Rice tillering related protein as well as coding gene and application thereof
By studying the RCN127 protein and its coding genes in rice, and using gene editing and transgenic technology to regulate its expression, the problem of low tillering and nitrogen utilization rate in rice was solved, and the effect of improving rice yield and quality was achieved.
Patent Information
- Application Number
- CN202411363788.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-28
- Publication Date
- 2025-02-28
AI Technical Summary
The prior art is difficult to effectively regulate the tillering and nitrogen utilization of rice, affecting rice yield and quality.
By discovering and studying the RCN127 protein and its encoding genes in rice, the expression of RCN127 gene is regulated by using gene editing and transgenic technology to improve the tiller number and nitrogen utilization rate of rice.
Through the overexpression of the RCN127 gene, the tiller number of rice is significantly increased, thereby improving the yield and quality of rice, and providing the possibility of adjusting plant plant type and population structure.
Smart Images
Figure HDA0005065604630000011 
Figure HDA0005065604630000012
Abstract
Description
Technical Field
[0001] The invention relates to the field of plant genetic engineering, and in particular to a rice tillering and nitrogen utilization related protein and a coding gene and application thereof. Background Art
[0002] Rice is one of the main food crops in the world, and more than half of the world's population relies on rice as their staple food. With the increasing population and the continuous reduction of available arable land, increasing grain yield has become an important way to ensure my country's food security. Rice yield is a complex trait, which is mainly determined by three yield factors (number of panicles, number of grains per panicle, and thousand-grain weight). Tillering is a unique branching phenomenon formed during the growth and development of rice. The number of tillers directly determines the number of panicles, which in turn directly affects the rice plant type and grain yield. During the tillering period of rice, promoting rice tillering and increasing the number of effective tillers will lay the foundation for increasing yield. At the same time, nitrogen is the basis for the formation of rice yield and quality, and it is also the element with the greatest demand during rice growth. Improving the nitrogen utilization rate of rice can reduce fertilizer input and reduce environmental pollution. Therefore, the study of rice tillering and nitrogen utilization rate is of great significance.
[0003] Ubiquitination is a very important protein post-translational modification process in eukaryotic cells. The ubiquitination pathway is completed through a cascade reaction of three enzymes: E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme and E3 ubiquitin ligase. E3 ubiquitin ligase determines the specific recognition of target proteins and plays an important role in the ubiquitin pathway. The SCF complex is the largest class of E3 ligases. The SCF complex is composed of SKP1, CUL1, RBX1 and F-box proteins. The F-box protein is responsible for substrate binding specificity and mediates the ubiquitination degradation of the target protein. At present, there are relatively few reports on F-box regulating tillering and nitrogen utilization in rice. Summary of the invention
[0004] One object of the present invention is to provide a rice tillering-related protein and its encoding gene and application.
[0005] The protein provided by the present invention is named RCN127 protein, which is derived from rice (Oryza sativa) and is as follows (a) or (b):
[0006] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO.2;
[0007] (b) a protein derived from the amino acid sequence shown in SEQ ID NO.2 by substitution and / or deletion and / or addition of one or more amino acid residues, which has the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.2;
[0008] (c) a protein that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the sequence defined in (a) and has the same function.
[0009] The present invention also provides a gene encoding the protein.
[0010] Specifically, the gene is a DNA molecule as shown in SEQ ID NO.1.
[0011] The present invention further provides an expression cassette, a recombinant vector, a transgenic cell line or a recombinant bacterium containing the gene.
[0012] The recombinant vector is as follows 1) or 2):
[0013] 1) A recombinant vector obtained by inserting the gene into the AraI recognition site of the pCLCSGHSRL2-2 vector;
[0014] 2) A recombinant vector obtained by inserting the gene between the KpnI and BamHI recognition sites of the 1300-Flag vector.
[0015] The invention also provides the gene of the protein and the use of the gene in cultivating transgenic plants. Specifically, the number of tillers per plant of the transgenic plant is less than or more than that of the target plant.
[0016] The present invention further provides a method for cultivating transgenic plants, which is to introduce the gene into a target plant to obtain a transgenic plant; the number of tillers per plant of the transgenic plant is greater than that of the target plant.
[0017] Specifically, the recombinant vector is introduced into the target plant.
[0018] More specifically, the target plant is a dicotyledonous or monocotyledonous plant; more specifically, rice.
[0019] The present invention provides a method for cultivating transgenic plants, which comprises knocking out or weakening the gene in the plant to obtain the transgenic plant, and the number of tillers per plant of the transgenic plant is less than that of the target plant;
[0020] The knockout is a gene editing method, and the target plant is a dicotyledonous or monocotyledonous plant; more specifically, rice.
