically binds to the target nucleotide sequence, any length is fine. The length of the probe can be as short as 25, 20, 15, 13 or 10 bases. Similarly, the length of the probe can be as long as 60, 80, 100, 150, 300 bases or longer, or even the entire gene.

[0063] In some embodiments, primer refers to a short nucleic acid molecule, such as a DNA oligonucleotide, which can anneal with a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid chain. The primer can be extended along the target nucleic acid molecule by a polymerase. Therefore, the primer can be used to amplify the target nucleic acid molecule, wherein the sequence of the primer is specific for the target nucleic acid molecule, such as the primer will hybridize with the target nucleic acid molecule under very high stringency hybridization conditions.

[0064] Primer or probe of the present application can use phosphoramidite solid phase support method or other well-known method chemical synthesis.Also can use many means known in the art to modify.The limiting examples of these modifications comprise methylation, capping, displacement and modification between nucleotides with one or more analogs of natural nucleotides, for example, modifying uncharged connector (for example, methyl phosphate, phosphotriester, phosphoramidite, carbamate etc.), or modifying charged connector (for example, phosphorothioate, phosphorodithioate etc.).

[0065] The products include chips, test kits, test strips or nucleic acid membrane strips.

[0066] In some embodiments, a kit refers to a set of components provided in the context of a system for sequencing nucleotides and / or isolating nucleotide sequences and / or diagnosing a subject with a disease or infection based on the presence, absence, and / or amount of expressed nucleotide sequences from a sample or cell.

[0067] The kit also includes a detectable label.

[0068] In some embodiments, detectable label refers to a composition that can produce a detectable signal indicating the presence of a target polynucleotide in a determination sample. Suitable labels include, but are not limited to, radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent moieties, magnetic particles, bioluminescent moieties. Therefore, labeling is any composition that can be detected by a device or method, including but not limited to spectroscopy, photochemistry, biochemistry, immunochemistry, electricity, optics, chemical detection devices or any other suitable device. In some embodiments, labeling can be detected visually without the aid of a device. Labeling is used to refer to any chemical group or part with detectable physical properties or can cause chemical groups or parts to show any compound of detectable physical properties, such as an enzyme that catalyzes substrate conversion into a detectable product. Labeling also encompasses compounds that suppress the performance of specific physical properties. Labeling can also be a compound as a member of a pair of binding, and another member thereof has a detectable physical property.

[0069] Among them, radioactive isotopes include but are not limited to 3 H. 14 C. 35 S. 125 I. 131 I.

[0070] Enzymes include, but are not limited to, horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase, acetylcholinesterase.

[0071] Fluorescent molecules include, but are not limited to, FITC, rhodamine, and lanthanide phosphors.

[0072] In some embodiments, the kit further comprises one or more substances from the following group: a container, a positive control substance, a negative control substance, a buffer, and a preservative.

[0073] In some embodiments, the kit may also be accompanied by instructions for use of the kit, which describe how to use the kit for testing, and how to use the test results to judge the progression of the disease and select a treatment plan.

[0074] In some embodiments, the components of the test kit can be packaged in the form of an aqueous medium or in a lyophilized form. Suitable containers in the test kit usually include at least a vial, test tube, flask, PET bottle, syringe or other container, in which a component can be placed, and preferably, can be appropriately divided. When there is more than one component in the test kit, the test kit will usually also include a second, third or other additional container, in which additional components are placed separately. However, the components of different combinations can be contained in a vial. The test kit of the application will usually also include a container for accommodating reactants, sealed for commercial sale. This container can include a plastic container of injection molding or blow molding, in which required vials can be retained.

[0075] The solid support of the kit can be, for example, plastic, silicon, metal, resin, glass, membrane, particle, precipitate, gel, polymer, sheet, sphere, polysaccharide, capillary, film, plate or slide.

[0076] The chips include gene chips and protein chips.

[0077] In some embodiments, the gene chip includes a solid phase carrier and a probe fixed on the solid phase carrier, wherein the probe includes an oligonucleotide probe for the RARRES1 gene for detecting the transcription level of the RARRES1 gene; the protein chip includes a solid phase carrier and a specific antibody for the RARRES1 protein fixed on the solid phase carrier; the gene chip can be used to detect the expression level of multiple genes including the human RARRES1 gene (for example, multiple genes related to macular degeneration). The protein chip can be used to detect the expression level of multiple proteins including the human RARRES1 protein (for example, multiple proteins related to macular degeneration). By detecting multiple markers related to macular degeneration at the same time, the accuracy of macular degeneration can be greatly improved.

