Lactobacillus paracasei strain and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to a lactobacillus paracasei strain and application thereof. The preservation number of the lactobacillus paracasei strain is CGMCC (China General Microbiological Culture Collection Center) No.27975. The lactobacillus paracasei disclosed by the invention can tolerate an oral environment, inhibit proliferation of streptococcus mutans and remarkably inhibit adhesion of the streptococcus mutans on a hydroxyapatite tooth model; the level of producing water-insoluble exopolysaccharides by streptococcus mutans is reduced, the formation of a dental plaque biofilm caused by streptococcus mutans is effectively reduced, the content of a mature dental plaque biofilm is reduced, and the biofilm is not easy to form; the expression quantity of cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS of streptococcus mutans can be obviously reduced.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Lactobacillus paracasei strain capable of preventing or treating dental caries and an application thereof. Background Art

[0002] Dental caries, commonly known as tooth decay, is a bacterial disease, so it can cause pulpitis and apical periodontitis. Cariogenic food sugars (especially sucrose and refined carbohydrates) adhere tightly to the tooth surface. Given enough time, the deep layer of plaque produces acid, invades the teeth, demineralizes them, and then destroys organic matter, resulting in cavities.

[0003] Streptococcus mutans is the main bacterium that causes dental caries. The relationship between Streptococcus mutans and dental caries is mainly that Streptococcus mutans can use sucrose as a substrate to produce water-insoluble extracellular glucan, fructan and intracellular polysaccharide. Glucan mediates bacterial adhesion and promotes plaque formation. It is an important cariogenic virulence factor of Streptococcus mutans. Under the same pH conditions, Streptococcus mutans can dissolve more calcium than Streptococcus sanguis and Lactobacillus.

[0004] Studies have found that probiotics can play an anti-caries role by inhibiting the growth of cariogenic bacteria and biofilm formation, including: ① probiotics can compete with cariogenic bacteria for nutrients or attachment sites; ② co-aggregate with pathogens and exert antibacterial effects; ③ probiotics can produce organic acids, hydrogen peroxide, bacteriocins, etc. to interfere with the metabolism of cariogenic bacteria, etc. Other anti-caries mechanisms include regulating immunity, adjusting local pH, and increasing saliva flow.

[0005] CN 108048347 A patent mentions that a kind of Lactobacillus rhamnosus has antibacterial and bactericidal effects on oral pathogenic microorganisms such as Streptococcus mutans, Streptococcus gordonii, Porphyromonas gingivalis, Fusobacterium nucleatum, and Bacillus actinomycetemcomitans, and reduces the formation of dental plaque and the occurrence and development of oral diseases such as caries and periodontitis. However, the research on the inhibitory mechanism of Lactobacillus paracasei on Streptococcus mutans is insufficient, and the anti-caries effect is not ideal. Therefore, a Lactobacillus paracasei strain that can significantly inhibit Streptococcus mutans and has a more excellent anti-caries effect is needed. Summary of the invention

[0006] The technical problem to be solved by the present invention is: a kind of Lactobacillus paracasei strain is provided, and the Lactobacillus paracasei strain has a very excellent effect of preventing or treating dental caries. The Lactobacillus paracasei strain can tolerate oral environment, has good self-aggregation ability, and the co-aggregation ability with mutans streptococcus, can suppress the proliferation of mutans streptococcus and common pathogenic bacteria, reduce the level of water-insoluble exopolysaccharide generated by mutans streptococcus, effectively reduce the formation of dental plaque biofilm caused by mutans streptococcus, reduce the content of mature dental plaque biofilm and self-difficult to form biofilm, significantly reduce the expression of mutans streptococcus cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS. Significantly suppress the adhesion ability of mutans streptococcus on hydroxyapatite tooth model, can be made into a functional product for preventing and treating dental caries.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] In one aspect, the present invention provides a Lacticaseibacillus paracasei strain, and the deposit number of the Lacticaseibacillus paracasei strain is CGMCC No.27975.

[0009] In one embodiment, the Lactobacillus paracasei strain comprises the 16S rRNA gene represented by SEQ ID NO:1.

[0010] In one embodiment, the Lactobacillus paracasei strain of the present invention can tolerate the oral environment and is not prone to forming biofilm on the tooth surface.

[0011] On the other hand, the present invention also provides the use of the Lactobacillus paracasei strain as described above in the preparation of a product for preventing or treating dental caries.

[0012] In one embodiment, the strain is used to inhibit the growth of Streptococcus mutans.

[0013] In one embodiment, the strain is used to reduce the formation of dental plaque biofilm caused by Streptococcus mutans and reduce the content of mature dental plaque biofilm.

[0014] In one embodiment, the strain is used to inhibit the level of water-insoluble exopolysaccharide production by Streptococcus mutans.

[0015] In one embodiment, the strain is used to reduce the expression levels of the cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS of mutans Streptococcus.

[0016] In one embodiment, the strain is used to reduce the adhesion rate of Streptococcus mutans on a hydroxyapatite tooth model.

[0017] In a further embodiment, the product is a food, a health product, a medicine or an oral care product.

[0018] In another embodiment, the oral care product is selected from one or more of mouthwash, beverage, mouth spray, chewing gum, tooth gel, toothpaste, tooth powder, dental floss, tooth cleaning liquid and tooth cleaning foam.

[0019] In another aspect, the present invention further provides a fermentation product, which is obtained by fermenting the Lactobacillus paracasei strain as described above.

[0020] In one embodiment, the fermentation product is fermented milk, and the content of active Lactobacillus paracasei strains in the fermented milk is 4.0×10 8 CFU / mL and above.

[0021] In another embodiment, the fermentation product is fermented oat milk, and the viable count of Lactobacillus paracasei in the fermented oat milk is 8.5×10 8 CFU / mL and above.