[0021] The experiment of the present invention proves that the present invention reversely knocks out the RCN127 gene and obtains a mutant with few tillers. The RCN127 gene is overexpressed by transgenic technology to obtain transgenic rice with significantly increased tillers, proving that the RCN127 gene can effectively increase the number of rice tillers, and it is possible to use the RCN127 gene to adjust the plant type and form a reasonable plant population structure, which can improve the yield and quality of crops per unit area of arable land. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Phenotype and tiller number of transgenic rice with homozygous mutant of RCN127 gene knockout.
[0023] Figure 2 Phenotype and tiller number of transgenic rice overexpressing RCN127. DETAILED DESCRIPTION
[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0025] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0026] Agrobacterium tumefaciens EHA105 is described in New Agrobacterium helper plasmids for gene transfer to plants. Hood, Elizabeth E; Gelvin, Stanton B; Melchers, Leo S; Hoekema, Andre. Transgenic Research, 2(4): p. 208-218-218 (1993). It is publicly available from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences.
[0027] Cultivation conditions of rice materials: Rice seeds were soaked in water for 3 days and then sown on the seedbed. Rice seedlings at the 4-leaf stage were transplanted into paddy fields and planted individually.
[0028] Example 1. RCN127 protein and its encoding gene
[0029] In the reverse knockout offspring of the japonica rice variety Nipponbare, it was found that a target gene function was lost, resulting in a phenotype of dwarf plants and significantly reduced tillering. In this rice mutant, sequencing revealed that the DNA molecule shown in SEQ ID NO.3 corresponding to the target gene had a base deletion, resulting in premature translation termination, indicating that the phenotype of reduced tillering in the mutant was caused by the mutation of the target gene. Therefore, the RCN127 protein and its encoding gene were further studied. Among them, the amino acid sequence of the RCN127 protein is the protein shown in SEQ ID NO.2; the nucleotide sequence of its encoding sequence is shown in SEQ ID NO.1.
[0030] Example 2: Construction of knockout vector
[0031] 1. Obtaining recombinant expression vector
[0032] The small fragment between the AarI recognition sequences of the pCLCSGHSRL2-2 vector was replaced with the DNA molecule shown in SEQ ID NO.3 to obtain a recombinant vector, and the recombinant vector with correct sequencing was marked as pCLCSGHSRLL2-2-RCN127.
[0033] 2. Obtaining Nipponnbare Rice
[0034] The recombinant vector obtained above was transferred into Agrobacterium tumefaciens EHA105 by heat shock method to obtain recombinant bacteria. The recombinant bacteria containing the plasmid were named EHA105 / pCLCSGHSRLL2-2-RCN127.
[0035] The mature seeds of rice (Oryza sativa) Nipponbare were dehulled and sterilized, and inoculated into a callus induction medium. After 3 weeks of culture, callus tissue grew from the scutellum, and embryonic calli with vigorous growth, light yellow color, and relatively loose were selected and used as the recipients for transformation.
[0036] The embryonic callus was infected with the EHA105 / pCLCSGHSRLL2-2-RCN127 obtained above, and after culturing at 25°C in the dark for 3 days, resistant callus and transgenic plants were selected on a selection medium containing 50 mg / L hygromycin. Hygromycin-resistant plants were hardened in a cool place and transplanted to paddy fields a few days later to obtain T0 generation rice.
[0037] Using Hyg-Phe (5'-TACTCATCCATGCATGCAA') and Hyg-R (5'-ATCTGGTGTGTCATGTGTGGGT-3') as primers, PCR amplification was performed on the T0 generation RCN127 rice (Nipponbare) to obtain a target fragment of 1665 bp in size. Sequencing with primer 3-R (CGGTACGGCGTGTTGATGCC) revealed Indel differences compared with the Nipponbare sequence, indicating that the RCN127 gene was edited.
[0038] Seeds were harvested from the positive T0 knockout rice and sown to obtain T1 seeds. The T1 mutants were compared with the wild-type Nipponbare to observe the phenotype. Figure 1 As shown, rcn127 is a mutant, and 1 and 2 are two families with different editing methods. Figure 1 It can be seen that the T1 generation knockout rice mutant has reduced tillering and lower plant height.
