New acremonium spp. Strain and application thereof

Abstract

The invention belongs to the technical field of fermentation of wine-making microorganisms, and particularly relates to a new acremonium spp. Strain capable of producing multiple enzymes and application of the new acremonium spp. Strain. In order to enrich beneficial microorganisms in a white spirit brewing environment and comprehensively evaluate the enzyme production property of a single strain and the flavor property produced in wine brewing fermentation, the invention provides an acremonium implicatum bacterium with the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.41535. The acremonium implicatum bacterium has the advantages that the preservation number is CGMCC No.41535; the enzyme production property of the strain is discussed on culture media of bran, pure wheat and sterilized wheat, the strain takes three different types of substances as substrates, various hydrolases with higher content can be produced, flavor substances related to flavor components of white spirit can be produced, and particularly, five-grain powder is taken as a substrate, and the strain is inoculated, so that the flavor components of white spirit can be produced. 64 volatile flavor substances are detected in total. Therefore, the strain is favorable for improving the brewing quality of the white spirit, and has a certain application prospect in the brewing of the white spirit.

Description

Technical Field

[0001] The invention belongs to the technical field of wine brewing microbial fermentation, and particularly relates to a new strain of Sarocladium implicatum capable of producing multiple enzymes and a use thereof. Background Art

[0002] Daqu is a saccharifying and fermenting agent in the production process of liquor, and its quality directly affects the quality of liquor. The production of Daqu is highly dependent on the environment. After long-term natural screening, Daqu is rich in a wide variety of microorganisms with stable species, which can provide complex and diverse enzymes, flavor precursors and microbial communities for the grain fermentation process. Therefore, Daqu is a carrier of rich enzyme systems, and the types of microorganisms and enzyme-producing properties further affect the quality of Daqu. At present, there are studies focusing on the separation, screening and identification of functional microorganisms to analyze the core functional microbial community of Daqu. By inoculating relatively stable microbial communities, the physical and chemical properties of Daqu (such as saccharification power, esterification power and liquefaction power, etc.) can reach a certain upper limit, thereby regulating the functional expression and aroma formation of Daqu.

[0003] Sarocladium implicatum belongs to the Fungi, Ascomycota, Hypocreales, Sarocladiaceae, Sarocladium in taxonomy. At present, there are reports on the use of Sarocladium in pepper and rice production environments, and it has plant disease resistance. However, there are few reports in the field of liquor brewing, especially in the field of Daqu production.

[0004] At the same time, the content of hydrolases such as α-GC, β-GC, α-GAL, and β-GAL has been proven to be extremely important for the quality of Daqu, and is also an enzyme system widely involved in the process of liquor brewing. At present, there are many reports on related enzymes in Daqu based on the macro-omics level, but there are no reports on the enzyme production properties and flavor formation of single microorganisms in Daqu. Summary of the invention

[0005] In order to enrich the beneficial microorganisms in the liquor brewing environment and comprehensively evaluate the enzyme production properties of a single strain and the flavor properties produced during wine fermentation, the present invention provides a Sarocladium implicatum that produces multiple enzymes and flavor substances.

[0006] In order to achieve the above application purpose, the technical solution adopted by the present invention is as follows:

[0007] In the first aspect, the present invention provides a strain of Sarocladium implicatum, which has a deposit number of CGMCC No. 41535. The strain was deposited on October 11, 2024; the deposit location is: China General Microbiological Culture Collection Center (CGMCC), address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Sarocladium implicatum.

[0008] The nucleotide sequence of the ITS rRNA of the above-mentioned Acremonium affine is shown in SEQ ID NO:1.

[0009] SEQ ID NO: 1 Nucleotide sequence of ITS rRNA of Acremonium affine

[0010] .

[0011] Among them, the morphological characteristics of the above-mentioned Acremonium interdigitatingii are: the hyphae are non-septate, the conidia are oblong, and there are no chains; the colonies are black and white, with a velvety texture, and the edges are irregular and diffuse.