[0022] Compared with the prior art, the Lactobacillus paracasei strain provided by the present invention has the following effects:

[0023] (1) It can tolerate the oral environment, has good self-aggregation ability, co-aggregation ability with Streptococcus mutans, can inhibit the proliferation of Streptococcus mutans and common pathogens, reduce the level of water-insoluble extracellular polysaccharides produced by Streptococcus mutans, effectively reduce the formation of dental plaque biofilm caused by Streptococcus mutans, reduce the content of mature dental plaque biofilm and is not easy to form biofilm itself, significantly inhibit the adhesion of Streptococcus mutans on hydroxyapatite tooth models, and significantly reduce the expression of Streptococcus mutans cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS. It can be made into functional products for preventing or treating dental caries.

[0024] (2) The Lactobacillus paracasei strain of the present invention has excellent in vitro probiotic function and is excellent in inhibiting multiple pathogens.

[0025] (3) The Lactobacillus paracasei strain of the present invention can be fermented to produce fermented milk, oat milk and other fermented products. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1The graph shows the copolymerization ability of Lactobacillus paracasei HOM1211 strain and Streptococcus mutans CICC10438. Note: ** indicates that there is a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). ## This represents a highly significant difference compared with the commercial Lactobacillus paracasei S strain (p<0.01).

[0027] Figure 2 The figure shows the inhibitory effect of Lactobacillus paracasei HOM1211 strain on the biofilm of Streptococcus mutans CICC10438. Note: ** indicates that there is a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). ## This represents a highly significant difference compared with the commercial Lactobacillus paracasei S strain (p<0.01).

[0028] Figure 3 The figure shows the inhibitory effect of Lactobacillus paracasei HOM1211 strain on the caries gene of Streptococcus mutans CICC10438. Note: ** indicates that there is a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). ## This represents a highly significant difference compared with the commercial Lactobacillus rhamnosus GG strain (p<0.01).

[0029] Figure 4 The figure shows the inhibitory effect of Lactobacillus paracasei HOM1211 strain on the adhesion of Streptococcus mutans CICC10438 to the tooth model. Note: ** indicates that there is a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). DETAILED DESCRIPTION

[0030] The present invention discloses strains and their applications, and those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0031] Description of biological deposit:

[0032] The Lacticaseibacillus paracasei HOM1211 strain of the present invention was deposited in the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration on July 24, 2023, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit number is CGMCC No. 27975.

[0033] The strain was identified at the Institute of Microbiology, Chinese Academy of Sciences.

[0034] The conclusion of the test and identification is as follows: Under the conditions of this laboratory, based on the comprehensive analysis of the cell morphology, physiological and biochemical characteristics, 16S rRNA gene sequence, pheS gene sequence and other experimental data of the tested strains, and with reference to the Bergey's Manual of Systematic Bacteriology and relevant research papers in the International Journal of Systematic and Evolutionary Microbiology, the identification result of the tested strain (strain number: HOM1211) is: Lactaseibacillus paracasei. Synonyms: Lactobacillus paracasei.

[0035] The cell morphology of the strain is rod-shaped; the physiological and biochemical characteristics are Gram-positive, catalase-negative (-), and oxidase-negative (-); the 16S rRNA gene sequence is shown in SEQ ID NO: 1, and the pheS gene sequence is shown in SEQ ID NO: 2.

[0036] It should be noted that the experimental methods used in the present invention are all conventional methods unless otherwise specified.

[0037] Unless otherwise specified, the reagents and materials used in the present invention are prepared by conventional methods or obtained from commercial channels.

[0038] As identified above, Lacticaseibacillus paracasei and Lactobacillus paracasei are synonyms of the same species. Therefore, in the present invention, Lacticaseibacillus paracasei and Lactobacillus paracasei can be used interchangeably.

[0039] The Lacticaseibacillus paracasei strain HOM1211 used in the present invention is isolated from healthy infant feces in Beijing. Physical and chemical properties: the suitable growth temperature is 37°C, it has antibacterial properties, good self-aggregation ability, co-aggregation ability with Streptococcus mutans, can inhibit the proliferation of Streptococcus mutans and common pathogens, can tolerate the oral environment, significantly inhibit the adhesion of Streptococcus mutans on the hydroxyapatite tooth model, reduce the level of water-insoluble extracellular polysaccharides produced by Streptococcus mutans, effectively reduce the formation of dental plaque biofilm caused by Streptococcus mutans, reduce the content of mature dental plaque biofilm and is not easy to form biofilm by itself, and significantly reduce the expression of Streptococcus mutans cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS. It can be used to prepare functional products for preventing or treating dental caries.

[0040] In order to further understand the present invention, the Lactobacillus paracasei provided by the present invention and uses thereof are described in detail below in conjunction with the embodiments, and the protection scope of the present invention is not limited by the following embodiments.

[0041] Example 1 Isolation and identification of Lactobacillus paracasei HOM1211 strain

[0042] (1) Preparation of culture medium

[0043] MRS liquid medium:

[0044] MRS medium (OXOID, CM1163) and double distilled water 1L, stir well, sterilize at 121℃ for 20min, and set aside.

[0045] Modified MRS solid medium:

[0046] MRS medium (OXOID, CM1163), 0.05 g of bromocresol green (Shanghai Biotech), 1 L of double distilled water, stir evenly, adjust pH to 5.5, sterilize at 121°C for 20 min, and set aside.

[0047] (2) Isolation of laboratory strains

[0048] Weigh 1g of healthy infant feces, shake and mix thoroughly with 9mL of 0.9% saline, dilute the sample by ten-fold dilution method, select two appropriate dilutions, apply 100μL on a modified MRS solid plate, and culture at 37℃ for 72h. Pick a single colony with a smooth surface, milky white or milky yellow colonies and yellowing edges, streak culture and purification. Observe the colony morphology under a microscope. Pick a single colony to MRS liquid culture medium for pure culture, preserve it in glycerol and number HOM1211.

