Molecular marker for identifying genetic sex of siniperca scherzeri, genetic sex identification method and application
By developing genetic sex molecular markers for scattered mandarin and corresponding primers and kits, the problem of difficult to quickly and accurately identify the gender of scattered mandarin in the prior art is solved, the process of induction of pseudo-male fish is simplified, and the breeding benefits are improved.
Patent Information
- Application Number
- CN202510059225.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-15
- Publication Date
- 2025-02-25
AI Technical Summary
The prior art is difficult to quickly and accurately identify the genetic gender of squid mandarin, and the operation of pseudo-male fish inducing hormones is complicated and labor costs are high.
A molecular marker that identifies the genetic gender of the squid mandarin is developed, and the genetic gender is identified through PCR amplification and electrophoresis detection methods are used, and primers and kits are designed for this molecular marker to simplify the induction process of pseudo-male fish.
The rapid and accurate identification of the genetic gender of scattered mandarin is achieved, the process of induction of pseudo-male fish is simplified, the labor cost is reduced, and the benefits of scattered mandarin are improved.
Smart Images
Figure CN119506440A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of fish sex identification, and in particular relates to a molecular marker for identifying the genetic sex of mandarin fish and a genetic sex identification method and application thereof. Background Art
[0002] Siniperca chuatsi Siniperca scherzeri ), belongs to the family Sinipercidae of the order Perciformes, genus Sinipercidae Siniperca ), in my country, it is mainly distributed in the Red River, Nanpan River to Xichang, Sichuan, east of Qinling Mountains and even southern Liaoning. Siniperca chuatsi is an important economic fish in my country, and its market price is high. However, it feeds on small fish and shrimps since hatching and refuses to eat feed, which creates many difficulties for the breeding of Siniperca chuatsi. After artificial domestication, Siniperca chuatsi can also be fed with iced fish blocks, which reduces production costs to a certain extent. Because of its delicate and tender meat, delicious taste, rapid growth and strong disease resistance, it is highly favored in the market, has a large market demand, and has broad breeding prospects.
[0003] The body shape of Siniperca chuatsi is obviously sexually dimorphic, and female individuals are significantly larger than male individuals. Therefore, achieving single-sex breeding is of great significance for improving the economic benefits of Siniperca chuatsi farming. Identifying pseudo-male fish (♂XX) with female genetic sex and male physiological sex is the key to achieving all-female breeding. However, it is impossible to distinguish male and pseudo-male fish of Siniperca chuatsi through phenotypic characteristics in production. Therefore, the development of sex-specific molecular markers for Siniperca chuatsi is a prerequisite for accurate screening of pseudo-male fish. Exogenous hormone interference during the window period of sex differentiation of Siniperca chuatsi can usually achieve sex reversal in female fish. Androgens are usually used to induce pseudo-male fish in production, but studies have found that progesterone can also achieve sex reversal in fish, and it shows great advantages in sperm motility and induction efficiency.
[0004] The problems existing in the prior art are: (1) In the past, the method of distinguishing between males and females was to raise the spotted mandarin fish to sexual maturity, squeeze their abdomens, and observe their ejaculation or ovulation to distinguish between males and females. This method is time-consuming, inefficient, and limited by the developmental stage. In all-female breeding, it is also impossible to screen out pseudo-male fish with female genetic sex through phenotypic characteristics.
[0005] (2) The existing pseudo-male fish inducing hormones are mainly achieved by indirectly feeding androgens to the mandarin fish. It is necessary to first prepare hormone feed and then feed the bait fish. The bait fish that have just eaten are fed to the mandarin fish. The operation is relatively complicated and the labor cost is high.
[0006] In summary, the present invention intends to newly develop a molecular marker for identifying the genetic sex of Siniperca chuatsi and a genetic sex identification method and its application, especially in the identification of progesterone-induced pseudomale fish, which will help to achieve sex-controlled breeding of Siniperca chuatsi and is of great value to improving the breeding efficiency of Siniperca chuatsi. Summary of the invention
[0007] The purpose of the present invention is to provide a molecular marker for identifying the genetic sex of Siniperca chuatsi.