[0012] Among them, the enzyme production characteristics of the bran prepared by the above-mentioned Acremonium crossbredum are: at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0013] Among them, the enzyme production characteristics of the Daqu prepared by the above-mentioned Acremonium crossbredum are: at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0014] Among them, the enzyme production characteristics of the enhanced Daqu prepared by the above-mentioned Acremonium crossbredum are: at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0015] In a second aspect, the present invention provides a microbial agent containing the above-mentioned Acremonium affine.

[0016] In a third aspect, the present invention provides use of the above-mentioned Acremonium corytae or microbial agent in liquor brewing.

[0017] Wherein, the liquor is at least one of sauce-flavor type, strong-flavor type, light-flavor type or rice-flavor type.

[0018] In a fourth aspect, the present invention provides use of the above-mentioned Acremonium alternifolium or microbial agent in preparing bran koji, daqu, fortified daqu or fermented grains.

[0019] Wherein, the Acremonium crossbranchii or microbial agent can metabolize to produce hydrolase, and the hydrolase is at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0020] In a fifth aspect, the present invention provides use of the above-mentioned Acremonium corytae or microbial agent in producing wine-making flavor substances.

[0021] The flavor substances include phenylethyl alcohol, methyl palmitate, caproic acid, 4-vinyl-2-methoxyphenol, methyl oleate, 2,4-di-tert-butylphenol, ethyl acetate, ethyl oleate, ethyl palmitate, methyl linoleate, benzaldehyde, acetic acid, methyl myristate, phenylethyl acetate, p-hydroxystyrene, isovaleric acid, isobutyl alcohol, isobutyric acid, octanoic acid, furfuryl alcohol, methyl caproate, n-nonanoic acid, 1-octen-3-ol, n-hexanol, palmitic acid, ligustrazine, 2,3,5-trimethylpyrazine, 2-pentanone, heptanoic acid, acetone, ethyl hexanoate, 4-methylvaleric acid, n-decanol, 2-acetylfuran, dipropylene glycol, At least one of 2-propyl-1-pentanol, benzoic acid, 2-heptanone, phenol, 2-methylpyrazine, methyl 10-undecenoate, isovaleraldehyde, n-valeric acid, methyl butyrate, ethyl butyrate, 3-hydroxy-2-butanone, phenylethyl alcohol, methyl isobutyrate, dimethyl carbonate, pyrazine, pentyl formate, 2-(2-hydroxypropoxy)-1-propanol, 3-methyl-3-butene-1-ol, isobutyl acetate, 2,5-dimethylpyrazine, n-butanol, 4-cyclopentene-1,3-dione, 2,3-butanedione, methyl 2-methylbutyrate, phenylacetic acid, methyl acetate, γ-caprolactone, 2,3-pentanedione or p-hydroxybenzaldehyde.

[0022] Wherein, the flavor substance is obtained by fermenting the above-mentioned Acremonium crossbranchii or microbial agent in potato glucose liquid culture medium or five-grain flour.

[0023] Beneficial effects: The present invention isolates and screens a Sarocladium implicatum WLY-WMCC30133 from the production environment of Luzhou-flavor Daqu, and its preservation number is CGMCC No.41535. The enzyme production properties of the strain were studied on the culture medium of bran, pure wheat and sterilized wheat. The strain can produce a variety of high-content hydrolases with 3 different types of substances as substrates, and generate flavor substances related to the flavor components of liquor. In particular, when the strain is inoculated with five-grain powder as a substrate, 64 volatile flavor substances are detected. Among them, the substances with higher contents include: phenylethanol (73.38μg / L), methyl palmitate (44.68μg / L), hexanoic acid (13.48μg / L), 2,4-di-tert-butylphenol (10.93μg / L), etc. These substances have a certain effect on the flavor of liquor. Among them, phenylethanol is mostly rose fragrance, rose fragrance, pollen fragrance, etc.; when the caproic acid content is high, it will present sour smell, sweet fragrance, fruit fragrance, etc., which helps to enrich the body of the wine. Therefore, this strain is conducive to improving the brewing quality of liquor and has a certain application prospect in the brewing of liquor. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1A phylogenetic tree constructed based on the Neighbor-Joining method of the ITS sequence of the Acremonium spp. strain WLY-WMCC30133 of the present invention;

