Method for efficiently producing branched human milk oligosaccharide lactyl-N-neohexaose (LNnH), recombinant strain and application of recombinant strain

Abstract

The invention discloses a method for efficiently producing branched human milk oligosaccharide lacto-N-neohexaose (lacto-N-neohexaose, LNnH, Gal beta 1, 4GlcNacbeta 1, 3 (Gal beta 1, 4GlcNacbeta 1, 6) Gal beta 1 and 4Glc), a recombinant strain and application of the recombinant strain. The invention further discloses a method for efficiently producing the branched human milk oligosaccharide lacto-N-neohexaose, LNnH, Gal beta 1, 4GlcNacbeta 1, 3 (Gal beta 1, 4GlcNacbeta 1, 6) Gal beta 1 and 4Glc. The whole-cell synthesis method of the LNnH is low in cost, high in efficiency and beneficial to industrial production. Besides, as the core structure of the branched human milk oligosaccharide, the method provided by the invention is beneficial to making up the blank of the biosynthesis technology of the branched human milk oligosaccharide and promoting the research and development of the branched human milk oligosaccharide.

Description

Technical Field

[0001] The present invention relates to the field of biochemical medicine technology, and in particular to a method for efficiently producing branched human milk oligosaccharide lacto-N-neohexaose (lacto-N-neohexaose, LNnH, Galβ1,4GlcNAcβ1,3(Galβ1,4GlcNAcβ1,6)Galβ1,4Glc), a recombinant strain and an application thereof. Background Art

[0002] Human milk oligosaccharides (HMOs) are a type of oligosaccharides that exist in free form in breast milk. They have a variety of important physiological functions and play a key role in the growth and development of infants and young children. HMOs promote the healthy growth of infants and young children through a variety of mechanisms, such as regulating intestinal microecology, promoting the growth of probiotics, and inhibiting the colonization of pathogens, thereby reducing the risk of infection and enhancing immunity. At present, about 200 HMOs have been identified, and some HMOs (such as 2'-FL, LNnT, LNT) have been approved by the US Food and Drug Administration (FDA) and the European Food Safety Authority (EFSA). my country has also approved two HMOs for use in infant formula in 2023.

[0003] According to the structural characteristics, HMOs can be divided into two categories: linear HMOs and branched HMOs. The research on the synthesis of linear HMOs is relatively in-depth and the technology is relatively mature. At present, chemical and enzymatic synthesis methods have been reported. Compared with linear HMOs with simple structures, the synthesis of branched HMOs is more difficult. The sugar chain structure is complex and the β1,6GlcNAc branch needs to be introduced. There are still certain limitations in the efficient synthesis method. Wang Peng's research group obtained branched pentasaccharides by chemical methods (Xiao, Z.; Guo, Y.; Liu, Y.; Li, L.; Zhang, Q.; Wen, L.; Wang, X.; Kondengaden, SM; Wu, Z.; Zhou, J.; Cao, X.; Li, X.; Ma, C.; Wang, PG, Chemoenzymatic Synthesis of a Library of Human Milk Oligosaccharides. The Journal of Organic Chemistry 2016, 81(14), 5851-5865.); Mithila D. Bandara et al. obtained lacto-N-neohexaose (LNnH) by chemical methods (Bandara, MD; Stine, KJ; Demchenko, AV, Chemical synthesis of human milkoligosaccharides:lacto-N-neohexaose(Galβ1→4GlcNAcβ1→)(2)3,6Galβ1→4Glc.Organic&biomolecular chemistry 2020,18(9),1747-1753.). However, the efficient preparation steps of LNnH by chemical synthesis are relatively cumbersome, which is not conducive to industrial production. Kai-Eng Ooi et al. prepared the starting branch pentasaccharide by chemical method, used glycosyltransferase to extend the sugar chain, and obtained LNnH by chemical enzymatic method (Ooi, K.-E.; Zhang, X.-W.; Kuo, C.-Y.; Liu, Y.-J.; Yu, C.-C., Chemoenzymatic Synthesis of Asymmetrically Branched Human Milk Oligosaccharide Lacto-N-Hexaose.Frontiers in chemistry 2022,10,905105.).Geert-Jan Boons, Kelley W. Moremen, et al., used β1,6-N-acetylglucosamine transferase (GCNT2) expressed in mammalian cells to achieve enzymatic synthesis of branched HMOs (Prudden, AR; Liu, L.; Capicciotti, CJ; Wolfert, MA; Wang, S.; Gao, Z.; Meng, L.; Moremen, KW; Boons, G.-J., Synthesis of asymmetrical multiantennary human milkoligosaccharides. Proceedings of the National Academy of Sciences of the United States of America 2017, 114(27), 6954–6959.). The heterologous expression of GCNT2 in mammalian systems has limitations such as high culture medium cost, long expression cycle, and complex operation. Although enzymatic synthesis has the advantage of high regional selectivity, each step of the enzymatic reaction is accompanied by tedious purification.

[0004] Although branched HMOs have been successfully synthesized by chemical and enzymatic methods, research on the whole-cell synthesis of branched HMOs is still blank. Summary of the invention

[0005] In order to overcome the deficiencies of the prior art, the present invention provides a method for efficiently producing branched human milk oligosaccharide lactoyl-N-neohexaose (LNnH), a recombinant strain and applications thereof.

[0006] In the first aspect of the present invention, a recombinant strain for producing branched human milk oligosaccharide lactoyl-N-neohexose (LNnH) is provided, which overexpresses β-1,3-N-acetylglucosamine transferase (LgtA), β-1,4-galactosyl transferase (LgtB), β1,6-N-acetylglucosamine transferase (GCNT2) and UDP-glucose 4-isomerase (GalE), and knocks out genes encoding β-galactosidase (lacZ), glucosamine-6-phosphate deaminase (nagB) and UDP-N-acetylglucosamine 2-isomerase (wecB).

[0007] In some embodiments of the present invention, the recombinant strain is a recombinant Escherichia coli, that is, its chassis cell is Escherichia coli, for example, but not limited to, E. coli Origami (DE3), E. coli Origami2 (DE3), E. coli OrigamiB (DE3), E. coli SHuffle T7 and related modified strains.

[0008] In some embodiments of the present invention, the chassis cell is E. coli SHuffle T7.

[0009] In some embodiments of the present invention, the chassis cell is E. coli OrigamiB (DE3).