[0008] The present invention also aims to provide a method for identifying the genetic sex of Siniperca chuatsi.
[0009] The last object of the present invention is to provide a reagent for detecting the molecular marker for molecular identification of the genetic sex of Siniperca chuatsi, a kit containing primers for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi, and the application of the genetic sex identification method of Siniperca chuatsi in genetic sex identification of Siniperca chuatsi, identification of pseudo-male fish induced by progesterone, and all-female breeding of Siniperca chuatsi.
[0010] The first object of the present invention can be achieved by the following technical solution: a molecular marker for identifying the genetic sex of Siniperca chuatsi, the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and the molecular marker is a male fish-specific DNA fragment.
[0011] The second object of the present invention can be achieved by the following technical solution: A method for identifying the genetic sex of Siniperca chuatsi, comprising the following steps: (1) Extracting genomic DNA from Siniperca chuatsi; (2) Using the genomic DNA of step (1) as a template, PCR amplification is performed using primers for detecting the molecular marker for identifying the genetic sex of the spotted chuatfish. After the amplification, electrophoresis detection is performed. If the electrophoresis result shows that the amplified product has a specific DNA band, the genetic sex of the spotted chuatfish detected is male; if the electrophoresis result shows that the amplified product does not have a specific DNA band, the genetic sex of the spotted chuatfish detected is female.
[0012] In the above method for identifying the genetic sex of Siniperca chuatsi: Preferably, the genomic DNA in step (1) is collected from fin rays or tissues of Siniperca chuatsi.
[0013] Preferably, the primers in step (2) include an upstream primer and a downstream primer, the sequence of the upstream primer is shown in SEQ ID NO: 2, and the sequence of the downstream primer is shown in SEQ ID NO: 3.
[0014] Specifically, the sequences of the upstream primer and the downstream primer are as follows: Upstream primer: 5'-AAAAGGCGGGTTTTCTTCAT-3' (as shown in SEQ ID NO: 2); Downstream primer: 5'-CTCATCTGTGAATGGGCCTT-3' (as shown in SEQ ID NO: 3).
[0015] Preferably, during PCR amplification in step (2), the PCR reaction system used is: 12.5 μL of 2×Taq PCR Master Mix, 1 μL of upstream and downstream primers with a concentration of 10 μmol / L, 2 μL of template DNA with a concentration of 50-100 ng, and ddH 2 O 8.5 μL, total 25 μL.
[0016] Among them: 2×Taq PCR Master Mix includes: 0.1U Taq DNA Polymerase / mL, 500mmol / L dNTP each, 50mmo1 / L Tris-HC1 (pH 8.7), 20mmol / L KC1, 4mmo1 / L MgC1 2 .
[0017] Preferably, the PCR reaction procedure in step (2) is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 60 s, for a total of 35 cycles; extension at 72°C for 10 min; and storage at 4°C.
[0018] Preferably, if the electrophoresis result in step (2) shows that the amplified product has a specific DNA band of about 921 bp in size, the genetic sex of the detected Siniperca chuatsi is male; if the electrophoresis result shows that the amplified product does not have a specific DNA band of about 921 bp in size, the genetic sex of the detected Siniperca chuatsi is female.
[0019] The present invention also provides an application of the primers for detecting the molecular markers for identifying the genetic sex of Siniperca chuatsi in preparing a kit for identifying the genetic sex of Siniperca chuatsi.
[0020] The kit for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi provided by the invention comprises the primers.
[0021] Furthermore, the present invention also provides a reagent for detecting the molecular marker for identifying the genetic sex of the spotted mandarin fish, a kit containing primers for detecting the molecular marker for identifying the genetic sex of the spotted mandarin fish, or the application of the genetic sex identification method in genetic sex identification of the spotted mandarin fish, identification of progesterone-induced pseudo-male fish, and all-female breeding of the spotted mandarin fish.