[0025] Figure 2 This is a microscopic morphology of the Acremonium spp. strain WLY-WMCC30133 of the present invention;

[0026] Figure 3 This is a colony morphology diagram of the Acremonium spp. strain WLY-WMCC30133 of the present invention;

[0027] Figure 4 This is a diagram showing the results of enzyme production in bran koji prepared on bran culture medium by the Acremonium spp. strain WLY-WMCC30133 of the present invention;

[0028] Figure 5 This is a diagram showing the results of enzyme production by preparing Daqu on pure wheat culture medium using the Acremonium spp. strain WLY-WMCC30133 of the present invention;

[0029] Figure 6 This is a diagram showing the results of simulating and enhancing enzyme production of Daqu by the Acremonium solani WLY-WMCC30133 of the present invention.

[0030] The Sarocladium implicatum strain of the present invention has a deposit number of CGMCC No. 41535. The strain was deposited on October 11, 2024; the deposit location is: General Microbiology Center of China Microbiological Culture Collection Administration Committee (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Sarocladium implicatum. DETAILED DESCRIPTION

[0031] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clear, the present application is further described in detail below in combination with the implementation methods. Unless otherwise defined, all scientific and technological terms used herein have the same meanings as understood by ordinary technicians in the field.

[0032] The enzymes and abbreviations appearing in the present invention are as follows: α-glucosidase (EC 3.2.1.20 abbreviated as α-GC), β-glucosidase (EC 3.2.1.21 abbreviated as β-GC), α-galactosidase (EC 3.2.1.22 abbreviated as α-GAL), β-galactosidase (EC 3.2.1.23 abbreviated as β-GAL), N-acetyl-β-glucosidase (EC 3.2.1.52 abbreviated as NAG), carboxylesterase (EC 3.1.1.1 abbreviated as CarE), alkaline protease (EC 3.4.4.16 abbreviated as AKP), acid protease (EC3.4.23.18 abbreviated as ACP), neutral protease (abbreviated as NP), lipase (EC 3.1.1.3 abbreviated as LPS), β-glucuronidase (EC 3.2.1.31 abbreviated as β-GD), saccharifying enzyme (EC 3.2.1.52 abbreviated as NAG), 3.2.1.3), exo-β-1,4-glucanase / cellobiosidase (EC 3.2.1.91 abbreviated as C1), α-L-arabinofuranosidase (EC 3.2.1.55 abbreviated as α-L-Af), β-xylosidase (EC 3.2.1.37), cellulase (EC 3.2.1.4 abbreviated as CL), α-amylase (EC 3.2.1.1 abbreviated as α-AL), β-amylase (EC 3.2.1.2 abbreviated as β-AL), pectinase, plant sucrase (EC 3.2.1.26 abbreviated as P-SC), polygalacturonase (EC 3.2.1.15 abbreviated as PG), acyltransferase (EC 2.3.1.- abbreviated as AAT).

[0033] In one embodiment of the present invention, a Sarocladium implicatum strain is provided, and its deposit number is CGMCC No.41535. The strain was deposited on October 11, 2024; the deposit location is: China General Microbiological Culture Collection Center (CGMCC), address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Sarocladium implicatum. It was screened and isolated from the koji making environment of Wuliangye Co., Ltd. in Yibin, and its biological characteristics are: mycelium is non-septate, conidia are oblong, and there is no chain; the colony is black and white, the texture is fluffy, and the edges are irregular and diffuse.

[0034] Among them, the nucleotide sequence of ITS rRNA of Acremonium crossbranchii WLY-WMCC30133 described in the present invention is shown as SEQ ID NO:1.