[0010] Preferably, the recombinant strain also expresses a lytic tag, such as Thioredoxin A (TrxA), Maltose binding protein (MBP), Glutathione S-transferase (GST), small ubiquitin-related modifier (SUMO), NusA (N-utilization substance A), GB1 (B1 domain of Streptococcalprotein G), etc., especially MBP. Specifically, one or more of the aforementioned overexpressed protein encoding genes carry the lytic tag, such as β-1,3-N-acetylglucosamine transferase (LgtA), encoding β1,6-N-acetylglucosamine transferase (GCNT2) with a lytic tag (especially MBP).

[0011] In some embodiments of the present invention, the gene (lgtA) encoding β-1,3-N-acetylglucosamine transferase (LgtA) is derived from Neisseria meningitidis, and its nucleotide sequence is shown in SEQ ID NO:61.

[0012] In some embodiments of the present invention, the gene (lgtB) encoding the β-1,4-galactosyltransferase (LgtB) is derived from Neisseria meningitidis, and its nucleotide sequence is shown in SEQ ID NO:63.

[0013] In some embodiments of the present invention, the gene (gcnt2) encoding β1,6-N-acetylglucosamine transferase (GCNT2) is derived from humans (homo sapiens), and its nucleotide sequence is shown in SEQ ID NO:64.

[0014] In some embodiments of the present invention, the gene (galE) encoding the UDP-glucose 4-epimerase (GalE) is derived from Escherichia coli (E. coli), and its nucleotide sequence is shown in SEQ ID NO:62.

[0015] Specifically, the construction of the recombinant strain includes the use of a dual expression vector system (expression vector I and expression vector II) to overexpress the coding genes of β-1,3-N-acetylglucosamine transferase (LgtA), β-1,4-galactosyl transferase (LgtB), β1,6-N-acetylglucosamine transferase (GCNT2) and UDP-glucose 4-isomerase (GalE); more specifically, expression vector I contains the gene lgtA encoding β-1,3-N-acetylglucosamine transferase (LgtA) and the gene gcnt2 encoding β1,6-N-acetylglucosamine transferase (GCNT2), and expression vector II contains the gene lgtB encoding β-1,4-galactosyl transferase (LgtB) and the gene galE encoding UDP-glucose 4-isomerase (GalE).

[0016] Specifically, the expression vector can be a plasmid, a virus, a phage, a targeted gene editing system (CRISPR / Cas9), etc., in particular a plasmid vector suitable for Escherichia coli protein expression, for example, but not limited to, pET-3a, pET-11a, pET-12a, pET-14b, pET-15b, pET-16b, pET-17b, pET-19b, pET-20b, pET-21a, pET-22b, pET-23a, pET-24a, pET-25b, pET-26b, pET-27b, pET-28a, pET-29a, pET-30b, pET-31b, pET-32c, pET-33d, pET-34d, pET-35e, pET-36f, pET-37b, pET-38c, pET-39d, pET-40e, pET-41d, pET-42e, pET-43d, pET-44e, pET-45e, pET-46f, pET-47f, pET-48e, pET-49f, pET-50f, pET-51f, pET-52f, pET-53f, pET-54f, pET-55f a, pET-31b, pET-32a, pET-33b, pET-34b, pET-35b, pET-37b, pET-39b, pET-40b, pET-41a, pET-42a, pET-43.1a, pET-44a, pET-45b, pET-47b, pET-48b, pET-49b, pET-50b, pET-51b, pET-52b, pETDuet-1, pACYCDuet-1, pCDFDuet-1, pRSFDuet-1, PCOLADuet-1 and their related transformation vectors.

[0017] More specifically, the plasmid of expression vector I can be pETDuet-1, pCOLADuet-1, or pACYCDuet-1; more specifically, the plasmid of expression vector II can be pETDuet-1, pCOLADuet-1, or pACYCDuet-1. In some embodiments of the present invention, the plasmid of expression vector I is pACYCDuet-1, and the plasmid of expression vector II is pETDuet-1; in some embodiments of the present invention, the plasmid of expression vector I is pCOLADuet-1, and the plasmid of expression vector II is pETDuet-1; in some embodiments of the present invention, the plasmid of expression vector I is pCOLADuet-1, and the plasmid of expression vector II is pACYCDuet-1.

[0018] Preferably, the expression vector I also contains a lytic tag, such as TrxA, MBP, GST, SUMO, NusA, GB1, etc., especially MBP; more specifically, the genes lgtA and gcnt2 in the expression vector I are respectively connected to the lytic tags.

[0019] In some embodiments of the present invention, expression vector I is pAC-(MBP)-LgtA-(MBP)-GCNT2, and expression vector II is pET-LgtB-GalE (ST10); in some embodiments of the present invention, expression vector I is pCO-(MBP)-LgtA-(MBP)-GCNT2, and expression vector II is pET-LgtB-GalE (ST11); in some embodiments of the present invention, expression vector I is pCO-(MBP)-LgtA-(MBP)-GCNT2, and expression vector II is pAC-LgtB-GalE (ST15).

[0020] In a second aspect of the present invention, a method for constructing the recombinant strain of the first aspect is provided, comprising the following steps:

[0021] (1) Knockout of genes encoding β-galactosidase (lacZ), glucosamine-6-phosphate deaminase (nagB), and UDP-N-acetylglucosamine 2-epimerase (wecB) in chassis cells;

[0022] (2) Using a dual expression vector system, overexpressing β-1,3-N-acetylglucosamine transferase (LgtA), β-1,4-galactosyl transferase (LgtB), β1,6-N-acetylglucosamine transferase (GCNT2) and UDP-glucose 4-isomerase (GalE) in the cells obtained in step (1).

[0023] In some embodiments of the present invention, step (1) comprises: knocking out the gene (lacZ) encoding β-galactosidase (lacZ) in the chassis cell to obtain the recombinant strain ST1, knocking out the gene (nagB) encoding glucosamine-6-phosphate deaminase (nagB) in ST1 to obtain the recombinant strain ST2, and then knocking out the gene (wecB) encoding UDP-N-acetylglucosamine 2-epimerase (wecB) in ST2 to obtain the recombinant strain ST3. Similarly, those skilled in the art may also appropriately adopt other available knockout sequences.

[0024] Specifically, the chassis cell is Escherichia coli, such as E. coli Origami (DE3), E. coli Origami2 (DE3), E. coli OrigamiB (DE3), E. coli SHuffle T7, especially E. coli SHuffle T7, E. coli Origami B (DE3).

[0025] Specifically, the knockout is performed using the CRISPR / cas9 system.

[0026] In some embodiments of the present invention, the sgRNA used to knock out lacZ is shown in SEQ ID NO:65.

[0027] In some embodiments of the present invention, the sgRNA used to knock out nagB is shown in SEQ ID NO:66.

[0028] In some embodiments of the present invention, the sgRNA used to knock out wecB is shown in SEQ ID NO:67.