[0022] Preferably, when used in all-female breeding of Siniperca chuatsi, the method includes screening and breeding of pseudo-male fish, and further includes the following steps: (S1) Culture of Siniperca chuatsi larvae by immersion in progesterone; (S2) using the reagent for detecting the molecular marker for identifying the genetic sex of the spotted mandarin fish, the kit for detecting the molecular marker for identifying the genetic sex of the spotted mandarin fish, or the genetic sex identification method to identify pseudo-male fish of the spotted mandarin fish fry, and selecting fish with a genetic type of XX, i.e., pseudo-male fish, from the mandarin fish soaked in progesterone; (S3) The XX pseudo-male fish identified by the mark is continued to be raised until sexual maturity, and then mated with normal XX female Siniperca chuatsi during the breeding season to obtain all-female Siniperca chuatsi offspring.
[0023] Preferably, the progestogen in step (S1) is levonorgestrel, the soaking concentration is about 1 μg / L, the soaking time is 30 to 60 days, and the soaking solution is replaced daily.
[0024] Preferably, in step (S1), the fry are 14 to 30 days old and are fed with palatable bait fish at 8:00, 12:00 and 20:00 every day.
[0025] The invention has the following advantages: the invention obtains a molecular marker for identifying the genetic sex of Siniperca chuatsi through high-throughput sequencing and comparative genome methods, designs primers, a kit and an identification method for the genetic sex of Siniperca chuatsi for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi, and the reagents, primers, kit or method for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi can be quickly and accurately used for detecting the genetic sex of Siniperca chuatsi, identifying pseudo-male fish induced by progesterone and all-female breeding of Siniperca chuatsi. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.
[0027] Figure 1 The electrophoresis diagram of the PCR products of the primer pair M1-F / R in Example 1, in which the amplified fragment was detected in the male sample but not in the female sample; Figure 2 The results of electrophoresis detection of 24 male and female samples of wild population by the primers in Example 2; Figure 3 The results of electrophoresis detection of 12 samples of male and female from the breeding population using the primers in Example 2 are shown. DETAILED DESCRIPTION
[0028] The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, but should not be construed as limiting the present invention. If no specific techniques or conditions are specified in the embodiments, the techniques or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially. Example 1
[0029] 1. Acquisition of molecular markers for identifying the genetic sex of Siniperca chuatsi In this embodiment, the molecular markers and primers for identifying the genetic sex of Siniperca chuatsi are obtained by the following method, which comprises the following steps: (1.1) Preparation of gonadal sections to determine the sex of Siniperca chuatsi A total of 19 sexually mature Siniperca chuatsi were purchased from Shaoguan, Guangdong. After dissection, the gonads were obtained and preserved in Bonn's solution, and the back muscle tissue was obtained and preserved in liquid nitrogen. The gonad tissue was embedded in paraffin and sectioned and HE stained for observation, resulting in 9 females and 10 males.
[0030] (1.2) DNA sample preparation of Siniperca chuatsi The muscle tissues were numbered F1-F9 for females and M1-M10 for males, and DNA samples were prepared by conventional column centrifugation (Universal Column Genome Extraction Kit, Beijing Kangwei Century Biotechnology Co., Ltd.) according to the instructions. The quality and concentration were detected by 1% agarose gel electrophoresis and a micro-spectrophotometer (NanoDrop2000) to meet the requirements of high-throughput sequencing.
[0031] (1.3) Sequencing library construction and high-throughput sequencing DNA samples of female fish F1-F9 and male fish M1-M10 were selected to construct 350-500 bp fragment sequencing libraries, respectively. Pair-End PE150 sequencing was performed using the Illumina Hiseq X Ten platform to obtain female and male genome sequencing clean data: 103,159,008,300 bp and 126,342,754,500 bp, respectively.