[0035] In one embodiment of the present invention, the Acremonium crossbranch is used to prepare bran on a bran culture medium, which can metabolize and produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0036] In one embodiment of the present invention, the Daqu prepared by Acremonium crossbranch can produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0037] In one embodiment of the present invention, the Acremonium crossbranch is used to prepare enhanced Daqu, which can produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0038] In one embodiment of the present invention, the Acremonium crossbranchingensis is subjected to liquid static fermentation with potato glucose and five-grain flour to simulate cellar fermentation. Under the fermentation conditions, 64 flavor substances such as phenylethanol, methyl palmitate, hexanoic acid, and 2,4-di-tert-butylphenol can be produced. The production of its flavor metabolites indicates that it has a certain role in winemaking and enriches the microbial sources for liquor brewing.

[0039] Specific examples will be listed below to explain the scheme of the present invention. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in this area or the product instructions are used. Reagents or instruments used that do not indicate manufacturers are all conventional products that can be obtained commercially.

[0040] Example 1 Strain Screening

[0041] 1. Initial screening of strains

[0042] Materials: Qu making environment of Wuliangye Yibin Co., Ltd.

[0043] Culture medium: Potato dextrose agar (PDA): a commercial synthetic culture medium purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021052. Potato dextrose liquid culture medium: a commercial synthetic culture medium purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053.

[0044] 2. Test methods:

[0045] The koji making environment of Yibin Wuliangye Co., Ltd. was selected, and the FKC-1 type floating bacteria sampler of Zhejiang Sujing Purification Equipment Co., Ltd. was used. The sampler was 80 cm above the ground, and the malt agar plate with a diameter of 9 cm was placed in the sampler. Three parallels were set each time, the air flow rate was 100L / min, and the sampling time was 1min. Then the plate was inverted and cultured in a 28℃ incubator for 3-4 days; after the colonies grew out, single mold colonies with different colony morphology were selected in PDA medium, numbered and streaked for purification, and the purification was repeated 2 to 3 times until the colonies on the plate were all in the same morphology. Single colonies were picked to make water-immersion slides, and the bacterial cell morphology was observed under a microscope. After separation and purification, the inclined test tubes were stored in a 4℃ refrigerator.

[0046] Example 2 Morphological identification of Acremonium affine of the present invention

[0047] Newly activated bacteria were used in each of the following tests. A small amount of bacteria was inoculated into PDA medium and cultured at 28°C for 3-5 days.

[0048] Colony and bacterial morphology observation:

[0049] The activated Acremonium spp. was inoculated onto the PDA medium using an inoculation loop, cultured at 28° C. for 5-7 days, and the colony morphology was observed; a small amount of bacteria was picked up with an inoculation needle, and the bacterial morphology was observed under a microscope.

[0050] Observation results of the fungus: hyphae without septa, conidia oblong, without chains. Figure 2 shown.

[0051] Colony observation results: The colonies are black and white, with a fluffy texture, and irregular and spreading edges. Figure 3 shown.

[0052] Example 3 Molecular Biological Identification of Acremonium affine of the Present Invention

[0053] The genomic DNA of the strain was extracted and amplified with the forward primer ITS1, SEQ ID NO:2: TCCGTAGGTGAACCTGCGG and ITS4, SEQ ID NO:3: TCCTCCGCTTATTGATATGC using the ITS universal primer. The reaction conditions were: 94℃ pre-denaturation for 4min followed by the following cycle: 94℃ denaturation for 45s, 55℃ annealing for 45s, 72℃ extension for 60s, 30 cycles; 72℃ extension for 10min. The results of 2% agarose gel electrophoresis were good. The PCR amplification product was sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing results were compared with the BLAST sequence on the NCBI database. Combined with the analysis of colony morphology, bacterial characteristics, and ITS rDNA gene sequence, it was determined to be Sarocladium implicatum and named WLY-WMCC30133. The strain was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration Committee on October 11, 2024, with the deposit number CGMCC No.41535, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. Its biological characteristics are: hyphae without septa, conidia oblong, without chain; colonies are black and white, with fluffy texture, irregular edges and spread.