[0029] Specifically, the dual expression vector system consists of expression vector I and expression vector II, and the expression vector I and expression vector II are as described in the first aspect.

[0030] In the third aspect of the present invention, a fermentation method of the recombinant strain of the first aspect is provided, which comprises: inoculating the recombinant strain into a fermentation medium for fermentation and culturing.

[0031] Specifically, the fermentation medium can be DM, LB or 2YT medium, especially DM medium.

[0032] Specifically, the inoculation amount of the fermentation culture is 1%-10% (eg, 2%, 4%, 5%, 6%, 8%, 10%).

[0033] Specifically, the fermentation culture temperature can be 30-40°C (such as 32, 34, 35, 36, 37, 38, 39°C), for example 37°C.

[0034] Specifically, the fermentation culture is continued until the fermentation liquid OD 600 It is 0.6-0.8.

[0035] Preferably, the fermentation method further comprises a step of inducing culture after the fermentation culture.

[0036] Specifically, the induction culture includes adding IPTG and lactose, so that the concentration of IPTG in the fermentation system is 0.1-0.5mM (e.g. 0.1, 0.2, 0.3, 0.4, 0.5mM), and the concentration of lactose in the fermentation system is 5-10g / L (e.g. 5, 6, 7, 8, 9, 10g / L).

[0037] Specifically, the induction culture temperature is 15-40°C (e.g., 16, 18, 19, 20, 21, 22, 24, 25, 30, 37°C), for example 15-25°C, especially 20°C.

[0038] Specifically, the induction culture time is more than 24 hours, such as 24-96 hours, 60-84 hours.

[0039] More specifically, the fermentation method comprises the following steps:

[0040] (1) inoculating the recombinant strain into a seed culture medium for culturing;

[0041] (2) The seed solution obtained in step (1) was inoculated into the fermentation medium and cultured by shaking until OD 600 to 0.6-0.8;

[0042] (3) Add IPTG and lactose to the fermentation broth of step (2), and supplement with glycerol to carry out induction culture.

[0043] In the fourth aspect of the present invention, a composition of expression vectors is provided, which includes expression vector I and expression vector II, wherein expression vector I contains gene lgtA encoding β-1,3-N-acetylglucosamine transferase (LgtA) and gene gcnt2 encoding β1,6-N-acetylglucosamine transferase (GCNT2), and expression vector II contains gene lgtB encoding β-1,4-galactosyltransferase (LgtB) and gene galE encoding UDP-glucose 4-isomerase (GalE).

[0044] Specifically, the expression vector can be a recombinant plasmid, for example, pET-3a, pET-11a, pET-12a, pET-14b, pET-15b, pET-16b, pET-17b, pET-19b, pET-20b, pET-21a, pET-22b, pET-23a, pET-24a, pET-25b, pET-26b, pET-27b, pET-28a, pET-29a, pET-30a, pET-31b, pET-32a, pET -33b, pET-34b, pET-35b, pET-37b, pET-39b, pET-40b, pET-41a, pET-42a, pET-43.1a, pET-44a, pET-45b, pET-47b, pET-48b, pET-49b, pET-50b, pET-51b, pET-52b, pETDuet-1, pACYCDuet-1, pCDFDuet-1, pRSFDuet-1, pColaDuet-1.

[0045] More specifically, the plasmid of expression vector I can be pETDuet-1, pCOLADuet-1, or pACYCDuet-1; more specifically, the plasmid of expression vector II can be pETDuet-1, pCOLADuet-1, or pACYCDuet-1. In some embodiments of the present invention, the plasmid of expression vector I is pACYCDuet-1, and the plasmid of expression vector II is pETDuet-1; in some embodiments of the present invention, the plasmid of expression vector I is pCOLADuet-1, and the plasmid of expression vector II is pETDuet-1; in some embodiments of the present invention, the plasmid of expression vector I is pCOLADuet-1, and the plasmid of expression vector II is pACYCDuet-1.

[0046] Preferably, the expression vector I also contains a lytic tag, such as Trx, MBP, GST, SUMO, NusA, GB1, etc., especially MBP; more specifically, the genes lgtA and gcnt2 in the expression vector I are respectively connected to the lytic tags.

[0047] In some embodiments of the present invention, expression vector I is pAC-(MBP)-LgtA-(MBP)-GCNT2, and expression vector II is pET-LgtB-GalE (ST10); in some embodiments of the present invention, expression vector I is pCO-(MBP)-LgtA-(MBP)-GCNT2, and expression vector II is pET-LgtB-GalE (ST11); in some embodiments of the present invention, expression vector I is pCO-(MBP)-LgtA-(MBP)-GCNT2, and expression vector II is pAC-LgtB-GalE (ST15).

[0048] Specifically, the composition may also include a molecular chaperone plasmid, such as pGro7.

[0049] In a fifth aspect of the present invention, a kit for constructing a recombinant strain for producing LNnH is provided, which comprises the expression vector composition described in the fourth aspect.

[0050] Specifically, the kit also contains other reagents required for constructing the recombinant strain, such as primers, Taq polymerase, dNTP, Mg 2+ , buffer, culture medium, etc.

[0051] In a sixth aspect of the present invention, a recombinant Escherichia coli expressing GCNT2 is provided, which is obtained by transforming and introducing an expression vector containing a GCNT2 coding gene into chassis cells.

[0052] Specifically, the chassis cell is Escherichia coli, for example, but not limited to, E. coli Origami (DE3), E. coli Origami2 (DE3), E. coli OrigamiB (DE3), E. coli SHuffle T7, especially E. coli SHuffle T7, E. coli Origami B (DE3).

[0053] Specifically, the expression vector is a plasmid, for example, but not limited to, pET-3a, pET-11a, pET-12a, pET-14b, pET-15b, pET-16b, pET-17b, pET-19b, pET-20b, pET-21a, pET-22b, pET-23a, pET-24a, pET-25b, pET-26b, pET-27b, pET-28a, pET-29a, pET-30a, pET-31b, pET-32a, pET-33b, In some embodiments of the present invention, the expression vector is pET-32a.

[0054] In some embodiments of the present invention, the chassis cells (such as E. coli Origami B (DE3)) are also transformed with a molecular chaperone plasmid (such as pGro7).

[0055] More specifically, the recombinant Escherichia coli is constructed by a method comprising the following steps: synthesizing the GCNT2 encoding gene sequence, connecting it with an expression vector (especially a plasmid vector, such as pET-32a) to obtain a recombinant vector; transforming the recombinant vector into chassis cells (such as E. coli SHuffle T7, E. coli Origami B (DE3)) to obtain recombinant Escherichia coli.