[0032] The library construction steps were specifically referred to the NovogeneNGS DNA Library Prep Kit instruction manual, and sequencing was completed by Guangzhou Ruike Gene Technology Co., Ltd.
[0033] 2. Obtaining Y chromosome-specific DNA fragments (2.1) Including male fish genome assembly The genome of male fish sequencing reads was assembled using the all method in SOAPdenovov2.04-r240 (https: / / github.com / aquasky line / SOAPdenovo2), and a total of 1,083,829 scaffolds of male fish were obtained, with a total size of 815,037,064 bp, of which N50 = 26,458 bp.
[0034] (2.2) Obtaining candidate DNA fragments of male fish The sequencing reads of female fish F1-F9 and male fish M1-M10 were aligned to the male fish genome using the aln method of bwav0.7.17-r1188 (http: / / bio-bwa.sourceforge.net / ) software. The reads that could not be aligned with the male fish sequencing reads were filtered out, and the regions that could be aligned with the male fish sequencing reads but not with the female fish sequencing reads were selected. These regions were considered to be male fish-specific DNA fragments.
[0035] Specifically, the nucleotide sequence of one of the male fish-specific DNA fragments is as follows: AAAAGGCGGGTTTTCTTCATATTCATCCTAACTTTGATGTTTCTGATGTACAAATTAGGTTCTGAGAGATTTTTGGCATTAATGACAGTTAATCTTAATGTTCTAATGCAGGAAGTTGTTTCTGAGAAGATTAATTACAAAAAAATAAAAGAGTTAATGACTGTTTACAGTAATATAATGATTAAAATGCAATTAACCAACAGAAAGAAACTTAAATTGAACATATACACTCTGTGGACTATGTTTTTAAAACATTCAAACAGAAGTTGATGTCAGTAATGCAGAATTGCATTTCTGGATGCTAGAAAGGTCAGCTGAAAATGTGAAAATGACCTTTTGTCATCCAAAGAAGGTCAACATATTAACATATGCTTGCTGTAGGAAAGTTTAAAAGACCATCAAAATAACCATGCTATCCCTCAGTTCTAAACAGATTTTTCATGTTTCTTCTGCAAAAATTTGATTCTAAGACATTCTGTAAACAAAATACAGCTTACCTTGACATAGTTGTGAAAATTAATTTATCTTACTGAAAACAGCTTAAAGTGATTATTTGCCAGCAAGAGGTTTTCAGTCTTTCCTCTGAAGATGGGTCATCTGTTCTCTGATGATCTCTGTCTTCTGGATGATCTCAGGAGAAGTGTGTCTGTAGGCTGTGACAATGCCTTAATTACTCTTGTGAGGTCATGGGTGGCTTTCAGGGGTTTCAAACCCAGTCTGTAGACATAAGTGATAAAACAATGACTTGTTCAGCAGTAATGAAAACAACAGGGTTTAGTCTCTAGATAGCCTTATTCTGATAATATTGGAAGTCAAGTGGAGAGTTAGCACGCATAATGTAGTTATTAACGTCTGAATAGATTCGTAAGCGCTCATTCATATGTTGGCTACATTGTGGAGG AAG GCCCATTCACAGATGAG (as shown in SEQ ID NO: 1).
[0036] The underlined parts are the complementary sequences of the upstream primer and the downstream primer, respectively.
[0037] 3. Primer design Primers were designed for the molecular marker with a nucleotide sequence as shown in SEQ ID NO: 1, including an upstream primer and a downstream primer. The specific sequences are as follows: Upstream primer: 5'-AAAAGGCGGGTTTTCTTCAT-3' (as shown in SEQ ID NO: 2); Downstream primer: 5'-CTCATCTGTGAATGGGCCTT-3' (as shown in SEQ ID NO: 3).