[0054] Example 4 Enzyme production properties of strain WLY-WMCC30133 of the present invention

[0055] Culture medium: Activated culture medium: Commercial synthetic culture medium, purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053;

[0056] Bran medium: 10 g bran, 8 mL distilled water, stir to mix, and sterilize at 121°C for 20 min;

[0057] Pure wheat culture medium: Pure wheat is moistened with hot water and then crushed according to the existing conventional koji making process requirements, mixed with water to form koji embryo, and sterilized at 121℃ for 20 minutes;

[0058] Simulated fortified Daqu: Pure wheat is moistened with hot water and then crushed according to the existing preparation process requirements of Luzhou-flavor liquor Daqu, and water is added to mix into qu embryo.

[0059] Enzymatic property analysis: The present invention detected 22 kinds of hydrolases, namely α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT. The detection of these 22 enzyme activities was carried out with reference to the quantitative kit (Beijing Box Biotechnology Co., Ltd.).

[0060] The standard curve of α-GC is y=0.032x+0.0068, R 2 =0.9999; the standard curve of β-GC is y=0.0033x+0.0045, R 2 =0.9999; the standard curve of α-GAL is y=0.0034x-0.0008, R 2 =0.9996; the standard curve of β-GAL is y=0.0036x+0.0142, R 2 =0.9994; the standard curve of saccharifying enzyme is y=0.2954x-0.1997, R 2 =0.9933; the standard curve of α-L-Af is y=0.0073x+0.0195, R 2 =0.9997; the standard curve of β-xylosidase is y=1.5042x-0.0768, R 2 =0.9959; the standard curve of CL is y=0.3758x-0.0636, R 2 =0.9999; the standard curves of α-AL and β-AL are y=1.991x-0.1095, R 2 =0.9999; the standard curve of pectinase is y=0.1042x-0.1389, R 2 =0.9931; the standard curve of P-SC is y=0.3398x-0.06, R 2 =0.9993; the standard curve of PG is y=0.1983x+0.0741, R 2 =0.9972; LPS standard curve is y=0.0067x+0.1531, R 2 =0.9952; the standard value of NAG is 0.285; the standard value of CarE is 0.004, the standard value of ACP is 0.753, the standard value of AKP is 0.696, the standard value of NP is 0.753; the standard value of β-GD is 0.001; in all standard curves, "y" is the absorbance value and "x" is the concentration of the standard.

[0061] Among them, the corresponding substrate generation amount is calculated based on the absorbance value combined with the standard curve.

[0062] The definition of α-GC enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of β-GC enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of α-GAL enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of β-GAL enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of NAG enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system l p-nitrophenol is defined as one unit of enzyme activity; CarE enzyme activity unit definition: under the condition of 37℃, the catalytic absorbance value increase of 0.5 per g of Daqu per minute is defined as one unit of enzyme activity; AKP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; ACP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; NP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; LPS enzyme activity unit definition: at 37℃, per g of Daqu, oxidizes 1nmol per minute NADPH is defined as one unit of enzyme activity; β-GD enzyme activity unit definition: the amount of enzyme required to generate 1μmol phenolphthalein per g Daqu per hour is defined as one unit of enzyme activity; saccharifying enzyme activity unit definition: 1mg glucose is generated per g Daqu per hour is defined as one unit of enzyme activity; C1 enzyme activity unit definition: 1nmol p-nitrophenol is generated per g Daqu per hour is defined as one unit of enzyme activity; α-L-Af enzyme activity unit definition: 1nmol p-nitrophenol is generated per g Daqu per minute is defined as one unit of enzyme activity; β-xylosidase enzyme activity unit definition: 1μmol p-nitrophenol is generated per g Daqu per minute is defined as one unit of enzyme activity; CL enzyme activity unit definition: 1μg glucose is catalyzed per g Daqu per minute is defined as one unit of enzyme activity; α-AL and β-AL enzyme activity units definition: 1mg glucose is generated per g Daqu per minute is defined as one unit of enzyme activity; pectinase enzyme activity unit definition: 50℃ pH Under the conditions of 3.5, one unit of enzyme activity is defined as 1 μmol of galacturonic acid produced per gram of Daqu per hour; the definition of P-SC enzyme activity unit is: one unit of enzyme activity is defined as one gram of Daqu catalyzing the hydrolysis of 1 μg of sucrose per minute; the definition of PG enzyme activity unit is: under the conditions of 40℃ and pH 6.0, one unit of enzyme activity is defined as the decomposition of polygalacturonic acid per gram of Daqu per hour to produce 1 mg of galacturonic acid; the definition of AAT enzyme activity unit is: under the conditions of 37℃, the catalytic absorbance change of 0.0005 per gram of Daqu per mL of the system per minute is defined as one unit of enzyme activity.