[0056] In the seventh aspect of the present invention, a method for constructing the recombinant Escherichia coli described in the sixth aspect is provided, which comprises the following steps: transforming and introducing an expression vector containing a GCNT2 encoding gene into chassis cells.

[0057] In some embodiments of the present invention, the method comprises transforming a molecular chaperone plasmid (such as pGro7) and an expression vector comprising a GCNT2 encoding gene into chassis cells (such as E. coli Origami B (DE3)).

[0058] More specifically, the construction method includes the following steps: synthesizing the GCNT2 encoding gene sequence, connecting it with an expression vector (especially a plasmid vector, such as pET-32a) to obtain a recombinant vector; transforming the recombinant vector into chassis cells (such as E. coli SHuffle T7, E. coli Origami B (DE3)) to obtain recombinant Escherichia coli.

[0059] In the eighth aspect of the present invention, a method for synthesizing human milk oligosaccharide LNnH is provided, which includes overexpressing β-1,3-N-acetylglucosamine transferase (LgtA), β-1,4-galactosyl transferase (LgtB), β1,6-N-acetylglucosamine transferase (GCNT2) and UDP-glucose 4-isomerase (GalE) in chassis cells, and knocking out genes encoding β-galactosidase (lacZ), glucosamine-6-phosphate deaminase (nagB) and UDP-N-acetylglucosamine 2-isomerase (wecB) to obtain a recombinant strain producing branched human milk oligosaccharide LNnH.

[0060] Specifically, the method comprises the following steps:

[0061] (1) Knockout of genes encoding β-galactosidase (lacZ), glucosamine-6-phosphate deaminase (nagB), and UDP-N-acetylglucosamine 2-epimerase (wecB) in chassis cells;

[0062] (2) Using a dual expression vector system, overexpressing β-1,3-N-acetylglucosamine transferase (LgtA), β-1,4-galactosyl transferase (LgtB), β1,6-N-acetylglucosamine transferase (GCNT2) and UDP-glucose 4-isomerase (GalE) in the cells obtained in step (1).

[0063] In some embodiments of the present invention, step (1) comprises: knocking out the gene (lacZ) encoding β-galactosidase (lacZ) in the chassis cell to obtain the recombinant strain ST1, knocking out the gene (nagB) encoding glucosamine-6-phosphate deaminase (nagB) in ST1 to obtain the recombinant strain ST2, and then knocking out the gene (wecB) encoding UDP-N-acetylglucosamine 2-epimerase (wecB) in ST2 to obtain the recombinant strain ST3. Similarly, those skilled in the art may also appropriately adopt other available knockout sequences.

[0064] In some embodiments of the present invention, the chassis cell is Escherichia coli, such as, but not limited to, E. coli Origami (DE3), E. coli Origami2 (DE3), E. coli OrigamiB (DE3), E. coli SHuffle T7.

[0065] In some embodiments of the present invention, the chassis cell is E. coli SHuffle T7.

[0066] In some embodiments of the present invention, the chassis cell is E. coli Origami B (DE3).

[0067] Specifically, the dual expression vector system consists of expression vector I and expression vector II, and the expression vector I and expression vector II are as described in the first aspect.

[0068] Specifically, the method further comprises: (3) inoculating the recombinant strain into a fermentation medium for fermentation culture, and then inducing culture, as described in the third aspect of the present invention.

[0069] Specifically, the method may further include: (4) separating and extracting the induced culture fluid obtained in step (3) to obtain branched human milk oligosaccharide LNnH.

[0070] In some embodiments of the present invention, the method comprises the steps of fermenting and inducing the recombinant strain described in the first aspect of the present invention, as described in the third aspect of the present invention.

[0071] In the ninth aspect of the present invention, there is provided use of the recombinant strain described in the first aspect, the fermentation method described in the third aspect, and the method described in the eighth aspect in preparing branched oligosaccharides.

[0072] Specifically, the branched oligosaccharide may be a double-branched, triple-branched or quadruple-branched oligosaccharide.

[0073] Specifically, the branched oligosaccharide can be a branched human milk oligosaccharide (e.g., a heptaose, an octaose, a decaose, an undecaose, a dodecaose, a tridecaose, a tetradecaose) modified by fucosylation or sialylation, such as the branched human milk oligosaccharides obtained by de(R)protection of human milk oligosaccharide structures 6-10, 12, 14, 15, 17, 19-34 shown in “Li Y, Li Y, Guo Y, Chen C, Yang L, Jiang Q, Ling P, Wang S, Li L, Fang J. Enzymatic modular synthesis of asymmetrically branched human milk oligosaccharides. Carbohydr Polym. 2024 Jun 1; 333: 121908.”

[0074] In some embodiments of the present invention, the branched oligosaccharide is difucosyllactoyl-N-neohexose, disialylactoyl-N-neohexose, monofucosyllactoyl-N-neohexose, monosialylactoyl-N-neohexose, as shown below:

[0075]

[0076] Specifically, the branched oligosaccharide is synthesized with LNnH as the core structure, using any suitable method known in the prior art, such as a chemical method, an enzymatic method, or a combination thereof (for example, as described in “Li Y, Li Y, Guo Y, Chen C, Yang L, Jiang Q, Ling P, Wang S, Li L, Fang J. Enzymatic modular synthesis of asymmetrically branched human milk oligosaccharides. Carbohydr Polym. 2024 Jun 1; 333: 121908.”).

[0077] The present invention provides a whole-cell synthesis method of human milk oligosaccharide LNnH, which has low cost, high efficiency and is conducive to industrial production. In addition, LNnH is a hexasaccharide core structure of branched HMOs, and the method provided by the present invention will help fill the gap in branched HMOs biosynthesis technology and promote the research and development of branched HMOs. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figure 1The figure shows the heterologous expression and activity detection of GCNT2; wherein, A: GCNT2 catalytic activity analysis; B: SDS-PAGE analysis of enzyme element GCNT2; C: activity detection of GCNT2 heterologously expressed in E.coli Origami B (DE3), Line 1: LNnT standard; Line 2: reaction solution, wherein the catalytic substrate is LNnT; Line 3: reaction solution, wherein the catalytic substrate is LNT; Line 4: UDP-GlcNAc standard; Line 5: LNT standard; D: activity detection of GCNT2 heterologously expressed in E.coli SHuffle T7, Line 1: UDP-GlcNAc standard; Line 2: LNT standard; Line 3: LNnT standard; Line 4: reaction solution, wherein the catalytic substrate is LNT; Line 5: reaction solution, wherein the catalytic substrate is LNnT.

[0079] Figure 2 Shown is a schematic diagram of the construction of the LNnH biosynthetic pathway in Escherichia coli.