[0078] The present invention provides the use of a promoter of RARRES1 in preparing a pharmaceutical composition for treating retinal damage diseases.

[0079] In some embodiments, the promoter refers to any substance that can increase the activity of RARRES1 protein, improve the stability of RARRES1 gene or protein, upregulate the expression of RARRES1 protein, increase the effective action time of RARRES1 protein, or promote the transcription and translation of RARRES1 gene, and these substances can be used in this application. The promoter includes nucleic acid promoter and protein promoter. The promoter includes but is not limited to a vector that overexpresses RARRES1, RARRES1 protein or its active peptide.

[0080] The pharmaceutical composition also includes other drugs.

[0081] In some embodiments, the other drugs include but are not limited to Lucentis, Eylea, Conbercept, vitamin C, vitamin E, lutein, iodine lecithin complex tablets, Mingmu Dihuang pills, and Xuemingmu tablets.

[0082] The pharmaceutical composition also includes a pharmaceutically acceptable carrier.

[0083] In some embodiments, a pharmaceutically acceptable carrier refers to a drug carrier composed of non-biological or undesirable materials, ie, the material can be administered to a subject together with the selected active agent without causing any or substantial adverse reactions.

[0084] In some embodiments, the pharmaceutical composition can be administered intraocularly, intravenously, intraarterially, intraperitoneally, intramuscularly, subcutaneously, intracavitary, transdermally or by, for example, an osmotic pump. For in vitro studies, the reagent can be added to or dissolved in a suitable biologically acceptable buffer and added to a cell or tissue.

[0085] In some embodiments, the pharmaceutical composition is preferably prepared and administered in a dosage unit. Solid dosage units can be tablets, capsules and suppositories. In order to treat the subject, different daily doses can be used according to the activity of the pharmaceutical composition, the mode of administration, the nature and severity of the disease, the age and weight of the subject. However, in certain cases, a higher or lower daily dose is also appropriate. The administration of the daily dose can be implemented by a single administration in the form of a single dosage unit or a plurality of small dosage units, or by multiple administrations of subdivided doses at specific intervals.

[0086] In some embodiments, the pharmaceutical composition can be in the form of a sterile injectable aqueous solution or oily suspension. The suspension can be prepared according to known methods using a suitable dispersant or wetting agent and suspending agent. The sterile injectable preparation can also be a sterile injectable solution or suspension in a nontoxic parenteral acceptable diluent or solvent, such as a solution in 1,3-butanediol. In these acceptable carriers and solvents, water, Ringer's solution and isotonic sodium chloride solution can be used. In addition, sterile, fixed oils are also commonly used as solvents or suspension media. For this purpose, any gentle fixed oil can be used, including synthetic monoglycerides or diglycerides. In addition, it is found that fatty acids such as oleic acid can be used in the preparation of injectable preparations.

[0087] In some embodiments, the suspending agent includes, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum arabic. The dispersing or wetting agent can be (a) a naturally occurring phospholipid, such as lecithin; (b) an alkylene oxide and a fatty acid condensation product, such as polyoxyethylene stearate; (c) a condensation product of ethylene oxide and a long chain fatty alcohol, such as heptadecaethylenoxycetanol; (d) a condensation product of ethylene oxide and a partial ester derived from a fatty acid and a hexitol, such as polyoxyethylene sorbitan monooleate, or (e) a condensation product of ethylene oxide and a partial ester derived from a fatty acid and a hexitolanhydrides, such as polyoxyethylene sorbitan monooleate.

[0088] The present invention provides the application of RARRES1 in constructing a computational model for diagnosing retinal damage diseases.

[0089] In some embodiments, the computational model includes the expression level of RARRES1. As known to the skilled artisan, the step of associating the level of RARRES1 with a certain probability or risk can be implemented and realized in different ways. For example, the measured concentrations of RARRES1 and one or more other markers are mathematically combined and the combined value is associated with the underlying diagnostic question. The determination of marker values ​​can be combined by any suitable prior art mathematical method.

[0090] The invention will be further described below in conjunction with specific examples. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the invention. The main features of the invention may be used in a variety of embodiments without departing from the scope of the invention.