[0049] (3) Isolation of commercial strains of Lactobacillus paracasei S and Lactobacillus rhamnosus GG

[0050] Weigh 1g of bacterial powder or 1ml of product (including commercial strains of Lactobacillus paracasei S strain or Lactobacillus rhamnosus GG strain) respectively, shake and mix thoroughly with 9mL of 0.9% saline, dilute the sample by ten-fold dilution method, select two appropriate dilutions, take 100μL and spread it on a modified MRS solid plate, and culture at 37°C for 48h. Pick a single colony with a smooth surface, streak culture and purify. Observe the colony morphology under a microscope. Pick a single colony to MRS liquid culture medium for pure culture, preserve the seeds with glycerol and number them as Lactobacillus paracasei S strain and Lactobacillus rhamnosus GG strain.

[0051] (4) Identification of strains

[0052] The strains of the selected strains were inoculated into MRS liquid medium and cultured at 37°C for 24h. The total DNA of the bacterial solution was extracted and 16S rRNA gene amplification was performed. Universal primers 27F (5'-AGTTTGATCMTGGCTCAG-3', SEQ ID NO: 3) and 1492R (5'-GGTTACCTTGTTACGACTT-3', SEQ ID NO: 4) were used for PCR amplification and agarose gel electrophoresis, gel cutting and recovery, and sequencing (performed by CGMCC). Then, the BLAST tool was used to compare in the NCBI database, and the HOM1211 strain was identified as Lactobacillus paracasei. The sequence of the 16S rRNA gene of the HOM1211 strain is shown in SEQ ID NO: 1:

[0053]

[0054] The sequence of the PheS gene of the HOM1211 strain is shown in SEQ ID NO: 2:

[0055] ACACATTGGGATGCACCATGCCGGCACCTAACACTTCAATCCAACCGGTATATTTGCAAACCGGGCAACCTTTACCGCCGCAACGAAAACAGGAAACATCAACTTCAACGGATGGCTCCGTAAAATGGAAAATAACTTGGCCGCAAGCGAATTGTCCGATCTTTACCAAAAACGTGTTGGCACATGGCCAACAAGGTTCCCTTTAGATCAG CCATGGTTATATGCTTGTCAATGACGAGTCCTTCCATCTGGTGAAACTGATGGCTATGAGTAGCATCGTCGTCATCACGTCGATAAACCACCCCAGGGCTAATCATTTTCAGCGGTCCTTTGGTAAAGTCGTGCTTTTCCATTGTCCGCGCCTGCATTGGACTTGTCTGCGAGCGCATGAGTAACTCATTGGTAATGTAAAAAGTCTCTTG

[0056] Example 2 Preparation process of active bacterial powder of Lactobacillus paracasei HOM1211 strain

[0057] (1) Culture of bacterial strains

[0058] The Lactobacillus paracasei HOM1211 strain isolated in Example 1 was inoculated into MRS liquid culture medium at a 3% inoculation rate and cultured at 37°C for 24 h to activate the second generation. The viable count of the strain was up to 1.5×10 10 CFU / mL and above.

[0059] (2) Freeze drying

[0060] The fermentation liquid of Lactobacillus paracasei HOM1211 strain cultured in (1) was centrifuged to collect bacterial sludge, which was washed with 0.9% sterile physiological saline, mixed with a protective agent (100 g / L skim milk powder), freeze-dried in a freeze dryer, and the bacterial cake was crushed with a fine grinder to obtain the freeze-dried bacterial powder, wherein the number of viable bacteria in the freeze-dried bacterial powder was higher than 3.5×10 11 CFU / g.

[0061] Example 3 Test on the ability of Lactobacillus paracasei HOM1211 strain to inhibit common pathogenic bacteria

[0062] (1) Activation of pathogenic bacteria

[0063] Five pathogenic bacteria were selected for this test: Escherichia coli ATCC8739, Salmonella typhimurium ATCC14028, Staphylococcus aureus ATCC6538, Pseudomonas aeruginosa ATCC9027, Listeria monocytogenes ATCC19111. The pathogenic strains were purchased from ATCC (American type culture collection).

[0064] The pathogenic strains were inoculated into the nutrient agar medium at an inoculum amount of 1% of the total volume of the medium, and cultured at 37°C, 200 rpm, and shaking for 12 hours. The indicator bacteria were adjusted to OD = 0.1 with fresh medium for later use.

[0065] (2) Strain activation

[0066] In this experiment, the commercial strain Lactobacillus rhamnosus GG was selected as the control strain. The Lactobacillus rhamnosus GG and HOM1211 strains separated in Example 1 were inoculated into MRS liquid culture medium at an inoculum amount of 1% of the total culture medium, and cultured at 37°C for 24 hours. After activation twice, the fermentation liquid of the strain was obtained. Centrifuged at 11000rpm for 10 minutes, the supernatant was taken for antibacterial test, and the MRS liquid culture medium was used as a negative control.

[0067] (3) Plate preparation

[0068] Pour the sterilized nutrient agar culture into the culture dish, add 100 μL of indicator bacteria solution into the culture medium, mix well, and let it stand to solidify.

[0069] (4) Antibacterial experiment

[0070] Use sterile tweezers to gently place the Oxford cup on the plate, keeping a certain distance between the wells. Add 150 μL of fermentation supernatant to each well, place in a 4°C refrigerator for diffusion for 12 hours, and then culture in a 37°C incubator for 18 hours. Observe and measure the diameter of the inhibition zone. Table 1 shows the inhibitory effect of the strain on pathogenic bacteria.

[0071] Table 1

[0072]

[0073] Note: “–” no antibacterial activity, <11mm; “+” 11mm≤inhibition zone<16mm; “++” 16mm≤inhibition zone<23mm; “+++” ≥23mm

[0074] As shown in Table 1, the Lactobacillus paracasei strain HOM1211 has an inhibitory effect on all five pathogens. The antibacterial ability of the HOM1211 strain is comparable to that of the commercial Lactobacillus rhamnosus strain GG.

