Poultry reticuloendotheliosis virus detection primer, probe, kit and detection method

Abstract

The invention belongs to the technical field of avian reticuloendotheliosis virus detection, and particularly relates to an avian reticuloendotheliosis virus detection primer, a probe, a kit and a detection method. Comprising a primer and a probe, the primer sequence is shown as SEQ ID NO: 1 and SEQ ID NO: 2, and the probe sequence is shown as SEQ ID NO: 3. The primer, the probe and the detection method provided by the invention have the advantages of high sensitivity and specificity, good repeatability, simplicity and convenience in operation, short detection time, small required sample size, minimum detection concentration of 1.77 * 10 copies / mu L, low pollution, cost saving and the like, can be used for directly detecting DNA extracted from an unknown sample, can be complementary with a traditional detection scheme, and can be used for detecting the DNA in the unknown sample. The kit has a high application value in rapid detection of viruses, and provides a basis for clinical diagnosis of REV.

Description

Technical Field

[0001] The invention belongs to the technical field of avian reticuloendothelial disease virus detection, and specifically relates to avian reticuloendothelial disease virus detection primers, probes, kits and detection methods. Background Art

[0002] Reticuloendotheliosis virus (REV) is a common tumor disease in poultry, which mainly causes immunosuppression in chickens. Studies have found that REV can be integrated into fowlpox virus, and the virulence and pathogenicity of the virus are enhanced after integration. Therefore, it is very necessary to invent a nucleic acid detection method for avian reticuloendotheliosis virus. TaqMan probe-based real-time fluorescence PCR detection technology is based on PCR. By designing a specific probe, the reporter group and the fluorescent quencher group are labeled at both ends of the probe. The probe can specifically bind to the template DNA. During the PCR amplification process, the reporter group is cut by the DNA polymerase, releasing a single reporter group, thereby emitting fluorescence, which is monitored by the instrument.

[0003] At present, laboratory detection methods for avian reticuloendotheliosis virus are mostly based on conventional PCR and nucleic acid dye methods. Compared with conventional PCR and nucleic acid dye methods, TaqMan probe method detection reagents have higher specificity and sensitivity. Therefore, it is very necessary to establish a more specific REV nucleic acid detection reagent. Summary of the invention

[0004] The object of the present invention is to provide primers, probes, kits and methods for detecting avian reticuloendotheliosis virus, so as to solve the problems raised in the above-mentioned background technology.

[0005] To achieve the above object, the present invention provides the following technical solution: Avian reticuloendotheliosis virus detection primers and probes, comprising

[0006] The upstream primer sequence of the primer is: 5'-GCCATATTAGCTTCTGTA-3';

[0007] The downstream primer sequence of the primer is: 5'-CCTTCAACAAACATTTCC-3';

[0008] The probe sequence is: 5'-CTGCTCTTGATGCCGATTCC-3'.

[0009] Preferably, the fluorescent reporter group labeled at the 5' end of the probe is FAM, and the fluorescent quencher group labeled at the 3' end is BHQ1.

[0010] A kit for detecting avian reticuloendotheliosis virus, comprising a reagent for detecting the avian reticuloendotheliosis virus as claimed in claim 1.

[0011] Preferably, the reagents include primers and probes.

[0012] A method for detecting avian reticuloendotheliosis virus comprises the following steps:

[0013] The DNA of the sample to be tested is used as a template, and the primers and probes are used to perform fluorescent PCR amplification, and whether the sample to be tested contains avian reticuloendotheliosis virus is determined according to the amplification curve.

[0014] Preferably, the PCR reaction system is 20 μL: 10 μL of 2×HyperProbe Onestep RT-QPCR Kit (UNG), 1-5 μL of template, 0.2 μL to 0.6 μL of primers and probes, and then RNase Free Water is added to make up to 20 μL.

[0015] Preferably, in any of the above schemes, the PCR reaction system is 10 μL of 2×HyperProbe Onestep RT-qPCRKit (UNG), 5 μL of template, 0.5 μL of upstream and downstream primers and probes, 3.5 μL of RNase Free Water, and the total volume of the reaction system is 20 μL.

[0016] Preferably, in any of the above schemes, the PCR reaction procedure is: 37°C, 2 min; reverse transcription, 55°C, 3 min; pre-denaturation, 96°C, 2 min; denaturation, 95°C, 10 sec, annealing / extension, 58°C, 30 sec, 45 cycles.