[0038] 4. Methods for sex identification of Siniperca chuatsi The following was verified using DNA samples extracted from female fish F1 to F5 and male fish M1 to M5 in Zhangjiajie, Hunan: (4.1) PCR amplification reaction system The animal genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd.) was used to extract the genomic DNA of Siniperca chuatsi as a template, and PCR amplification was performed using primers; The PCR amplification reaction system is 25 μL: 2×Taq PCR Master Mix [0.1U Taq DNA Polymerase / mL, 500mmol / L dNTP each, 50mmo1 / L Tris-HC1 (pH 8.7), 20mmol / LKC1, 4mmo1 / LMgC1 2 ]12.5μL; 1μL each of upstream and downstream primers (10μmol / L); Template DNA (50-100 ng) 2 μL; ddH 2 O 8.5μL.
[0039] (4.2) PCR amplification procedure The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 60 s, for a total of 35 cycles; extension at 72°C for 10 min; and storage at 4°C.
[0040] (4.3) Electrophoresis detection The PCR amplification products were tested and analyzed for specificity by 1.0% agarose gel electrophoresis. Figure 1 As shown, Figure 1 The electrophoresis results showed that a specific DNA band of about 921 bp in size could be amplified in all five male Siniperca chuatsi, but not in all five female Siniperca chuatsi, indicating that the molecular marker for identifying the genetic sex of Siniperca chuatsi can be used to identify the sex of Siniperca chuatsi.
[0041] The reliability of the method was confirmed by extracting DNA samples from female fish F1 to F5 and male fish M1 to M5 from Zhangjiajie, Hunan, and finally a molecular marker for identifying the genetic sex of Siniperca chuatsi with a nucleotide sequence as shown in SEQ ID NO: 1 and primers as shown in SEQ ID NO: 2 and SEQ ID NO: 3 were obtained. Example 2
[0042] Application and validation of molecular markers for sex identification of wild populations of Siniperca chuatsi 1. Sexually mature Siniperca chuatsi were obtained from Zhangjiajie, Hunan and Qingyuan, Guangdong. Twenty-four female and 12 male Siniperca chuatsi were obtained by dissection, including 12 female and 12 male Siniperca chuatsi from Zhangjiajie, Hunan and 12 male and 12 female Siniperca chuatsi from Qingyuan, Guangdong. The tail fins were cut off and DNA samples were prepared using an Animal Genomic DNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd.) according to the instructions. The integrity of DNA was identified by 1% agarose gel electrophoresis, and its OD value was measured by UV spectrophotometer and diluted to 50 ng / μL.
[0043] 2. Using the genomic DNA of Siniperca chuatsi in step 1 as a template, PCR amplification was performed using the primers in Example 1. The reaction system and PCR reaction procedure were the same as those in Example 1. The obtained PCR amplification products were subjected to electrophoresis detection and specificity analysis.
[0044] 3. Figure 2 The agarose gel electrophoresis results showed that specific bands could be amplified in all 24 male Siniperca chuatsi, and the size of the amplified product was about 921 bp; male-specific bands could not be amplified in all 24 female Siniperca chuatsi, indicating that the male-specific molecular marker can be used to identify the sex of Siniperca chuatsi. Example 3
[0045] Sexually mature Siniperca chuatsi were purchased from Global Aquatic Products Market in Foshan, Guangdong Province, and 12 males and females were obtained. DNA extraction and sex identification were performed according to Example 2. The results are shown in Table 2. Figure 3 As shown, specific bands were amplified in all 12 male Siniperca chuatsi, and the size of the amplified product was about 921 bp; male-specific bands could not be amplified in all 12 female Siniperca chuatsi, further indicating that the male-specific molecular marker can be used for the identification of the sex of Siniperca chuatsi. Example 4
[0046] This embodiment provides an application of the primers for detecting the molecular markers for identifying the genetic sex of Siniperca chuatsi in embodiment 1 or the method in embodiment 2 to carry out all-female breeding of Siniperca chuatsi, comprising the following steps: (S1) When the spotted mandarin fish fry are cultured to 14 days old, they are continuously immersed in 1 μg / L of the progestin levonorgestrel, and the immersion solution is changed daily. During the culture period, natural light is used, the water temperature is 23-30°C, and palatable bait fish is fed at 8:00, 12:00, and 20:00 every day. The feeding amount should not be too much to keep the fish in a non-satiated state, and the feeding is continued for 45 days; (S2) Using the primers in Example 1 or the method in Example 2 to screen the Siniperca chuatsi soaked in progesterone, fish with genotype XX, i.e., pseudo-male fish, are obtained. The specific process is as described in Example 2.