[0075] Example 4 Tolerance of HOM1211 strain to artificial saliva containing lysozyme

[0076] (1) Activation of strains

[0077] The Lactobacillus paracasei HOM1211 strain isolated in Example 1 and the commercial strain Lactobacillus paracasei S strain were inoculated in an MRS liquid culture medium at an inoculum rate of 3%, cultured at 37°C for 24 hours, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 minutes, and the viable count was adjusted to 1.5×10 with sterile phosphate buffered saline (PBS). 9 CFU / mL.

[0078] Streptococcus mutans CICC10438 10438) was screened from children with dental caries and purchased from the China Industrial Microbiological Culture Collection. Mutant Streptococcus CICC10438 was inoculated into BHI liquid medium at a 3% inoculum, cultured anaerobically at 37°C for 24 hours, and activated twice. After the strain was activated twice, it was centrifuged at 11000 rpm for 10 minutes, the supernatant was removed, and the viable count was adjusted to 1.5×10 with sterile PBS. 9 CFU / mL.

[0079] (2) Experiment on strain tolerance to artificial saliva containing lysozyme

[0080] The strain was transferred to sterile artificial saliva containing 1 mg / mL lysozyme and cultured at 37°C. The number of live bacteria at 0h and 6h was measured to evaluate the strain's tolerance to artificial saliva containing lysozyme.

[0081] (3) Tolerance

[0082]

[0083] Wherein, T1 represents the number of live bacteria of the strain at t = 6 hours; T0 represents the number of live bacteria of the strain at t = 0 hours. Table 2 shows the tolerance of the strain to artificial saliva containing 1 mg / mL lysozyme.

[0084] Table 2

[0085]

[0086] Note: * indicates significant difference compared with Streptococcus mutans CICC10438 (p<0.05). # indicates significant difference compared with commercial Lactobacillus paracasei S strain (p<0.05).

[0087] As can be seen from Table 2, compared with Streptococcus mutans CICC10438 and commercial strain Lactobacillus casei S, Lactobacillus paracasei HOM1211 strain has stronger tolerance in artificial saliva containing 1 mg / mL lysozyme (p<0.05). The survival rate of Lactobacillus paracasei HOM1211 strain after incubation in artificial saliva containing 1 mg / mL lysozyme for 6 hours was 74.80%±6.38%. Studies have shown that oral saliva contains abundant lysozyme, so Lactobacillus paracasei HOM1211 strain can maintain a high survival rate in the oral cavity, thereby playing a probiotic role in the oral cavity.

[0088] Example 5 Self-aggregation ability of strains

[0089] (1) Activation of strains

[0090] The Lactobacillus paracasei HOM1211 strain and the Lactobacillus paracasei S strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and resuspended 3 times with sterile PBS buffer.

[0091] Mutans Streptococcus CICC10438 was inoculated into brain heart infusion (BHI) liquid culture medium at 3% inoculation volume, cultured at 37°C for 24 hours, and activated twice. After the strain was activated twice, it was centrifuged at 11000 rpm for 10 minutes, the supernatant was removed, and it was resuspended three times with sterile PBS buffer.

[0092] (2) Self-aggregation experiment

[0093] The initial absorbance of the strain was adjusted to A0 = 0.6 ± 0.02 with sterile PBS buffer and allowed to stand at room temperature. The absorbance of the suspension was measured at 1 h, 2 h, and 3 h. t )(OD=600).

[0094] (3) Self-aggregation ability

[0095]

[0096] Where At represents the absorbance at t = 1, 2, and 3 hours. Table 3 shows the self-aggregation ability of the strains.

[0097] Table 3

[0098]

[0099] Note: ** indicates a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). ## Compared with the commercial Lactobacillus paracasei S strain, there was a very significant difference (p<0.01).

[0100] As can be seen from Table 3, with the increase of time, the self-aggregation ability of the strains gradually increased. The self-aggregation ability of the two Lactobacillus paracasei strains HOM1211 and S strains was higher than that of Streptococcus mutans CICC10438 (p<0.01). Compared with the commercial Lactobacillus paracasei S strain, the self-aggregation ability of Lactobacillus paracasei HOM1211 strain was higher, with a very significant difference (p<0.01). Studies have shown that higher self-aggregation ability helps strains reproduce and survive in the oral cavity.

[0101] Example 6 Co-culture of Lactobacillus paracasei HOM1211 strain and Streptococcus mutans CICC10438

[0102] Aggregation Capability

[0103] (1) Activation of strains

[0104] The Lactobacillus paracasei HOM1211 strain and the Lactobacillus paracasei S strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and resuspended 2-3 times with sterile PBS buffer.

[0105] Mutans Streptococcus CICC10438 was inoculated into BHI liquid medium at 3% inoculation volume, cultured anaerobically at 37°C for 24 hours, and activated twice. After the strain was activated twice, it was centrifuged at 11000 rpm for 10 minutes, the supernatant was removed, and it was resuspended three times with sterile PBS buffer.

[0106] (2) Coaggregation experiment

[0107] Equal volumes of Lactobacillus paracasei HOM1211 strain, Lactobacillus paracasei S strain and Streptococcus mutans CICC10438 were mixed respectively. In the control group, Lactobacillus paracasei HOM1211 strain was replaced with sterile PBS buffer. The absorbance of the suspension was measured at 1h, 2h and 3h respectively. The results are shown in Table 1. Figure 1 .

[0108] (3) Coaggregation ability

[0109]

[0110] A0 and B0 represent the initial absorbance of Lactobacillus paracasei HOM1211 and Streptococcus mutans CICC10438, C t The absorbance of the mixture measured at t = 1, 2, and 3 hours is shown.