[0080] Figure 3 The HPLC and Q-TOF MS analysis results of the compound LNnH are shown; wherein, A: HPLC analysis results of the intracellular fermentation product of strain ST4, (a) LNT II standard; (b) LNnT standard; (c) LNP standard; (d) intracellular fermentation product; B: Q-TOF MS spectrum of LNnH.

[0081] Figure 4 The results of the experiment of optimizing gene expression intensity to enhance the synthesis of LNnH are shown. A: The production of LNnH was detected after optimizing the copy number of key genes; B: The OD values ​​of six strains were monitored during shake flask fermentation. 600 .

[0082] Figure 5 Shown are the experimental results of increasing the soluble expression of lgtA and gcnt2 to promote the synthesis of LNnH.

[0083] Figure 6 The figure shows the effect of different fermentation culture conditions on the production of LNnH; A: the effect of different induction temperatures on the production of LNnH; B: the effect of the type of fermentation medium on the production of LNnH.

[0084] Figure 7 Shown are the results of fermentation of branched human milk oligosaccharide LNnH by recombinant strain ST15 in a 5L fermentor. DETAILED DESCRIPTION

[0085] Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as commonly understood by one of ordinary skill in the art to which the present invention relates.

[0086]

[00136] Various publications, patents, and published patent specifications are cited herein, the disclosures of which are incorporated by reference in their entireties.

[0087] The term "overexpression" refers to the process in which the expression level of a gene exceeds its expression level under normal physiological conditions. This phenomenon is usually achieved through genetic engineering technology, such as inserting the target gene into the host cell through an overexpression vector to make it overexpressed in the cell.

[0088] The term "knockout" refers to the removal of a gene from the genome of an organism or its inactivation through genetic engineering techniques. This technique is usually achieved through homologous recombination, that is, the homologous sequences between the exogenous gene and the target gene recombine, resulting in the inactivation of the target gene.

[0089] The term "oligosaccharide", also known as oligosaccharide or oligosaccharide, is a straight-chain or branched carbohydrate compound formed by 2-20 identical or different monosaccharide units connected by glycosidic bonds.

[0090] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0091] The strains, plasmids, primers, gene sequences, etc. used in the following examples are shown in the following table.

[0092] Table 1 Strains

[0093]

[0094]

[0095] Table 2 Plasmids

[0096]

[0097]

[0098] Table 3 Primers

[0099]

[0100]

[0101]

[0102] Table 4 Gene sequence

[0103]

[0104] Table 5 sgRNA

[0105] sgRNA Sequence (5'-3') SEQ ID NO: sgRNA-lacZ CTGACAATGGCAGATCCCAG 65 sgRNA-nagB GTTCACGCAACCTTCAACGG 66 sgRNA-wecB ACAAACGGTAAATACTCCTG 67

[0106] Example 1: Heterologous expression and activity detection of β1,6-N-acetylglucosamine transferase (GCNT2)

[0107] The inventors previously used the Pichia pastoris eukaryotic protein expression system to achieve soluble expression of GCNT2 (as described in "Li Y, Li Y, Guo Y, Chen C, Yang L, Jiang Q, Ling P, Wang S, Li L, Fang J. Enzymatic modular synthesis of asymmetrically branched human milkoligosaccharides. Carbohydr Polym. 2024 Jun 1; 333: 121908."), but the eukaryotic protein expression system has the defects of low expression level, high cost and long cycle in the process of recombinant protein expression. The inventors hope to achieve the activity and soluble expression of GCNT2 in Escherichia coli, which is more advantageous in industry. It was found through experiments that some strains are unavailable. For example, in E. coli BL21 (DE3), GCNT2 protein expression cannot be achieved by replacing expression vectors such as pET-32a, pGEX-4T-1, and pCOLD TF. After experimental screening, the inventors achieved the expression of GCNT2 in E. coli SHuffle T7, which has more industrial advantages.

[0108] (1) The human gcnt2 (Uniprot: Q8N0V5-2) gene (encoding amino acids 26-400) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and constructed into the pET-32a vector. The plasmid pET-32a-GCNT2 was introduced into E. coli SHuffle T7 by transformation and spread onto an LB plate containing 100 μg / mL ampicillin (Amp) resistance, and positive clones were screened by colony PCR. The E. coli SHuffle T7 engineered bacteria transformed with the recombinant plasmid were cultured overnight and inoculated into LB medium containing 100 μg / mL Amp at a 1% inoculum, and cultured with shaking at 37°C and 220 rpm. When OD 600When the p-value was between 0.6 and 0.8, 0.2 mM isopropyl β-D-thiogalactoside (IPTG) was added to the culture medium, and the expression of the recombinant protein was induced at 16°C. After 20 h, the cells were collected by centrifugation at 8,000 rpm for 8 min and ultrasonically disrupted, and then the bacterial solution was centrifuged at 4°C and 12,000 rpm for 30 min, and the supernatant was collected for affinity chromatography purification.

[0109] The results of SDS-PAGE analysis of GCNT2 are shown in Figure 1 As shown in B, it shows that the efficient expression of GCNT2 in Escherichia coli was finally achieved, and the protein expression level reached 10 mg / L.

[0110] (2) In order to explore whether GCNT2 can be expressed soluble in other Escherichia coli, E. coli Origami B (DE3) was further selected for heterologous expression. The molecular chaperone plasmid pGro7 and pET-32a-GCNT2 were transformed into E. coli Origami B (DE3) and induced for expression. The E. coli Origami B (DE3) engineered bacteria transformed with the recombinant plasmid were cultured overnight and inoculated into LB medium containing 100 μg / mL Amp and 35 μg / mL chloramphenicol (Cm) at a 1% inoculation rate, and cultured at 37°C and 220 rpm with shaking. When OD 600 When the pH value was between 0.6 and 0.8, 0.2 mM isopropyl β-D-thiogalactoside (IPTG) and 1 g / L arabinose were added to the culture medium, and the expression of the recombinant protein was induced by continuing the culture at 16° C. Purification was performed according to the above purification steps.

[0111] The activity of recombinant GCNT2 protein was determined according to the following reaction system: 100 mM pH 9.0 Glycine-NaOH buffer, 5 mM UDP-GlcNAc, 3 mM LNnT (Galβ1, 4GlcNAc-β1, 3Gal-β1, 4Glc) or LNT (Galβ1, 3GlcNAc-β1, 3Gal-β1, 4Glc) and 4 mg / mL GCNT2. The reaction was carried out at 30°C for 12 h, and the reaction substrate consumption and product formation were monitored by thin layer chromatography (TLC).