[0017] Establishment of standard curve: Recombinant plasmid pcDNA3.1-REV was diluted with RNase Free Water at a concentration of 1.0×10-1.0×10 7 The recombinant plasmid was diluted in gradients at 100 copies / μL, and then the diluted recombinant plasmid was used as a template to perform fluorescence quantitative PCR according to the optimized reaction conditions to detect the sensitivity of the method, calculate the linear regression line equation and its correlation coefficient, and draw a standard curve.

[0018] The standard curve is: y = -3.807x + 42.11, the correlation coefficient R 2 =0.9954; the lowest detection concentration is: 1.77×10 copies / μL.

[0019] The specific primer amplified sequence was 5′-GCCATATTAGCTTCTGTAATCATGCTTGCTTGCCTTAG CCGCCATTGTACTTGATATATTTCGCTGATATCATTTCTCGGAATCGGCATCAAGAG CAGGCTCATAAACCATAAAAGGAAATGTTTGTTGAAGG-3′, with a length of 133 bp.

[0020] Technical effects and advantages of the present invention: The detection method provided by the present invention has the advantages of high sensitivity and specificity, good repeatability, simple operation, short detection time, small sample amount required, minimum detection concentration of 1.77×10 copies / μL, low pollution, cost saving, etc. It can directly detect DNA extracted from unknown samples, can be complementary to traditional detection schemes, has high application value in rapid virus detection, and provides a basis for the clinical diagnosis of REV. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a standard curve diagram in the embodiment;

[0022] Figure 2 This is a diagram of the real-time fluorescence PCR amplification result of the sensitivity test in the embodiment;

[0023] Figure 3 This is a graph showing the results of real-time fluorescence PCR amplification in a specific test in the example. DETAILED DESCRIPTION

[0024] The specific embodiments of the present invention are further described below in conjunction with the accompanying drawings. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0025] Example:

[0026] 1. Main instruments and reagents

[0027] 2×HyperProbe Onestep RT-qPCR Kit (UNG) and RNase-Free Water were purchased from Kangwei Reagent Biotechnology Co., Ltd., Newcastle disease (NDV) and infectious bronchitis vaccines were purchased from Keqian Biological, infectious bursal virus (IBDV) vaccine and Marek's (MDV) vaccine were purchased from Harbin Pharmaceutical Group Biological Vaccine Co., Ltd., and viral DNA / RNA extraction kits, fully automatic nucleic acid extractors, and fully automatic PCR analysis systems were purchased from Xi'an Tianlong Technology Co., Ltd.

[0028] The gene sequence of the positive plasmid standard is derived from the 70-202 region of the REV LTR gene (GenBank NO: FJ496333.1). The standard was synthesized by Nanjing Qingke Biotechnology Co., Ltd. The specific sequence is:

[0029] GCCATATTAGCTTCTGTAATCATGCTTGCTTGCCTTAGCCGCCATTGTACTTGAT ATATTTCGCTGATATCATTTCTCGGAATCGGCATCAAGAGCAGGCTCATAAACCATA AAAGGAAATGTTTGTTGAAGG.

[0030] Upstream primer REV-F: GCCATATTAGCTTCTGTA (SEQ ID NO: 1);

[0031] Downstream primer REV-R: CCTTCAACAAACATTTCC (SEQ ID NO: 2);

[0032] Probe REV-P: CTGCTCTTGATGCCGATTCC (SEQ ID NO: 3).

[0033] All of the above were synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0034] 2. Kit composition:

[0035] 2×HyperProbe Onestep RT-qPCR Kit (UNG), upstream primer REV-F, downstream primer REV-R, probe REV-P, template DNA and RNase Free Water.

[0036] 3. The testing process can be as follows:

[0037] Take tissue samples from chickens and extract viral nucleic acid using a DNA / RNA extraction kit and a fully automatic nucleic acid extractor;

[0038] Preparation of positive standards:

[0039] The amplified fragment was analyzed using Primer Premier 5.0, and restriction sites were selected and cloned into the vector pcDNA3.1(+) using EcoR I and Kpn I as restriction sites. The recombinant plasmid pcDNA3.1-REV was synthesized by Nanjing Qingke Biotechnology Co., Ltd. and used as the positive control plasmid.

[0040] PCR amplification was performed with the following steps: 37°C, 2 min; reverse transcription, 55°C, 3 min; pre-denaturation, 96°C, 2 min; denaturation, 95°C, 10 sec; annealing / extension, 58°C, 30 sec; 45 cycles of annealing / extension, 58°C, 30 sec.