[0063] (1) The target strain WLY-WMCC30133 was activated with an activation medium. After confirming that there was no contamination, it was inoculated into a bran medium at a 10% inoculation rate and cultured at 28°C for 5 days. The hydrolase activity after culture was detected. Compared with the blank control group, the strain WLY-WMCC30133 was able to metabolize and produce AAT (EC 2.3.1.-), saccharifying enzyme (EC3.2.1.3), α-GAL (EC 3.2.1.22), β-GC (EC 3.2.1.21), C1 (EC 3.2.1.91), NAG (EC3.2.1.52), α-GC (EC 3.2.1.20), α-L-Af (EC 3.2.1.55), and β-GAL (EC 3.2.1.23) on the bran medium. Figure 4 shown.

[0064] Among them, AAT (EC 2.3.1.-) was 6266.67 U / g dry yeast, saccharifying enzyme (EC 3.2.1.3) was 1116.47 U / g dry yeast, α-GAL (EC 3.2.1.22) was 1027.85 U / g dry yeast, β-GC (EC 3.2.1.21) was 628.91 U / g dry yeast, C1 (EC3.2.1.91) was 400.56 U / g dry yeast, NAG (EC 3.2.1.52) was 270.42 U / g dry yeast, α-GC (EC 3.2.1.20) was 163.94 U / g dry yeast, α-L-Af (EC 3.2.1.55) was 146.74 U / g dry yeast, β-GAL (EC 3.2.1.23) is 131.96U / g dry koji.

[0065] (2) The target strain WLY-WMCC30133 was activated with activation medium. After confirming that there was no contamination, it was inoculated into pure wheat medium at a 10% inoculation rate and cultured at 28°C for 5 days. The hydrolase activity after culture was detected. Compared with the blank control group, it can produce AKP (EC 3.4.4.16), AAT (EC 2.3.1.-), NAG (EC 3.2.1.52), saccharifying enzyme (EC3.2.1.3), β-GC (EC 3.2.1.21), C1 (EC 3.2.1.91), β-GAL (EC 3.2.1.23), α-L-Af (EC3.2.1.55), α-GAL (EC 3.2.1.22), α-GC (EC 3.2.1.20), and β-AL (EC 3.2.1.2), and the content is significantly higher than that of the blank group. Figure 5 shown.

[0066] Among them, AKP (EC 3.4.4.16) was 896.36 U / g dry yeast, AAT (EC 2.3.1.-) was 573.33 U / g dry yeast, saccharifying enzyme (EC 3.2.1.3) was 210.86 U / g dry yeast, NAG (EC 3.2.1.52) was 42.24 U / g dry yeast, β-GC (EC3.2.1.21) was 32.77 U / g dry yeast, C1 (EC 3.2.1.91) was 33.28 U / g dry yeast, β-GAL (EC 3.2.1.23) was 31.13 U / g dry yeast, α-L-Af (EC 3.2.1.55) was 17.23 U / g dry yeast, α-GAL (EC The concentrations of α-GC (EC 3.2.1.20) and β-AL (EC 3.2.1.2) were 16.91 U / g dry yeast, 6.47 U / g dry yeast and 5.62 U / g dry yeast, respectively.