[0112] TLC results are as follows Figure 1 C and Figure 1As shown in D, GCNT2 heterologously expressed in E. coli SHuffle T7 and E. coli Origami B (DE3) can use LNnT and LNT as receptors to add β1,6-GlcNAc branches, among which GCNT2 has better catalytic activity for substrate LNnT and poorer catalytic activity for substrate LNT. Therefore, subsequent research will be carried out based on the fact that GCNT2 has better catalytic activity for LNnT.

[0113] Example 2: Construction of an E. coli system using synthetic biology to efficiently produce branched human milk oligosaccharide lactoyl-N-neohexaose

[0114] Construction of the LNnH biosynthetic pathway in Escherichia coli Figure 2 shown.

[0115] (1) CRISPR / Cas9 system-mediated gene editing

[0116] Taking the knockout of lacZ in E.coli SHuffle T7 as an example, the gene knockout operation process of this study is briefly described.

[0117] The genome of E.coli SHuffle T7 strain carries spectinomycin gene. For effective screening, the resistance gene of plasmid pTarget-F was replaced from spectinomycin (spe) to chloramphenicol (Cm). The pCas plasmid was introduced into competent E.coli SHuffle T7 through transformation. When single colonies grew on the plate, positive clones were picked to prepare electroporation competent cells. In the early stage of competent cell growth, 30mM L-arabinose was added to induce pCas to express λ-Red recombinant protein. 200ng of targeting plasmid pTargetF-lacZ and 1500ng of lacZ repair template Template-lacZ were mixed and added to the prepared E.coli SHuffle T7 competent cells containing pCas plasmid to complete electroporation. After electroporation, the cells were spread on LB plates containing kanamycin (Kan) and Cm and cultured at 30℃ for 20-30h. When a single colony grows on the plate, colony PCR verification is performed, and positive clones are screened and inoculated into LB liquid culture medium. IPTG and kanamycin are added, and the pTargetF-lacZ plasmid is eliminated by culturing at 30°C overnight, and then the pCas plasmid is removed by culturing at 37°C overnight to complete the knockout of the lacZ gene and obtain strain ST1 (E. coli SHuffle T7ΔlacZ).

[0118] The knockout of other genes was also carried out according to the above process. To knock out different genes, it was only necessary to replace the targeting plasmid and repair template corresponding to a certain knockout gene (the targeting plasmid, repair template, and sgRNA used for knockout are shown in Tables 2 and 5), and strains ST2 (E. coli SHuffle T7ΔlacZΔnagB) and ST3 (E. coli SHuffle T7ΔlacZΔnagBΔwecB) were obtained respectively.

[0119] (2) Construction of the starting strain for LNnH synthesis

[0120] As mentioned above, the CRISPR / cas9 system was used to knock out three genes encoding β-galactosidase (lacZ), glucosamine-6-phosphate deaminase (nagB) and UDP-N-acetylglucosamine 2-isomerase (wecB) in E. coli SHuffle T7 to obtain the starting strain ST3.

[0121] The gene gcnt2 encoding β-1,6-N-acetylglucosamine transferase and the gene lgtA encoding β-1,3-N-acetylglucosamine transferase were inserted into the plasmid pETDuet-1 by seamless cloning technology to obtain the plasmid pET-LgtA-(TrxA)-GCNT2; the lgtB encoding β-1,4-galactosyltransferase and the galE encoding UDP-glucose 4-epimerase were inserted into the plasmid pCOLADuet-1 to obtain the plasmid pCO-LgtB-GalE. The plasmid pET-LgtA-(TrxA)-GCNT2 and the plasmid pCO-LgtB-GalE were introduced into the strain ST3 by electroporation to obtain the strain ST4.

[0122] The strain ST4 was cultured in a shake flask. After 72 hours of induction culture, the cells were collected, boiled for 15 minutes, and centrifuged at 10,000 rpm for 15 minutes to collect the supernatant.

[0123] The supernatant was subjected to HPLC ( Figure 3 A) and Q-TOF MS( Figure 3 B) The test proved that the branched human milk oligosaccharide LNnH was successfully obtained with a yield of 1.0 mg / L.

[0124] The fermentation conditions were as follows:

[0125] E. coli shake flask fermentation conditions: Take a single colony and inoculate it into 5 mL LB medium, culture at 37°C for 12-14 hours to obtain seed culture solution. Inoculate it into 50 mL fermentation medium at a 2% inoculum volume, and culture at 37°C, 220 rpm until OD 600To 0.6-0.8, add IPTG with a final concentration of 0.2mM and 10g / L lactose, add glycerol during the period, and collect the bacteria after induction culture at 20℃ for 72h.

[0126] E. coli fermentation medium (DM): glycerol 20g / L, KH 2 PO 4 13.5 g / L, (NH 4 ) 2 HPO 4 4.0g / L, MgSO 4 7H 2 O1.4g / L, citric acid 1.7g / L, trace element solution (FeSO 4 7H 2 O 10.0g / L, CaCl 2 2.0g / L, ZnSO 4 7H 2 O 2.2g / L, MnSO 4 ·H 2 O 0.38g / L, CuSO 4 ·5H 2 O 1.0g / L, (NH 4 ) 6 Mo 7 O 24 ·4H 2 O 0.1g / L and Na 2 B 4 O 7 10H 2 O 0.02 g / L, dissolved in 5 M HCl) 10.0 mL / L, 4.5 mg / L thiamine, 3 g / L yeast extract, pH 7.0 (see Zhu, Y.; Wan, L.; Meng, J.; Luo, G.; Chen, G.; Wu, H.; Zhang, W.; Mu, W., Metabolic Engineering of Escherichia coli for Lacto-N-triose II Production with High Productivity. J Agric Food Chem 2021, 69(12), 3702-3711.).

[0127] Example 3: Optimizing gene expression intensity to increase LNnH production

[0128] Overexpression of galE, lgtB, lgtA, and gcnt2 can achieve the biosynthesis of branched human milk oligosaccharide LNnH, but the yield of LNnH is low. Balancing the expression intensity of the four key genes may be beneficial for improving the yield of LNnH.

[0129] In this study, the expression intensity of genes was further adjusted by the copy number of plasmids, and three plasmids with different copy numbers were selected, including pETDuet-1 (copy number ~40), pCOLADuet-1 (copy number 20-40) and pACYCDuet-1 (copy number 10-12). The genes lgtA and gcnt2 were constructed on the same vector, and lgtB and galE were constructed on the same vector, and a total of six plasmids were obtained, namely pET-LgtA-(TrxA)-GCNT2, pCO-LgtA-(TrxA)-GCNT2, pAC-LgtA-(TrxA)-GCNT2, pET-LgtB-GalE, pCO-LgtB-GalE and pAC-LgtB-GalE. The above plasmids were combined in pairs and the plasmid combinations with the same replicon were deleted, and finally 6 combinations were obtained. The 6 plasmid combinations were introduced into strain ST3 respectively to obtain recombinant strains ST4-ST9.