[0091] Example

[0092] 1. Experimental Materials and Methods Patients and samples Patients with nAMD and age-matched cataract controls (n = 8) were recruited from the Department of Ophthalmology, the Second Hospital of Hebei Medical University. Inclusion criteria were: (1) age older than 60 years; (2) first diagnosis of nAMD according to the preferred practice pattern for age-related macular degeneration; and (3) no history of treatment such as intravitreal injection of anti-VEGF drugs, photodynamic therapy, or photocoagulation. Exclusion criteria included: (1) patients with ocular diseases other than cataract and nAMD; (2) history of intraocular disease or surgery; and (3) any major systemic disease such as cancer, autoimmune disease, congestive heart failure, hypertension, and diabetes. This study adhered to the Declaration of Helgi and was approved by the Ethics Committee of the Second Hospital of Hebei Medical University. All patients signed informed consent. AH samples were collected before the first intravitreal injection of anti-VEGF drugs and during cataract surgery in patients with nAMD. Samples were collected using a 1cc syringe and cannula. After collection, 50 to 150 μL of the sample was transferred to an eppendorf tube and frozen at –80°C. The aqueous humor (AH) of every 4 patients in each group was randomly mixed for sequencing, and finally 2 pairs of samples were obtained.

[0093] Quantitative proteomics analysis using tandem mass tags (TMT) technology Quantitative proteomic analysis based on tandem mass tagging was performed by Shanghai Bio-Applied Protein Technology Co., Ltd. First, aqueous humor was placed in SDT lysis buffer (4% w / v SDS, 100 mM Tris / HCl, pH 7.6, 0.1 M DTT) to extract proteins. Protein levels in the supernatant were quantified using the BCA protein assay kit. An appropriate amount of protein was taken from each sample and trypsin digested by filter-assisted proteome preparation (FASP), and then peptide levels were quantified (OD280). Next, 100 μg of peptides from each sample were labeled using the TMT Equal Mass Tag Kit (Thermo Scientific, MA, USA). Equal amounts of labeled peptides from each sample were mixed and fractionated using a high pH reverse phase peptide fractionation kit according to the manufacturer's protocol. LC-MS / MS was performed on a Q-Exactive mass spectrometer (Thermo Scientific) coupled to an Easy-nLC 1000 instrument (Thermo Scientific). Protein identification and quantification were performed using Mascot 2.2 and Proteome Discoverer 1.4.

[0094] Bioinformatics analysis GO functional annotation: Blast2GO was used to perform GO annotation on the target protein set. The process can be roughly summarized into four steps: sequence alignment (Blast), GO entry extraction (Mapping), GO annotation (Annotation) and InterProScan supplementary annotation (Annotation Augmentation).

[0095] KEGG pathway annotation: KEGG pathway annotation was performed on the target protein set using KAAS (KEGG Automatic Annotation Server) software.

[0096] Enrichment analysis: Fisher's Exact Test was used to compare the distribution of each GO classification (or KEGG pathway) in the target protein set and the overall protein set, and enrichment analysis of GO annotations or (or KEGG pathway) annotations was performed on the target protein set.

[0097] Cell lines The human retinal pigment epithelial cell line (ARPE-19 cells) was obtained from the American Type Culture Collection (Manassas, VA, USA).

[0098] q-PCR Treated ARPE-19 cells were extracted using TRIzol reagent (Takara, Dalian, China). cDNA was synthesized using PrimeScript™ 1st strand cDNA synthesis kit (Monad Biotech Inc, Suzhou, China) and then amplified and quantified using SYBR qPCR kit (Monad Biotech Inc.) on the CFX Connect Real-Time PCR System. -ΔΔCT Methods Quantification of gene expression. mRNA expression levels were normalized to GAPDH (RARRES1 primer sequences, F: CTAGTGTGAGGCAGTGGAAAACC (SEQ ID NO: 1); R: GACCAAGTGAATGCGACAGG (SEQ ID NO: 2)).

[0099] Western blotting Cells were lysed with RIPA buffer on ice and then boiled in SDS loading buffer, and protein extracts were subjected to 6%–12% SDS-PAGE and electro-transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk, cut horizontally as needed, and then exposed to the designated primary antibodies overnight at 4°C. After washing, the membranes were incubated with the relevant secondary antibodies for 1 hour at room temperature. Finally, visualization was achieved using ECL chemiluminescent reagents and the Bio-Rad GelDoc imaging system.

[0100] Construction of CNV mouse model Male C57BL / 6 mice (6–8 weeks old) were purchased from Beijing Huafukang Biotechnology Co., Ltd. (Beijing, China) and housed in a specific pathogen-free (SPF) facility. All mice had free access to food and water under a 12-h light / dark cycle. The experiments were performed in accordance with the National Animal Care and Use Guide and approved by the Research Ethics Committee of the Second Hospital of Hebei Medical University.