[0111] from Figure 1 It can be seen that as time goes on, the coaggregation ability of Lactobacillus paracasei HOM1211 strain and Lactobacillus paracasei S strain with Streptococcus mutans CICC10438 increases respectively. Compared with the PBS control group, at 2h and 3h, the coaggregation ability of Lactobacillus paracasei HOM1211 strain and Streptococcus mutans CICC10438 has a very significant difference (p<0.01). Compared with Lactobacillus paracasei S strain, at 1h, the Lactobacillus paracasei HOM1211 strain group has a very significant difference (p<0.01). It shows that the coaggregation ability of Lactobacillus paracasei HOM1211 strain and Streptococcus mutans is high, which can reduce the adhesion and colonization of free Streptococcus mutans in the oral cavity and reduce the formation of dental biofilm.

[0112] Example 7 Inhibitory Effect of Lactobacillus paracasei HOM1211 on Streptococcus mutans CICC10438

[0113] (1) Activation of strains

[0114] The Lactobacillus paracasei HOM1211 strain and the Lactobacillus paracasei S strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and the bacterial count was adjusted with sterile PBS.

[0115] Mutans Streptococcus CICC10438 was inoculated into BHI liquid medium at 3% inoculation volume, cultured at 37°C for 24 hours, and activated twice. After the strain was activated twice, the supernatant was removed after centrifugation at 11000 rpm for 10 minutes, and the bacterial count was adjusted with sterile PBS.

[0116] (2) Co-culture experiment with Streptococcus mutans CICC10438

[0117] The viable counts of Lactobacillus paracasei HOM1211 strain, Lactobacillus paracasei S strain and Streptococcus mutans CICC10438 were adjusted to 1.5×10 8CFU / mL, 125 μL of Lactobacillus paracasei HOM1211 strain, Lactobacillus paracasei S strain and Streptococcus mutans CICC10438 were inoculated into BHI liquid medium respectively, and cultured anaerobically at 37 °C for 24 h. In the control group, Lactobacillus paracasei HOM1211 strain was replaced with sterile PBS, and the colony count was performed with BHI solid medium after the co-culture.

[0118] (3) Inhibition rate:

[0119]

[0120] A is the number of viable bacteria of Streptococcus mutans CICC10438 after the co-culture of Lactobacillus paracasei HOM1211 strain and Lactobacillus paracasei S strain with Streptococcus mutans CICC10438 respectively; B is the number of viable bacteria of Streptococcus mutans CICC10438 in the control group. Table 4 shows the inhibitory effects of Lactobacillus paracasei HOM1211 strain and Lactobacillus paracasei S strain on Streptococcus mutans CICC10438 respectively.

[0121] Table 4

[0122]

[0123] Note: ** indicates that the results are significantly different from those of commercial Lactobacillus paracasei S (p<0.01).

[0124] As can be seen from Table 4, both Lactobacillus paracasei strains HOM1211 and S strains can inhibit the growth of Streptococcus mutans CICC10438. Compared with the commercial Lactobacillus paracasei strain S, Lactobacillus paracasei strain HOM1211 has a stronger inhibitory effect on Streptococcus mutans CICC10438 (p<0.01).

[0125] Example 8 Biofilm Formation Ability of Strains

[0126] (1) Activation of strains

[0127] The Lactobacillus paracasei HOM1211 strain and the Lactobacillus paracasei S strain isolated in Example 1 were inoculated in an MRS liquid medium at an inoculum size of 3%, cultured at 37°C for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and the strain was resuspended three times with sterile saline, and sterile PBS was used as a blank control to adjust the OD 600 =0.5±0.02.

[0128] Mutans Streptococcus CICC10438 was inoculated into BHI liquid medium at 3% inoculation volume, cultured anaerobically at 37°C for 24 hours, and activated twice. After the strain was activated twice, it was centrifuged at 11000rpm for 10 minutes, the supernatant was removed, and it was resuspended 2-3 times with sterile PBS, and the sterile PBS was used as the blank control to adjust its OD 600 =0.5±0.02.

[0129] (2) Biofilm formation ability of strains

[0130] Lactobacillus paracasei HOM1211 strain and Lactobacillus paracasei S strain were inoculated into MRS+2% sucrose medium, and Streptococcus mutans was inoculated into BHI+2% sucrose medium. After mixing evenly, the mixture was transferred to a 96-well plate for culture and anaerobically cultured at 37°C for 48 hours.

[0131] (3) Determination of biofilm content

[0132] The 96-well plate was rinsed twice with sterile water, dried, and stained with 200 μL 0.1% crystal violet for 15 minutes. After staining, the crystal violet was removed, rinsed twice with sterile water, placed in a 37°C incubator to dry for 30 minutes, and then 200 μL 30% glacial acetic acid was added to dissolve for more than 30 minutes. The plate was read with an ELISA reader at a wavelength of 570 nm. Table 5 shows the biofilm formation ability of the strains.

[0133] Table 5

[0134]

[0135] Note: ** indicates a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01).

[0136] As can be seen from Table 5, compared with Streptococcus mutans CICC10438, the biofilm formation of the two strains of Lactobacillus paracasei HOM1211 and S was less, with a very significant difference (p<0.01).

[0137] Example 9 Inhibitory effect of Lactobacillus paracasei HOM1211 strain on biofilm formation of Streptococcus mutans CICC10438

[0138] (1) Activation of strains

[0139] The Lactobacillus paracasei HOM1211 strain and the Lactobacillus paracasei S strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated twice. After the activation of the strains, the supernatant was removed after centrifugation at 11000 rpm for 10 min.

[0140] Mutans Streptococcus CICC10438 was inoculated into BHI liquid culture medium at 3% inoculation amount, cultured anaerobically at 37°C for 24 hours, activated twice, and centrifuged at 11000 rpm for 10 minutes before removing the supernatant.

