T7 RNA polymerase mutant and application thereof

Abstract

The invention relates to a T7RNA polymerase mutant and application thereof. Compared with a wild type T7RNA polymerase, the T7RNA polymerase mutant has the following mutations: P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I and F880Y, and the T7RNA polymerase mutant has the following mutations: P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I and F880Y. Or, on the basis of the mutation, at least one of the following mutations: S43Y, G47A and S641A can also exist. The T7RNA polymerase mutant provided by the invention can be used for identifying and doping one or more nucleotide substrates in rNTPs, 2 '-F-dNTPs and dNTPs, so that a single-stranded DNA molecule, a fluorinated RNA molecule and a perfluorinated DNA molecule are efficiently synthesized in vitro.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a T7 RNA polymerase mutant and application thereof. Background Art

[0002] As an indispensable basic technology in the field of synthetic biology, single-stranded nucleic acid synthesis technology has a potential impact on fields such as molecular diagnosis and biomedicine, comparable to the supporting role of sequencing technology in genomics. The solid-phase chemical synthesis method is already very mature and is currently the mainstream method for synthesizing short-chain oligonucleotides. However, it has disadvantages such as difficulty in synthesizing long-chain nucleotides, cumbersome experimental operations, high consumption of chemical reagents, and environmental pollution.

[0003] In addition to chemical methods, biological enzymatic methods are also an important method for synthesizing single-stranded nucleic acids. Among the enzymatic synthesis methods, the asymmetric PCR (aPCR) method is simple and fast, but it is prone to nonspecific amplification and by-products, and there is a problem of impure products.

[0004] T7 RNA polymerase (T7 RNAP) is a single-subunit polymerase that was first isolated from Escherichia coli infected with bacteriophage T7 in 1970. As an important and efficient tool enzyme, it plays an important role in many key links such as gene expression, transcriptional regulation and RNA synthesis. Especially in the field of RNA synthesis, through in vitro transcription technology, T7 RNA polymerase can synthesize RNA molecules of specific sequences, providing important technical support for the study of RNA structure and function, the development of RNA interference technology and the research and development of RNA vaccines.

[0005] However, the function of wild-type T7 RNA polymerase is limited. Some T7 RNA polymerase mutants with improved substrate specificity have been reported in the prior art, which can be used to synthesize modified nucleic acid molecules. However, it still has the following problems: when more C2' chemically modified nucleotide substrates are incorporated, the catalytic efficiency of the mutant is significantly reduced. In particular, when all nucleotides are introduced with chemical modifications, the synthesis efficiency often reaches the lowest, and the length of the synthetic product is also limited, making it difficult to synthesize full-length transcripts. Summary of the invention

[0006] The object of the present invention is to provide a T7 RNA polymerase mutant and its application. The T7 RNA polymerase mutant can be used to synthesize single-stranded DNA molecules, fluorinated RNA molecules and perfluorinated DNA molecules in vitro and has a high transcription efficiency.

[0007] To this end, in a first aspect, the present invention provides a T7 RNA polymerase mutant, which is a protein described in any one of the following a1-a3:

[0008] a1: A protein having the following amino acid substitutions based on the wild-type T7 RNA polymerase shown in SEQ ID NO: 1:

[0009] P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0010] a2: A protein obtained by substituting the protein described in a1 with amino acids containing one or a combination of any two or more of the following groups:

[0011] S43Y;

[0012] G47A;

[0013] S641A;

[0014] a3: A fusion protein obtained by connecting a tag and / or a protease cleavage site to the amino and / or carboxyl termini of the protein described in a1 or a2, wherein the tag and the protease cleavage site do not affect the function of the T7 RNA polymerase mutant.

[0015] According to the technical solution of the present application, by performing the above-mentioned amino acid substitution on the wild-type T7 RNA polymerase shown in SEQ ID NO: 1, the T7 RNA polymerase mutant can be made to have the ability to efficiently recognize and incorporate 2'-F-dNTPs and dNTPs, and have a conventional RNA molecule transcription efficiency comparable to that of the wild-type.

[0016] In some embodiments, the T7 RNA polymerase mutant is b1 or b2,

[0017] b1: A protein having any of the following amino acid substitutions based on the wild-type T7 RNA polymerase shown in SEQ ID NO: 1:

[0018] P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0019] S43Y, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0020] G47A, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0021] S43Y, G47A, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0022] P266L, S430P, N433T, S633P, Y639F, S641A, V689Q, V783M, F849I, F880Y;

[0023] b2: A fusion protein obtained by connecting a tag and / or a protease cleavage site to the protein described in b1 at the amino terminus and / or carboxyl terminus, wherein the tag and the protease cleavage site do not affect the function of the T7 RNA polymerase mutant.