[0130] Strains ST4-ST9 were cultured in shake flasks and tested by HPLC according to the method described in Example 2.

[0131] Test results such as Figure 4 After optimizing the gene expression intensity, strain ST8 had the highest yield (1.28 mg / L), and its plasmid combination was pET-LgtA-(TrxA)-GCNT2 and pAC-LgtB-GalE.

[0132] Example 4: Improving the soluble expression of key genes lgtA and gcnt2

[0133] After optimizing the gene expression intensity, the production of LNnH only increased by 0.28 times. In order to further improve the synthesis efficiency of LNnH, the LNnH synthesis pathway was analyzed, and it was speculated that increasing the production level of LNT II (GlcNAc-β1,3Gal-β1,4Glc) and branched pentasaccharide LNP (Galβ1,4GlcNAc-β1,3(GlcNAc-β1,6)Gal-β1,4Glc) would be an important strategy to improve LNnH synthesis.

[0134] By seamless cloning technology, the maltose binding protein (MBP) lytic protein gene was added to the genes lgtA and gcnt2 on the basis of the three recombinant plasmids (pET-LgtA-(TrxA)-GCNT2, pCO-LgtA-(TrxA)-GCNT2 and pAC-LgtA-(TrxA)-GCNT2) obtained, respectively, to obtain three new recombinant plasmids, namely pET-(MBP)-LgtA-(MBP)-GCNT2, pCO-(MBP)-LgtA-(MBP)-GCNT2 and pAC-(MBP)-LgtA-(MBP)-GCNT2. For the convenience of recording, the above three plasmids were named pET-MAMG, pCO-MAMG and pAC-MAMG respectively. According to the combination method described in Example 3, these three plasmids were combined with pET-LgtB-GalE, pCO-LgtB-GalE, and pAC-LgtB-GalE to obtain a total of 6 plasmid combinations. The 6 plasmid combinations were respectively introduced into strain ST3 to obtain strains ST10-ST15.

[0135] Strains ST10-ST15 were cultured in shake flasks and tested by HPLC according to the method described in Example 2.

[0136] Test results such as Figure 5 As shown. After adding the lytic tag protein MBP, the LNnH production of each strain was higher than that of strain ST8, among which the strain ST15 with the plasmid combination of pCO-MAMG and pAC-LgtB-GalE had the highest production, reaching 21 mg / L, which was 15 times higher than that of strain ST8 and 20 times higher than that of strain ST4. The results show that the addition of the lytic tag protein MBP to the key enzyme elements LgtA and GCNT2 can better promote the synthesis of LNnH.

[0137] Example 5: Optimizing fermentation conditions

[0138] The induction temperature of fermentation culture is a key factor in the biosynthesis of LNnH. The recombinant strain ST15, which is the best at producing LNnH, was selected to optimize the induction conditions.

[0139] During the ST15 fermentation culture, different induction temperatures (16°C, 20°C, 25°C and 30°C, the culture medium was DM medium) and types of fermentation medium (DM medium, LB and 2YT, the induction temperature was 20°C) were selected to optimize the culture conditions.

[0140] The results are as follows Figure 6As shown in the figure, when the induction temperature is higher than 25°C, the remaining amount of LNnT is much higher than the content of LNnH, which means that too high an induction temperature may affect the soluble expression and catalytic activity of the protein GCNT2, thereby resulting in a decrease in the production of branched hexasaccharide LNnH. For the type of fermentation medium, the richer the nutrients, the higher the production of LNnH. The nutrients in 2YT are the richest among the three mediums. During the fermentation culture, OD 600 The value of was also the highest, but the yield of LNnH was not as high as that in DM medium. After optimization of fermentation conditions, the best conditions for synthesizing LNnH were an induction temperature of 20°C, DM medium for fermentation, and a LNnH yield of 20 mg / L±1 mg / L.

[0141] Example 6: 5L fermentation tank fermentation culture

[0142] In order to detect the ability of recombinant strain ST15 to produce LNnH under high-density fermentation conditions, the recombinant strain ST15 was fermented in a 5L fermenter according to the optimized fermentation conditions, and the pH-stat mode was used for fed-batch fermentation. The pH-stat mode (Kim, BS; Lee, SC; Lee, SY; Chang, YK; Chang, HN, High cell density fed-batch cultivation of Escherichia coli using exponentialfeeding combined with pH-stat. Bioprocess Biosyst Eng 2004, 26 (3), 147-50.) refers to a feedback control mode that monitors the pH value in the culture medium and adjusts the speed of the substrate flowing into the culture medium according to the program instructions to maintain a stable pH value.

[0143] Fermentation data such as Figure 7 As shown, the seed culture solution was inoculated at 10% inoculum and fermented in DM medium at 37°C for 17 h. 600 The fermentation temperature was about 20, at which time the fermentation temperature was lowered to 20°C, IPTG with a final concentration of 0.2mM and lactose with a final concentration of 10g / L were added, and the lactose content was monitored during the fermentation process. When the lactose content was lower than 5g / L, 12.5g lactose was added. During the entire fermentation process, the program instructions were set to reasonably adjust the feed ratio of glycerol (800g / L) and organic nitrogen source (100g / L peptone, 50g / L yeast extract). Finally, after 78h of fermentation, the yield of LNnH reached 173mg / L, which is 8.65 times that of shake flask fermentation culture, and has a good prospect for industrial application.

[0144] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

[0145] The aforementioned embodiments and methods described in the present invention may be varied based on the ability, experience and preference of those skilled in the art.

[0146] In the present invention, merely listing the steps of the method in a certain order does not constitute any limitation on the order of the method steps.

Claims

1. A recombinant strain for efficiently producing branched human milk oligosaccharide lacto-N-neohexaose (LNnH, Galβ1,4GlcNAcβ1,3(Galβ1,4GlcNAcβ1,6)Galβ1,4Glc), which overexpresses β-1,3-N-acetylglucosamine transferase (LgtA), β-1,4-galactosyltransferase (LgtB), β1,6-N-acetylglucosamine transferase (GCNT2) and UDP-glucose 4-epimerase (GalE), and knocks out genes encoding β-galactosidase (lacZ), glucosamine-6-phosphate deaminase (nagB) and UDP-N-acetylglucosamine 2-epimerase (wecB); Preferably, the recombinant strain is a recombinant Escherichia coli, preferably selected from: Escherichia coli Origami (DE3), E. coli Origami2 (DE3), E. coli OrigamiB (DE3), E. coli SHuffle T7, more preferably E. coli SHuffle T7 or E. coli OrigamiB (DE3).