[0041] Establish a standard curve: Use RNase Free Water to dilute the recombinant plasmid pcDNA3.1-REV at a concentration of 1.0×10-1.0×10 7 The recombinant plasmid was then used as a template for gradient dilution, and fluorescence quantitative PCR was performed according to the optimized reaction conditions to detect the sensitivity of the method, calculate the linear regression line equation and its correlation coefficient, and draw a standard curve. Figure 1 As shown, the standard curve is: y = -3.807x + 42.11, the correlation coefficient R 2 =0.9954, which has a good linear relationship.

[0042] The test results need to be judged based on the amplification results and amplification curve of the positive control (or internal standard of the test tube) set in the reaction system and the deionized water without RNA hydrolase as the negative control.

[0043] Determination of invalid results: If the test sample is negative, the positive control of the reaction system (or the internal standard of the test tube) must be positive, otherwise the test tube result is invalid and needs to be retested.

[0044] Sensitivity: The heavy standard was adjusted to 1.0×10~1.0×10 7 The diluted recombinant plasmid was then used as a template to perform fluorescence quantitative PCR according to the optimized reaction conditions. A blank control group was set up to observe the amplification curve and determine the minimum detection limit. Figure 2 As shown in the figure, the minimum copy number detected by this method is 1.77×10 copies / μL, which has high sensitivity.

[0045] Specificity: chicken tissue DNA, avian reticuloendotheliosis virus nucleic acid, chicken Newcastle disease virus nucleic acid, infectious bronchitis virus nucleic acid, Marek's disease virus nucleic acid, and chicken infectious bursal disease virus nucleic acid were obtained for fluorescent PCR, and nuclease-free water was set as a negative control and a standard plasmid as a positive control to detect the specificity of primers and probes. The results are as follows Figure 3As shown, only REV nucleic acid was amplified, while chicken tissue DNA, Newcastle disease, infectious bronchitis, Marek's, and infectious bursal disease nucleic acids were not amplified, indicating that this primer and probe have good specificity.

[0046] Stability: 1.0×10 3 ~1.0×10 7 The positive control plasmid with 100 copies / μL was used as the template and double distilled water as the negative control. Each gradient was repeated 3 times and the repeatability was detected by fluorescence quantitative PCR again to calculate the coefficient of variation.

[0047] The results are shown in the following table:

[0048]

[0049] It can be seen that the primer and probe sequences of the present invention have good sensitivity, specificity and repeatability.

[0050] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments or to make equivalent substitutions for some of the technical features therein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

[0051] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. Avian reticuloendotheliosis virus detection primer, characterized in that: include The upstream primer sequence of the primer is: 5'-GCCATATTAGCTTCTGTA-3'; The downstream primer sequence of the primer is: 5'-CCTTCAACAAACATTTCC-3'.

2. A probe for detecting avian reticuloendotheliosis virus, characterized in that: include The probe sequence is: 5'-CTGCTCTTGATGCCGATTCC-3'.

3. The avian reticuloendotheliosis virus detection probe according to claim 2, characterized in that: The fluorescent reporter group labeled at the 5' end of the probe is FAM, and the fluorescent quencher group labeled at the 3' end is BHQ1.

4. A kit for detecting avian reticuloendotheliosis virus, characterized in that: The invention comprises a reagent for detecting the avian reticuloendotheliosis virus as claimed in any one of claims 1 to 3.

5. The avian reticuloendotheliosis virus detection kit according to claim 4, characterized in that: The reagents include the primers and probes as described in claims 1 and 2.

6. A method for detecting avian reticuloendotheliosis virus, characterized in that: The following steps are involved: Using the DNA of the sample to be tested as a template, the primers and probes as described in claims 1 and 2 are used to perform fluorescent PCR amplification, and judging whether the sample to be tested contains avian reticuloendotheliosis virus according to the amplification curve.

7. The method for detecting avian reticuloendotheliosis virus according to claim 6, characterized in that: The PCR reaction system is 20 μL: 2×HyperProbe Onestep RT-QPCR Kit 10 μL, template 1-5 μL, set 0.2 μL to 0.6 μL primer and probe dosage, and then add RNase Free Water to make up to 20 μL.

8. The method for detecting avian reticuloendotheliosis virus according to claim 7, characterized in that: The PCR reaction system is: 2×HyperProbe Onestep RT-qPCR Kit 10 μL, template 5 μL, primers and probes 0.5 μL each, RNase Free Water 3.5 μL, and the total volume of the reaction system is 20 μL.

9. The method for detecting avian reticuloendotheliosis virus according to claim 6, characterized in that: The PCR reaction program is: 37°C, 2 min; reverse transcription, 55°C, 3 min; pre-denaturation, 96°C, 2 min; denaturation, 95°C, 10 sec, annealing / extension, 58°C, 30 sec, 45 cycles.

Images