[0141] (2) Lactobacillus paracasei HOM1211 and Lactobacillus paracasei S were co-cultured with Streptococcus mutans CICC10438

[0142] The viable counts of Lactobacillus paracasei HOM1211 strain, Lactobacillus casei S strain and Streptococcus mutans CICC10438 were adjusted to 1.5×10- 8 CFU / mL, added at a ratio of 1:1, and the control group replaced the Lactobacillus paracasei HOM1211 strain with MRS+2% sucrose medium, mixed evenly and added to a 96-well plate, and fermented anaerobically at 37°C for 24h and 48h.

[0143] (3) Determination of biofilm content

[0144] The samples in the 96-well plate after fermentation were rinsed twice with sterile water, dried, and stained with 200 μL 0.1% crystal violet for 15 minutes. After staining, the crystal violet was removed, rinsed twice with sterile water, placed in a 37°C incubator to dry for 30 minutes, and then 200 μL 30% glacial acetic acid was added to dissolve for more than 30 minutes. The results were read with an enzyme-labeled instrument at a wavelength of 570 nm. Figure 2 .

[0145] from Figure 2 Can find out, when Lactobacillus paracasei HOM1211 strain, Lactobacillus paracasei S strain were co-cultured with Streptococcus mutans CICC10438 for 24h and 48h respectively, Lactobacillus paracasei HOM1211 strain all can significantly inhibit Streptococcus mutans CICC10438 biofilm formation (p<0.01).And Lactobacillus paracasei S strain can only significantly inhibit Streptococcus mutans CICC10438 biofilm formation (p<0.01) when 48h.Compare with Lactobacillus paracasei S, when 24h and 48h, the ability that Lactobacillus paracasei HOM1211 strain inhibits Streptococcus mutans CICC10438 to form biofilm is much higher than Lactobacillus paracasei S strain (p<0.01), which shows that the ability that Lactobacillus paracasei HOM1211 strain inhibits Streptococcus mutans CICC10438 to form biofilm is stronger.

[0146] Example 10 Inhibitory effect of Lactobacillus paracasei HOM1211 strain on mature biofilm of Streptococcus mutans CICC10438

[0147] (1) Preparation of supernatant of Lactobacillus paracasei HOM1211 strain

[0148] The Lactobacillus paracasei HOM1211 strain and the Lactobacillus paracasei S strain separated in Example 1 were respectively inoculated into fresh MRS liquid medium with an inoculum size of 3%, cultivated under 37 ℃ of anaerobic conditions for 24 h, activated for 2 generations, obtained supernatant after centrifugation at 11000 rpm for 10 min, its pH was adjusted to 6.5 with 1.0 M NaOH, and bacterial cells were removed by filtration with a 0.22 μm filter membrane, and put into a 4 ℃ refrigerator for standby use.

[0149] (2) Preparation of mature biofilm of Streptococcus mutans CICC10438

[0150] Mutant Streptococcus CICC10438 was inoculated into fresh BHI liquid medium at a 3% inoculum and cultured at 37°C under anaerobic conditions for 24 h to activate the second generation. Mutant Streptococcus CICC10438 was centrifuged and resuspended twice with sterile PBS. The OD 600 Adjust to 0.5, mix well, take 100 μL and add to 96-well plate, and culture anaerobically at 37°C for 24 h.

[0151] (3) Effects of the supernatants of Lactobacillus paracasei HOM1211 and Lactobacillus paracasei S on the mature biofilm of Streptococcus mutans CICC10438

[0152] The supernatant of mutans Streptococcus CICC10438 was removed after the culture was completed, and 100 μL of the treated strain supernatant was added after rinsing once with sterile PBS. In the control group, the Lactobacillus paracasei HOM1211 strain was replaced with fresh MRS medium (pH=6.5) and co-cultured at 37°C for 24 h.

[0153] (4) Determination of biofilm content

[0154] The sample that fermentation in 96-well plate is finished is rinsed with sterile water 2 times, dried, and dyed with 200 μ L 0.1% crystal violet for 15 min. After dyeing, take out crystal violet, rinse with sterile water 2 times, place 37 ℃ of incubators to dry for 30 min, then add 200 μ L 30% glacial acetic acid to dissolve more than 30 min. Read with microplate reader, wavelength is 570 nm. Table 6 shows the inhibitory effect of fermentation supernatant of Lactobacillus paracasei HOM1211 strain and Lactobacillus paracasei S strain on mature biofilm of Streptococcus mutans CICC10438 respectively.

[0155] Table 6

[0156]

[0157] Note: ** indicates a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01).

[0158] As can be seen from Table 6, after the respective fermentation supernatants of Lactobacillus paracasei HOM1211 strain and Lactobacillus paracasei S strain were adjusted to pH=6.5, the fermentation supernatant still had a very significant inhibitory effect (p<0.01) on the mature biofilm of Streptococcus mutans CICC10438, indicating that the non-acidic metabolites produced by Lactobacillus paracasei HOM1211 strain have the effect of inhibiting biofilm formation by Streptococcus mutans.

[0159] Example 11 Effect of Lactobacillus paracasei HOM1211 strain on the content of water-insoluble exopolysaccharides produced by Streptococcus mutans CICC10438

[0160] (1) Activation of strains

[0161] The Lactobacillus paracasei HOM1211 strain and the Lactobacillus rhamnosus GG strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and washed twice with sterile PBS for standby use.

[0162] Mutans Streptococcus CICC10438 was inoculated into BHI liquid culture medium at 3% inoculation volume and cultured anaerobically at 37°C for 24 hours. After the strain was activated twice, the supernatant was removed after centrifugation at 11000 rpm for 10 minutes, and the culture was washed twice with sterile PBS for use.

[0163] (2) Lactobacillus paracasei HOM1211 and Lactobacillus rhamnosus GG were co-cultured with Streptococcus mutans CICC10438

[0164] Use fresh MRS + 2% sucrose to adjust the viable counts of Lactobacillus paracasei HOM1211 and Lactobacillus rhamnosus GG to 1.5×10 8 CFU / mL, and the viable count of Streptococcus mutans CICC10438 was adjusted to 1.5×10 8 CFU / mL. Lactobacillus paracasei HOM1211 strain, Lactobacillus rhamnosus GG strain and Streptococcus mutans CICC10438 were added in a 1:1 ratio, and the bacterial solution of Lactobacillus paracasei HOM1211 strain in the control group was replaced with fresh MRS+2% sucrose, mixed evenly and added to a 24-well plate, and anaerobically fermented at 37°C for 48h.