2. The recombinant strain according to claim 1, characterized in that The encoding gene (lgtA) of the β-1,3-N-acetylglucosamine transferase (LgtA) is shown in SEQ ID NO:61; and / or, the encoding gene (lgtB) of the β-1,4-galactosyl transferase (LgtB) is shown in SEQ ID NO:63; and / or, the encoding gene (gcnt2) of the β1,6-N-acetylglucosamine transferase (GCNT2) is shown in SEQ ID NO:64; and / or, the encoding gene (galE) of the UDP-glucose 4-isomerase (GalE) is shown in SEQ ID NO:

62.

3. The recombinant strain according to claim 1 or 2, characterized in that The recombinant strain also expresses a lytic tag; Preferably, the lytic tag is selected from: one or more of TrxA, MBP, GST, SUMO, NusA, GB1, more preferably MBP.

4. A method for constructing a recombinant strain according to any one of claims 1 to 3, comprising the following steps: (1) Knockout of genes encoding β-galactosidase (lacZ), glucosamine-6-phosphate deaminase (nagB), and UDP-N-acetylglucosamine 2-epimerase (wecB) in chassis cells; (2) Using a dual expression vector system, overexpress β-1,3-N-acetylglucosamine transferase (LgtA), β-1,4-galactosyl transferase (LgtB), β1,6-N-acetylglucosamine transferase (GCNT2) and UDP-glucose 4-isomerase (GalE) in the gene knockout chassis cells obtained in step (1).

5. The construction method according to claim 4, characterized in that: The dual expression vector system consists of expression vector I and expression vector II, wherein expression vector I contains gene lgtA encoding β-1,3-N-acetylglucosamine transferase (LgtA) and gene gcnt2 encoding β1,6-N-acetylglucosamine transferase (GCNT2), and expression vector II contains gene lgtB encoding β-1,4-galactosyl transferase (LgtB) and gene galE encoding UDP-glucose 4-epimerase (GalE).

6. The construction method according to claim 5, characterized in that: The expression vector I is a plasmid selected from: pETDuet-1, pCOLADuet-1, pACYCDuet-1; the expression vector II is a plasmid selected from: pETDuet-1, pCOLADuet-1, pACYCDuet-1; Preferably, the plasmid of the expression vector I is pACYCDuet-1, and the plasmid of the expression vector II is pETDuet-1; Preferably, the plasmid of the expression vector I is pCOLADuet-1, and the plasmid of the expression vector II is pETDuet-1; Preferably, the plasmid of the expression vector I is pCOLADuet-1, and the plasmid of the expression vector II is pACYCDuet-1.

7. The construction method according to claim 5, characterized in that: The expression vector I also includes a solubility-promoting tag; Preferably, the lytic tag is selected from: one or more of TrxA, MBP, GST, SUMO, NusA, GB1, more preferably MBP; Preferably, the genes lgtA and gcnt2 in the expression vector I are connected to lytic tags respectively; More preferably, the expression vector I is pAC-(MBP)-LgtA-(MBP)-GCNT2, and the expression vector II is pET-LgtB-GalE; or, the expression vector I is pCO-(MBP)-LgtA-(MBP)-GCNT2, and the expression vector II is pET-LgtB-GalE; or, the expression vector I is pCO-(MBP)-LgtA-(MBP)-GCNT2, and the expression vector II is pAC-LgtB-GalE.

8. A fermentation method of the recombinant strain according to any one of claims 1 to 3, comprising: inoculating the recombinant strain into a fermentation medium for fermentation and culturing; Preferably, the fermentation medium is DM, LB or 2YT medium, especially DM medium; Preferably, the fermentation method further comprises the step of inducing culture. More preferably, the induction culture comprises adding IPTG and lactose; More preferably, the induction culture temperature is 15-40°C, such as 15-25°C, especially 20°C.

9. An expression vector composition, comprising expression vector I and expression vector II, wherein: Expression vector I contains the gene lgtA encoding β-1,3-N-acetylglucosamine transferase (LgtA) and the gene gcnt2 encoding β1,6-N-acetylglucosamine transferase (GCNT2), and expression vector II contains the gene lgtB encoding β-1,4-galactosyltransferase (LgtB) and the gene galE encoding UDP-glucose 4-epimerase (GalE); Preferably, the expression vector I is a plasmid selected from: pETDuet-1, pCOLADuet-1, pACYCDuet-1; the expression vector II is a plasmid selected from: pETDuet-1, pCOLADuet-1, pACYCDuet-1; Preferably, the expression vector I further comprises a solubility-promoting tag; Preferably, the lytic tag is selected from: one or more of TrxA, MBP, GST, SUMO, NusA, GB1, more preferably MBP; Preferably, the genes lgtA and gcnt2 in the expression vector I are connected to lytic tags respectively; More preferably, the expression vector I is pAC-(MBP)-LgtA-(MBP)-GCNT2, and the expression vector II is pET-LgtB-GalE; or, the expression vector I is pCO-(MBP)-LgtA-(MBP)-GCNT2, and the expression vector II is pET-LgtB-GalE; or, the expression vector I is pCO-(MBP)-LgtA-(MBP)-GCNT2, and the expression vector II is pAC-LgtB-GalE. 10 . A kit for constructing a recombinant strain for producing branched human milk oligosaccharide LNnH, comprising the expression vector composition according to claim 9 .

11. A recombinant Escherichia coli expressing GCNT2, which is obtained by transforming and introducing an expression vector containing a GCNT2 coding gene into chassis cells; Preferably, the chassis cells are selected from: E. coli Origami (DE3), E. coli Origami2 (DE3), E. coli OrigamiB (DE3), E. coli SHuffle T7, more preferably E. coli SHuffle T7 or E. coli Origami B (DE3).

12. A method for synthesizing branched human milk oligosaccharide LNnH, comprising the steps of fermenting and inducing the recombinant strain according to any one of claims 1 to 3 or the steps of the fermentation method according to claim 8.

13. Use of the recombinant strain according to any one of claims 1 to 3, the fermentation method according to claim 8 or the method according to claim 12 in the preparation of branched oligosaccharides; Preferably, the branched oligosaccharide is a branched human milk oligosaccharide modified by fucosylation or sialylation; More preferably, the branched oligosaccharide is difucosyllactyl-N-neohexose, disialylactyl-N-neohexose, monofucosyllactyl-N-neohexose and monosialylactyl-N-neohexose, which have the following structures respectively:

Images