[0101] Mice were anesthetized with chloral hydrate, and pupils were dilated using 0.5% tropicamide (Henry Schein, NY, USA). Laser photocoagulation was performed using an ophthalmic laser system (Nd, 532 nm; Coherent Novus Omni (Palo Alto, CA, USA) with a spot diameter of 50 μm, a duration of 100 ms, and a power of 300 mW, with five spots per eye around the optic disc. The formation of bubbles confirmed successful rupture of the Bruch's.

[0102] Cell viability assay Cell viability was detected using the Cell Counting Kit-8 (CCK-8, BioTek, Jiangsu, China). Briefly, the treated cells were seeded in a 96-well plate and incubated with 10 μL of CCK-8 solution at 37 °C for 1 h. The optical density (OD) value of each well at a wavelength of 450 nm was measured using a microplate reader (BioTek, Vermont, USA).

[0103] Annexin V-FITC / PI staining ARPE-19 cells were subjected to cell apoptosis detection using Annexin V-FITC apoptosis detection kit (Cat#: E-CK-A217, Elabscience, Wuhan, China) and studied by FACS LSRFortessa™ flow cytometer. Briefly, cells were seeded in 6-well plates and cultured at 37°C and 5% CO2. When the cell confluence reached approximately 75%, they were treated with 400 μm mol / L H2O2 for 48 hours. After washing the cells with PBS, Annexin V-FITC / PI dual fluorescent dye was added, and the culture plate was placed in the dark for 15 minutes.

[0104] Measurement of ROS Intracellular ROS levels were observed by fluorescent dye 20,70-dichlorodihydrofluorescein diacetate (Cat#: E-BC-K138-F, DCFH-DA, Elabscerince). Briefly, treated cells were incubated in DMEM containing 10 µM DCFH-DA at 37°C for 30 min. After washing, labeled cells were observed using a fluorescence microscope (Nikon, Tokyo, JP).

[0105] Immunofluorescence staining To investigate the intracellular localization of RARRES1, ARPE-19 cells were cultured in 24-well chamber slides (Lab-Tek II chamber slide system, Nunc). After 24 h, ARPE-19 cells were treated with 400 μM hydrogen peroxide solution. Cells were fixed with 4% formaldehyde and permeabilized with 1% Triton X-100.

[0106] Then, cells and paraffin sections were blocked with 5% BSA and incubated overnight at 4°C with mouse anti-human RARRES1 (dilution 1:50; Cat sc-390461, Santa Cruz, CA, USA). After washing the cells and sections, they were moved to a dark place and incubated for 1 h at 37°C with goat anti-mouse IgG secondary antibody Alexa Fluor 594 or 488 (1:200; Zen BioScience, China). Finally, cells and paraffin sections were incubated with DAPI to stain the cell nuclei.

[0107] Statistical analysis Each experiment was performed at least three times, and the mean of these replicates was calculated for statistical analysis. Data are presented as mean ± standard deviation (SD). Statistical analysis was completed using SPSS program. One-way ANOVA was used for comparison between multiple groups, and t-test was used for comparison between two groups. P values ​​< 0.05 were considered statistically significant.

[0108] 2. Experimental results like Figure 1 As shown, RARRES1 was upregulated in the n AMD patient group compared with the cataract patient group.

[0109] Compared with the control group (Control), the RARRES1 protein and transcription levels in the CNV mouse model (CNV) were significantly downregulated. Compared with the control group (Control), the RARRES1 protein level in H2O2-induced ARPE-19 cells (H2O2) was significantly downregulated ( Figure 2 ).

[0110] In normal ARPE-19 cells, compared with the control group (si-NC), there was no significant change in the apoptosis rate and cell viability of ARPE-19 cells after knockdown of RARRES1 (si-RARRES1); in ARPE-19 cells treated with H2O2, compared with the control group (si-NC+H2O2), the apoptosis rate of ARPE-19 cells was significantly increased and the cell viability was significantly decreased after knockdown of RARRES1 (si-RARRES1+H2O2); in normal ARPE-19 cells, compared with the control In the ARPE-19 cells treated with H2O2, the apoptosis rate of ARPE-19 cells was significantly decreased and the cell viability was significantly increased after overexpression of RARRES1 (RARRES1+H2O2) compared with the control group (pcDNA3.1+H2O2). Overexpression of RARRES1 reduced ROS generation and increased Occludin protein level ( Figure 3 ).

[0111] Overexpression of RARRES1 promotes the expression of JNK, Nrf2, and SIRT1 proteins in ARPE-19 cells ( Figure 4 ).