[0165] (3) Determination of water-insoluble extracellular polysaccharide content

[0166] The supernatant of the sample after the culture in the 24-well plate was removed, 2 mL of sterile water was added, 1 mL was taken for centrifugation, and resuspended 3 times with sterile water to remove water-soluble exopolysaccharides, and the water-insoluble exopolysaccharides were dissolved with 1.0 M NaOH, stirred at 37 ° C for 2 h, and the content was determined by phenol-concentrated sulfuric acid method. Table 7 shows the effects of Lactobacillus paracasei HOM1211 strain and Lactobacillus rhamnosus GG strain on the content of water-insoluble exopolysaccharides produced by Streptococcus mutans CICC10438.

[0167] Table 7

[0168]

[0169] Studies have shown that water-insoluble extracellular polysaccharides are key factors in the formation of dental biofilm and dental caries by Streptococcus mutans. As can be seen from Table 7, both Lactobacillus paracasei HOM1211 strain and Lactobacillus rhamnosus GG strain can significantly reduce the formation of water-insoluble extracellular polysaccharides of Streptococcus mutans CICC10438, with an inhibition rate of up to 75%, which shows that Lactobacillus paracasei HOM1211 strain and Lactobacillus rhamnosus GG strain can inhibit the formation of water-insoluble polysaccharides by Streptococcus mutans and prevent the formation of dental caries.

[0170] Example 12 Effect of Lactobacillus paracasei HOM1211 strain on the expression of cariogenic genes in Streptococcus mutans CICC10438

[0171] (1) Activation of strains

[0172] The Lactobacillus paracasei HOM1211 strain and the Lactobacillus rhamnosus GG strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated for 2 generations. After the activation of the strains, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and the strains were washed twice with sterile saline.

[0173] Mutans Streptococcus CICC10438 was inoculated into BHI liquid culture medium at an inoculum size of 3%, and cultured anaerobically at 37°C for 24 hours. After the strain was activated twice, the supernatant was removed after centrifugation at 11000 rpm for 10 minutes, and the culture was washed twice with sterile saline.

[0174] (2) Lactobacillus paracasei HOM1211 and Lactobacillus rhamnosus GG were co-cultured with Streptococcus mutans CICC10438

[0175] Use fresh MRS+2% sucrose and BHI+2% sucrose culture media to adjust the viable counts of Lactobacillus paracasei HOM1211 strain, Lactobacillus rhamnosus GG strain and Streptococcus mutans CICC10438 to the same level. 200 μL of Lactobacillus paracasei HOM1211 strain was added to the upper chamber of the Transwell plate, 600 μL of Streptococcus mutans CICC10438 was added to the lower chamber, and only MRS+2% sucrose culture medium was added to the upper chamber of the control group, and cultured anaerobically at 37°C for 48 hours.

[0176] (3) RT-qPCR technology

[0177] RNA of mutans Streptococcus CICC10438 was extracted and quality tested. If the purity, concentration and integrity of RNA met the requirements of subsequent experiments, the next step of reverse transcription experiment would be carried out. After RNA was reverse transcribed into cDNA, the expression levels of internal reference genes and target genes were determined by real-time fluorescence quantitative PCR, and the results were processed and analyzed. The cariogenic genes and primer designs measured are shown in Table 8, and the housekeeping gene gyrA was selected as the internal reference gene. The results are shown in Figure 3 .

[0178] Table 8. Reference genes and cariogenic genes of Streptococcus mutans and their primer designs

[0179]

[0180] Studies have shown that gtfB, gtfC and gtfD are related to the formation of glucan in biofilms, and ftf is related to the formation of fructan in biofilms. Inhibiting the expression of gtfB, gtfC, gtfD and ftf can reduce the formation of biofilms, thereby reducing the risk of dental caries. In addition, the LuxS gene is involved in the regulation of oxidative stress tolerance of Streptococcus mutans, which can reduce the ability of Streptococcus mutans to adapt to the environment.

[0181] from Figure 3 It can be seen that compared with the control group of Streptococcus mutans CICC10438, Lactobacillus paracasei HOM1211 can significantly reduce the expression of cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS of Streptococcus mutans CICC10438 (p<0.01), while Lactobacillus rhamnosus GG can significantly reduce the expression of gtfB, gtfC, ftf and LuxS (p<0.01), but cannot reduce the expression of gtfD (p>0.05). This shows that Lactobacillus paracasei HOM1211 can effectively reduce the expression of the above five cariogenic genes of Streptococcus mutans, thereby limiting the cariogenic effect of Streptococcus mutans in the oral cavity.

[0182] Example 13 Effect of Lactobacillus paracasei HOM1211 strain on the adhesion of Streptococcus mutans CICC10438 on the tooth model

[0183] (1) Preparation of hydroxyapatite

[0184] Hydroxyapatite was suspended in sterile potassium chloride (KCl) buffer, washed 10 times with distilled water, and dried in a 60°C incubator for 48 h. 12 mg of treated hydroxyapatite and 1 mL of sterile KCl buffer were added to a suitable tube and placed at 4°C for 16 h for adhesion experiments.

[0185] (2) Activation of strains

[0186] Example 1 The isolated Lactobacillus paracasei HOM1211 strain and Lactobacillus rhamnosus GG strain were activated twice with Streptococcus mutans CICC10438, and the activated strains were washed three times with sterile KCl buffer, and the viable counts of Lactobacillus paracasei HOM1211 strain and Lactobacillus rhamnosus GG strain were adjusted to 1.5×10 8 CFU / mL, the viable count of Streptococcus mutans CICC10438 was adjusted to 7.5×10 7 CFU / mL.