[0067] (3) The target strain WLY-WMCC30133 was activated with an activation medium, and after confirming that there was no contamination, it was inoculated into fresh koji embryos at a 10% inoculum and cultured at 28° C. for 5 days. The hydrolase activity after culture was detected. Compared with the non-fortified group, the fortified Daqu prepared by strain WLY-WMCC30133 can metabolize and produce AAT (EC 2.3.1.-), saccharifying enzyme (EC3.2.1.3), α-GAL (EC 3.2.1.22), β-GC (EC 3.2.1.21), β-GAL (EC 3.2.1.23), P-SC (EC3.2.1.26), NAG (EC 3.2.1.52), α-GC (EC 3.2.1.20), AKP (EC 3.4.4.16), C1 (EC3.2.1.91), β-AL (EC 3.2.1.2), α-L-Af (EC 3.2.1.55), α-AL (EC 3.2.1.1), β-GD (EC3.2.1.31), ACP (EC 3.4.23.18), etc. Figure 6 shown.

[0068] Among them, AAT (EC 2.3.1.-) was 2573.33 U / g dry yeast, saccharifying enzyme (EC 3.2.1.3) was 1515.69 U / g dry yeast, α-GAL (EC 3.2.1.22) was 1154.23 U / g dry yeast, β-GC (EC 3.2.1.21) was 910.34 U / g dry yeast, β-GAL (EC 3.2.1.23) was 710.56 U / g dry yeast, P-SC (EC 3.2.1.26) was 706.95 U / g dry yeast, NAG (EC3.2.1.52) was 626.07 U / g dry yeast, α-GC (EC 3.2.1.20) was 313.05 U / g dry yeast, AKP (EC 3.4.4.16) is 255.29U / g dry product, C1 (EC 3.2.1.91) is 186.24U / g dry product, β-AL (EC 3.2.1.2) is 65.73U / g dry product, α-L-Af (EC 3.2.1.55) is 62.74U / g dry product, α-AL (EC 3.2.1.1) is 12.04U / g dry product, β-GD (EC3.2.1.31) is 3.10U / g dry product, and ACP (EC 3.4.23.18) is 2.18U / g dry product.

[0069] Example 5 Analysis of main flavor components in the fermentation broth of strain WLY-WMCC30133 of the present invention

[0070] Culture medium: Potato dextrose liquid medium. Commercial synthetic culture medium, purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053.

[0071] Culture medium: five-grain flour. Five grains (36% sorghum, 22% rice, 18% glutinous rice, 16% wheat, 8% corn) are ground into fine powder, and the ratio of five-grain flour to water is 1:10. Boil tap water, add fine five-grain flour, and cook for about 40 minutes (into a porridge state), cool to about 60°C, add liquefaction enzyme (5g / 3L) and saccharification enzyme (5g / 3L) at the same time, keep warm at 62°C for liquefaction and saccharification for 4 hours, stir every 1 hour, place in a 4°C refrigerator overnight, filter through 8 layers of gauze, replenish water, add glucose to make the sugar content reach about 12°Bé, pH about 6.8, and sterilize for later use.

[0072] The seed liquid of strain WLY-WMCC30133 was inoculated at a 1% inoculation rate into potato glucose liquid culture medium and five-grain powder culture medium, filled into 200mL / 250mL Erlenmeyer flasks, sealed, and three groups of samples with the same treatment were made in parallel and cultured and fermented at 28°C for 5 days.

[0073] Pretreatment method of flavor substances in fermentation broth: Accurately pipette 1.0 mL of fermentation broth into a headspace bottle, then add 0.3 g of sodium chloride and 6 μL of 4-octanol (concentration of 12 ppb), insert the headspace bottle filled with the sample into the extraction column, place it in a 50°C water bath for equilibration for 15 minutes, extract for 45 minutes, and then put it on the machine for testing.

[0074] After the flavor compounds in the fermentation broth were extracted by pretreatment, they were subsequently analyzed by HS-SPME. The separation was performed according to the following procedure: GC conditions: DB-WAX capillary column (30m×250μm×0.25μm); carrier gas was helium (purity ≥99.999%), flow rate 1mL / min; injection mode: splitless injection; column temperature: starting temperature 60℃, maintained for 1min, increased to 200℃ at 8℃ / min, maintained for 1min, increased to 280℃ at 30℃ / min, maintained for 2min; injection port temperature: 250℃; auxiliary heating temperature 280℃.