[0047] (S3) The XX pseudo-male fish identified by the mark is continued to be raised until sexual maturity, and then mated with normal XX female Siniperca chuatsi during the breeding season to obtain all-female Siniperca chuatsi offspring.
[0048] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.
Claims
1. A molecular marker for identifying the genetic sex of Siniperca chuatsi, characterized in that: The nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1, and the molecular marker is a male fish-specific DNA fragment.
2. A method for identifying the genetic sex of Siniperca chuatsi, characterized in that: The following steps are involved: (1) Extracting genomic DNA from Siniperca chuatsi; (2) Using the genomic DNA of step (1) as a template, PCR amplification is performed using primers for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi as described in claim 1, and electrophoresis is performed after the amplification is completed. If the electrophoresis result shows that the amplified product has a specific DNA band, the genetic sex of the detected Siniperca chuatsi is male; if the electrophoresis result shows that the amplified product does not have a specific DNA band, the genetic sex of the detected Siniperca chuatsi is female.
3. The method for identifying the genetic sex of Siniperca chuatsi according to claim 2, characterized in that: The primers in step (2) include an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ ID NO: 2, and the sequence of the downstream primer is shown in SEQ ID NO:
3.
4. The method for identifying the genetic sex of Siniperca chuatsi according to claim 2, characterized in that: If the electrophoresis result in step (2) shows that the amplified product has a specific DNA band of 921 bp in size, the genetic sex of the detected Siniperca chuatsi is male; if the electrophoresis result shows that the amplified product does not have a specific DNA band of 921 bp in size, the genetic sex of the detected Siniperca chuatsi is female.
5. Use of primers for detecting the molecular markers for identifying the genetic sex of Siniperca chuatsi as claimed in claim 1 in preparing a kit for identifying the genetic sex of Siniperca chuatsi.
6. Use of a reagent for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi according to claim 1, a kit comprising primers for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi, or the method for identifying the genetic sex of Siniperca chuatsi according to any one of claims 2 to 4 in identifying the genetic sex of Siniperca chuatsi.
7. Use of a reagent for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi as claimed in claim 1, a kit comprising primers for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi, or a method for identifying the genetic sex of Siniperca chuatsi as claimed in any one of claims 2 to 4 in identifying pseudo-male fish induced by progesterone.
8. Use of a reagent for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi as claimed in claim 1, a kit comprising primers for detecting the molecular marker for identifying the genetic sex of Siniperca chuatsi, or a method for identifying the genetic sex of Siniperca chuatsi as claimed in any one of claims 2 to 4 in all-female breeding of Siniperca chuatsi.
9. The use according to claim 8, characterized in that: The following steps are involved: (S1) Culture of Siniperca chuatsi larvae by immersion in progesterone; (S2) using a reagent for detecting the molecular marker for identifying the genetic sex of the spotted mandarin fish, a kit containing primers for detecting the molecular marker for identifying the genetic sex of the spotted mandarin fish, or the genetic sex identification method to identify pseudo-male fish of the spotted mandarin fish fry, and screening fish with a genetic type of XX, i.e., pseudo-male fish, from the mandarin fish soaked in progesterone; (S3) The XX pseudo-male fish identified by the mark is continued to be raised until sexual maturity, and then mated with normal XX female Siniperca chuatsi during the breeding season to obtain all-female Siniperca chuatsi offspring.