[0039] Example 3: RCN127 overexpression in rice increases tillering of receptor material
[0040] 1. Obtaining recombinant expression vector
[0041] The small fragment between the KpnⅠ and BamHI recognition sequences of the 1300-Flag vector is replaced with the double-stranded DNA molecule shown in SEQ ID NO.1 to obtain a recombinant vector, and the correctly sequenced recombinant vector is recorded as 1300-Flag-RCN127. 1300-Flag-RCN127 contains the DNA fragment shown in SEQ ID NO.1 and the constitutive promoter CAMV35S of the cauliflower mosaic virus, and can express the RCN127 protein shown in SEQ ID NO.2. The expression of the protein is driven by the constitutive promoter CAMV35S of the cauliflower mosaic virus.
[0042] 2. Obtaining RCN127 overexpressing rice
[0043] 1300-Flag::RCN127 was transferred into Agrobacterium tumefaciens EHA105 by heat shock to obtain recombinant bacteria. Mature seeds of rice (Oryza sativa) Nipponbare were dehulled and sterilized, and inoculated into callus induction medium. After 3 weeks of culture, callus tissue grew from the scutellum, and embryonic callus with vigorous growth, light yellow color, and relatively loose was selected as the recipient for transformation.
[0044] The embryonic callus was infected with the 1300-Flag::RCN127 obtained above, and after culturing at 25°C in the dark for 3 days, resistant callus and transgenic plants were selected on a selection medium containing 50 mg / L hygromycin. Hygromycin-resistant plants were hardened in a cool place and transplanted to paddy fields a few days later to obtain T0 generation RCN127 overexpressing rice.
[0045] Using 1300-Flag (5'-CCACTATCCTTCGCAAGACC-3') and 3-R as primers, PCR amplification was performed on T0 generation RCN127 overexpressing rice to obtain a 470 bp target fragment, indicating that the RCN127 gene was transferred. A total of 10 positive T0 generation RCN127 overexpressing rice were obtained.
[0046] 3. Functional study of RCN127 overexpressing rice
[0047] Positive T2 generation RCN127 overexpressing rice lines numbered 1 and 2 were selected and planted in paddy fields in May and grown under natural conditions. Nipponbare was used as a control. Fifteen plants were selected from each line and the results were averaged.
[0048] The number of tillers per plant was counted, and the results were as follows: Figure 2 As shown. Figure 2 It can be seen that
[0049] The number of tillers per plant of T2 transgenic RCN127 rice (OE1) numbered 1 was 12.3;
[0050] The number of tillers per plant of T2 transgenic RCN127 rice (OE2) numbered 2 was 13.9;
[0051] The number of tillers per plant in WT was 9.4;
[0052] As can be seen from the figure, compared with the wild-type Nipponbare, the number of tillers per plant in the T2 generation RCN127 overexpressing rice is significantly increased, thereby promoting the increase in rice yield.
Claims
1. A protein which is (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO.2; (b) a protein derived from the amino acid sequence shown in SEQ ID NO.2 by substitution and / or deletion and / or addition of one or more amino acid residues, which has the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.2; (c) a protein that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the sequence defined in (a) and has the same function.
2. A gene encoding the protein as claimed in claim 1.
3. The gene according to claim 2, characterized in that: The gene is a DNA molecule as shown in SEQ ID NO.
1.
4. An expression cassette, recombinant vector, transgenic cell line or recombinant bacterium containing the gene according to claim 2 or 3.
5. The recombinant vector according to claim 4, characterized in that: The recombinant vector is as follows 1) or 2): 1) Inserting the gene described in claim 2 or 3 into the pCLCSGHSRL2-2 vector Ara I recognition site obtained recombinant vector; 2) The gene of claim 2 or 3 is inserted into a 1300-Flag vector Kpn I and Bm I recognition site obtained between the recombinant vector.
6. Use of the gene of the protein according to claim 1, or the gene according to claim 2 or 3 in cultivating transgenic plants, specifically, the number of tillers per plant of the transgenic plant is less than or more than that of the target plant.
7. A method for cultivating transgenic plants, characterized in that: The gene of claim 2 or 3 is introduced into a target plant to obtain a transgenic plant; the number of tillers per plant of the transgenic plant is greater than that of the target plant.
8. The method according to claim 7, characterized in that: The gene described in claim 2 or 3 is introduced into the target plant via the recombinant vector described in claim 5.
9. The method according to claim 7 or 8, characterized in that: The target plant is a dicotyledonous or monocotyledonous plant; more specifically, rice.
10. A method for cultivating transgenic plants, characterized in that: The gene of claim 2 or 3 in the plant is knocked out or weakened in reverse order to obtain the transgenic plant, and the number of tillers per plant of the transgenic plant is less than that of the target plant; The knockout is a gene editing method, and the target plant is a dicotyledonous or monocotyledonous plant; more specifically, rice.