[0112] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. The use of reagents for detecting RARRES1 levels in the preparation of products for diagnosing retinal damage diseases; Preferably, the diagnosis of retinal damage diseases includes diagnosing retinal damage diseases and distinguishing cataracts from retinal damage diseases; Preferably, the retinal damage disease is selected from macular degeneration; Preferably, the macular degeneration is selected from age-related macular degeneration; Preferably, the age-related macular degeneration is selected from neovascular age-related macular degeneration; Preferably, the reagent is selected from a probe that specifically recognizes the RARRES1 gene, a primer that specifically amplifies the RARRES1 gene, or a binding agent that specifically binds to a protein encoded by the RARRES1 gene; Preferably, the primer sequences for specifically amplifying the RARRES1 gene are shown in SEQ ID NOs: 1 and 2.

2. The use according to claim 1, characterized in that: The products include chips, test kits, test strips or nucleic acid membrane strips; Preferably, the kit further comprises a detectable label; Preferably, the detectable label comprises a radioisotope, a nucleotide chromophore, an enzyme, a substrate, a fluorescent molecule, a chemiluminescent moiety, a magnetic particle, a bioluminescent moiety; Preferably, the kit further comprises a buffer and a preservative; Preferably, the kit further comprises instructions; Preferably, the chip includes a gene chip or a protein chip.

3. A product for diagnosing retinal damage, characterized in that: The product includes a reagent for detecting RARRES1 levels; Preferably, the product comprises a chip, a test kit, a test paper or a nucleic acid membrane strip; Preferably, the kit comprises reagents for detecting the expression level of RARRES1 gene or protein by RT-PCR, qRT-PCR, biochip detection, Southern blotting, in situ hybridization, or immunoblotting.

4. Use of a promoter of RARRES1 in the preparation of a pharmaceutical composition for treating retinal damage diseases; Preferably, the promoter is an agent that upregulates the expression or activity of RARRES1; Preferably, the promoter comprises a RARRES1 overexpression vector or a RARRES1 protein; Preferably, the retinal damage disease is selected from macular degeneration; Preferably, the macular degeneration is selected from age-related macular degeneration; Preferably, the age-related macular degeneration is selected from neovascular age-related macular degeneration.

5. A pharmaceutical composition, characterized in that The pharmaceutical composition includes a promoter of RARRES1; Preferably, the pharmaceutical composition further comprises other drugs; Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

6. Application of RARRES1 as a target in screening candidate drugs for the treatment of retinal damage diseases; Preferably, the method for screening candidate drugs for treating retinal damage diseases comprises: Treating a culture system expressing or containing the RARRES1 gene or a protein encoded by it with a substance to be screened; and detecting the expression or activity of the RARRES1 gene or the protein encoded by it in the system; wherein, when the substance to be screened promotes the expression level or activity of the RARRES1 gene or the protein encoded by it, the substance to be screened is a candidate drug for treating retinal damage diseases; Preferably, the retinal damage disease is selected from macular degeneration; Preferably, the macular degeneration is selected from age-related macular degeneration; Preferably, the age-related macular degeneration is selected from neovascular age-related macular degeneration.

7. A method for screening candidate drugs for treating retinal damage diseases, characterized in that: The method comprises: treating a culture system expressing or containing the RARRES1 gene or a protein encoded by it with a substance to be screened; and detecting the expression or activity of the RARRES1 gene or a protein encoded by it in the system; wherein, when the substance to be screened promotes the expression level or activity of the RARRES1 gene or a protein encoded by it, the substance to be screened is a candidate drug for treating retinal damage diseases; Preferably, the retinal damage disease is selected from macular degeneration; Preferably, the macular degeneration is selected from age-related macular degeneration; Preferably, the age-related macular degeneration is selected from neovascular age-related macular degeneration.

8. A method for regulating the level of any one or more of the following substances in vitro, characterized in that: The method comprises administering RARRES1, wherein the substances comprise: VEGFA, VEGFR2, IL-1, IL-6, IL-8, MCP-1, Occludin, JNK, Nrf2, SIRT1; Preferably, the substance is a substance in ARPE-19 cells.

9. Use of RARRES1 in the preparation of products for regulating any one or more of the following substances, wherein the substances include: VEGFA, VEGFR2, IL-1, IL-6, IL-8, MCP-1, Occludin, JNK, Nrf2, SIRT1; Preferably, the substance is a substance in ARPE-19 cells.

10. Application of RARRES1 in constructing computational models for diagnosing retinal damage diseases; Preferably, the diagnosis of retinal damage diseases includes diagnosing retinal damage diseases and distinguishing cataracts from retinal damage diseases; Preferably, the retinal damage disease is selected from macular degeneration; Preferably, the macular degeneration is selected from age-related macular degeneration; Preferably, the age-related macular degeneration is selected from neovascular age-related macular degeneration.

Images