[0075] Semi-quantitative analysis was performed using 4-octanol (12.0 ppb) as the internal standard and peak area normalization method. The peak area of ​​each compound was calculated using selected ion spectrometry (SIM), and the concentration of each compound was calculated based on the ratio of the peak area of ​​the internal standard substance.

[0076] The test results are shown in Table 1, which shows that strain WLY-WMCC30133 mainly produces methyl palmitate, benzoic acid, phenylethanol, ethyl acetate, etc. in potato glucose liquid medium. In five-grain powder medium, it mainly produces phenylethanol, methyl palmitate, caproic acid, methyl oleate, ethyl acetate, ethyl elaidate, benzaldehyde, acetic acid, isovaleric acid, isobutanol, octanoic acid, furfuryl alcohol, etc.

[0077] Table 1 Flavor substances of strain WLY-WMCC30133 in different culture media

[0078]

[0079]

[0080]

[0081] As can be seen from the above examples, the WLY-WMCC30133 strain of the present invention can be used to produce a variety of hydrolases and ferment to produce a variety of flavor substances, which have a certain effect on the flavor of liquor, among which phenylethanol is mostly rose fragrance, rose fragrance, pollen fragrance, etc.; when the caproic acid content is high, it will present sour smell, sweet fragrance, fruit fragrance, etc., which helps to enrich the layers of the wine. Therefore, it has a good application value to use it in liquor brewing.

Claims

1. Sarocladium implicatum, characterized in that: The deposit number is CGMCC No.41535.

2. A microbial agent, characterized in that: Contains the Acremonium corytae described in claim 1.

3. Use of the Acremonium corytae described in claim 1 or the microbial agent described in claim 2 in liquor brewing.

4. The use according to claim 3, characterized in that: The liquor is at least one of sauce-flavor type, strong-flavor type, light-flavor type or rice-flavor type.

5. Use of the Acremonium coriaceae according to claim 1 or the microbial agent according to claim 2 in preparing bran koji, daqu, fortified daqu or fermented grains.

6. The use according to claim 5, characterized in that: The Acremonium crossbranchii fungus or microbial agent can metabolize to produce hydrolase, and the hydrolase is at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

7. Use of the Acremonium corytae described in claim 1 or the microbial agent described in claim 2 in producing wine flavor substances.

8. The use according to claim 7, characterized in that: The flavor substances include phenylethyl alcohol, methyl palmitate, hexanoic acid, 4-vinyl-2-methoxyphenol, methyl oleate, 2,4-di-tert-butylphenol, ethyl acetate, ethyl oleate, ethyl palmitate, methyl linoleate, benzaldehyde, acetic acid, methyl myristate, phenylethyl acetate, p-hydroxystyrene, isovaleric acid, isobutyl alcohol, isobutyric acid, octanoic acid, furfuryl alcohol, methyl hexanoate, n-nonanoic acid, 1-octen-3-ol, n-hexanol, palmitic acid, ligustrazine, 2,3,5-trimethylpyrazine, 2-pentanone, heptanoic acid, acetone, ethyl hexanoate, 4-methylvaleric acid, n-decanol, 2-acetylfuran, dipropylene glycol, 2- At least one of propyl-1-pentanol, benzoic acid, 2-heptanone, phenol, 2-methylpyrazine, methyl 10-undecenoate, isovaleraldehyde, n-valeric acid, methyl butyrate, ethyl butyrate, 3-hydroxy-2-butanone, phenylethyl alcohol, methyl isobutyrate, dimethyl carbonate, pyrazine, pentyl formate, 2-(2-hydroxypropoxy)-1-propanol, 3-methyl-3-butene-1-ol, isobutyl acetate, 2,5-dimethylpyrazine, n-butanol, 4-cyclopentene-1,3-dione, 2,3-butanedione, methyl 2-methylbutyrate, phenylacetic acid, methyl acetate, γ-caprolactone, 2,3-pentanedione or p-hydroxybenzaldehyde.

9. The use according to claim 8, characterized in that: The flavor substance is obtained by fermenting the Acremonium affine described in claim 1 or the microbial agent described in claim 2 in a potato glucose liquid culture medium or five-grain flour.

Images