[0187] (3) Pre-incubation of Lactobacillus paracasei HOM1211 and Lactobacillus rhamnosus GG with artificial saliva containing bovine serum albumin (BSA)

[0188] In the experimental group, the bacterial suspension of Lactobacillus paracasei HOM1211 and Lactobacillus rhamnosus GG were mixed with saliva at a volume ratio of 1:1, incubated anaerobically at 37°C for 1 hour, and filtered through a 0.22 μm filter membrane after the incubation. In the control group, Lactobacillus paracasei HOM1211 was replaced with sterile KCl buffer.

[0189] (4) Establishment of tooth model and adhesion of Lactobacillus paracasei HOM1211 strain to Streptococcus mutans CICC10438

[0190] The pre-incubated saliva was mixed with hydroxyapatite at room temperature for 1 hour, the saliva was removed after mixing, and the mixture was rinsed 3 times with sterile KCl buffer. Mutans Streptococcus CICC10438 was added and mixed at room temperature for 1 hour. After mixing, the mixture was rinsed 3 times with sterile KCl buffer to remove the unadhered mutans Streptococcus CICC10438. The sample was ultrasonically treated for 15 minutes, and the adhered bacteria were stained with Nile red for 1 hour, and the cell-related fluorescence intensity (excitation wavelength 530nm, emission wavelength 570nm) was measured. The results are shown in Figure 4 .

[0191] The adhesion of Streptococcus mutans to teeth is a crucial step in the formation of biofilm. Figure 4 It can be seen that both Lactobacillus paracasei HOM1211 and Lactobacillus rhamnosus GG can reduce the adhesion of Streptococcus mutans CICC10438 to the tooth model (p<0.01). This shows that Lactobacillus paracasei HOM1211 can effectively inhibit the adhesion of Streptococcus mutans on teeth, thereby reducing the formation of biofilm and dental caries.

[0192] Example 14 Fermented milk test

[0193] Weigh 12 g of skim milk powder and 2 g of glucose, add double distilled water to 100 mL, stir evenly, homogenize with a high-pressure homogenizer (60°C, 22 MPa), sterilize at 95°C for 10 min, and cool to 37°C for later use.

[0194] The Lactobacillus paracasei HOM1211 strain prepared in Example 1 was inoculated into MRS liquid culture medium and cultured at 37° C. for 18 h. The culture was subcultured twice in this way to obtain a high-activity bacterial solution for later use.

[0195] The bacterial solution was eluted and resuspended in 0.9% saline at 1×10 7 CFU / mL inoculation amount was inoculated into the milk, mixed evenly, and fermented at 37°C for 16 hours to obtain a fermented dairy product. The content of active Lactobacillus paracasei HOM1211 strain in the fermented milk was higher than 4.0×10 8 CFU / mL, pH can reach 4.60, with a mellow taste, sweet and sour.

[0196] Example 15 Fermented oat milk test

[0197] Weigh 120 g of enzymatically hydrolyzed oatmeal powder and 20 g of yeast powder, add double distilled water to 1000 mL, homogenize at 200 bar, sterilize at 90 °C for 10 min, and cool to 37 °C for later use.

[0198] The seed liquid of Lactobacillus paracasei HOM1211 prepared in Example 1 was inoculated into MRS liquid culture medium, cultured at 37° C. for 18 h, subcultured twice to obtain a high-concentration bacterial liquid, and stored at low temperature (4° C.) for later use.

[0199] The bacterial solution was washed with 0.9% saline and resuspended at 1×10 7 CFU / mL inoculation amount was inoculated into oat slurry, mixed evenly, and kept at 37°C for 6 hours to obtain fermented oat milk. The viable bacterial count of Lactobacillus paracasei HOM1211 strain in the fermented milk was higher than 8.5×10 8 CFU / mL, pH can be reduced to 4.50, and the taste is rich.

[0200] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A Lacticaseibacillus paracasei strain, characterized in that The deposit number of the Lactobacillus paracasei strain is CGMCC No.27975.

2. The Lactobacillus paracasei strain according to claim 1, characterized in that The Lactobacillus paracasei strain comprises the 16S rRNA gene represented by SEQ ID NO:

1.

3. Application of Lactobacillus paracasei strain according to claim 1 in the preparation of a product for preventing or treating dental caries.

4. The use according to claim 3, characterized in that: The strain is used to inhibit the growth of Streptococcus mutans.

5. The use according to claim 3, characterized in that: The strain is used for reducing the formation of dental plaque biofilm caused by mutans streptococci and reducing the content of mature dental plaque biofilm.

6. The use according to claim 3, characterized in that: The strain is used to inhibit the level of water-insoluble exopolysaccharide produced by mutans Streptococcus.

7. The use according to claim 3, characterized in that: The strain is used for reducing the expression levels of the cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS of mutans streptococci.

8. The use according to claim 3, characterized in that: The strain is used for reducing the adhesion rate of Streptococcus mutans on a hydroxyapatite tooth model.

9. The use according to claim 3, characterized in that The product is food, health care product, medicine or oral care product.

10. The use according to claim 9, characterized in that The oral care product is selected from one or more of mouthwash, beverage, mouth spray, chewing gum, tooth gel, toothpaste, tooth powder, dental floss, tooth cleaning liquid and tooth cleaning foam.

11. A fermentation product, characterized in that The fermentation product is obtained by fermenting the Lactobacillus paracasei strain according to claim 1 or 2.

12. The fermentation product according to claim 11, characterized in that The fermentation product is fermented milk, and the content of active Lactobacillus paracasei strains in the fermented milk is 4.0×10 8 CFU / mL and above.

13. The fermentation product according to claim 11, characterized in that The fermented product is fermented oat milk, and the number of viable bacteria of Lactobacillus paracasei in the fermented oat milk is 8.5×10 8 CFU / mL and above.

Images