[0024] The second aspect of the present invention provides a coding gene, which encodes the T7 RNA polymerase mutant.

[0025] The third aspect of the present invention provides a vector comprising the encoding gene described in the second aspect of the present invention.

[0026] In some embodiments, the vector is selected from one of the following groups: a plasmid, a bacteriophage, a cosmid, an artificial chromosome, a plant cell virus, a mammalian cell virus or a retrovirus.

[0027] The fourth aspect of the present invention provides a host cell, which expresses the T7 RNA polymerase mutant described in the first aspect of the present invention, and / or contains the encoding gene described in the second aspect of the present invention, and / or contains the vector described in the third aspect of the present invention.

[0028] In some embodiments, the host cell is a prokaryotic cell, a yeast cell, an insect cell or a mammalian cell.

[0029] In a fifth aspect, the present invention provides a method for preparing the T7 RNA polymerase mutant, comprising: allowing the host cell described in the fourth aspect of the present invention to express the T7 RNA polymerase mutant, and isolating and purifying the T7 RNA polymerase mutant.

[0030] The sixth aspect of the present invention provides the use of the T7 RNA polymerase mutant described in the first aspect of the present invention, and / or the encoding gene described in the second aspect of the present invention, and / or the vector described in the third aspect of the present invention, and / or the host cell described in the fourth aspect of the present invention in synthesizing nucleic acid molecules.

[0031] In some embodiments, the nucleic acid molecule has a modification; the modification comprises a fluorine substitution.

[0032] In some embodiments, the nucleic acid molecule is single-stranded.

[0033] In some embodiments, the nucleic acid molecule is DNA or RNA.

[0034] The seventh aspect of the present invention provides a method for synthesizing a nucleic acid molecule, which comprises providing a system comprising a template, a substrate and the T7 RNA polymerase mutant described in the first aspect of the present invention, and synthesizing the nucleic acid molecule by transcription under the catalytic action of the T7 RNA polymerase mutant; the substrate is selected from at least one of dNTPs (2'-deoxyribonucleoside triphosphates), rNTPs (ribonucleoside triphosphates), and 2'-F-dNTPs (2'-fluoro-ribonucleoside triphosphates).

[0035] In some embodiments, the reaction conditions for transcription include incubation at 30-37°C; for example, the incubation temperature can be about 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, etc.

[0036] In some embodiments, the incubation time is 2 to 6 hours; for example, it can be about 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, etc.

[0037] In some embodiments, the nucleic acid molecule has a modification; the modification comprises a fluorine substitution.

[0038] In some embodiments, the nucleic acid molecule is single-stranded.

[0039] In some embodiments, the nucleic acid molecule is DNA or RNA.

[0040] Compared with the prior art, the technical solution of the present invention has at least the following advantages:

[0041] (1) The T7 RNA polymerase mutant provided by the present invention can recognize and incorporate one or more nucleotide substrates among rNTPs, 2'-F-dNTPs and dNTPs to efficiently synthesize single-stranded DNA molecules, fluorinated RNA molecules and perfluorinated DNA molecules.

[0042] (2) In terms of transcribing conventional RNA molecules using rNTPs as substrates, the T7 RNA polymerase mutant provided by the present invention has a transcription efficiency comparable to that of the wild-type T7 RNA polymerase. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Various other advantages and benefits will become apparent to those of ordinary skill in the art by reading the detailed description of the preferred embodiments below. The accompanying drawings are only used for the purpose of illustrating the preferred embodiments and are not to be considered as limiting the present invention. In the accompanying drawings:

[0044] Figure 1: SDS-PAGE gel electrophoresis analysis results of the T7 RNA polymerase prepared in Example 1;

[0045] Figure 2 : Normalized value of fluorescence intensity emitted by T7 RNA polymerase transcribed fluorescent RNA 4 hours after binding to ligand HBC (E x / E m :488 / 530); wherein, None represents blank control, and WT represents wild-type T7 RNA polymerase;

[0046] Figure 3 : Characterization of the activity of T7 RNA polymerase mutants in synthesizing long and complex 2'-fluoropyrimidine-modified RNA molecules; (a) 1% agarose gel electrophoresis characterization of 2'-fluoropyrimidine-modified RNA products transcribed by T7 RNA polymerase mutants; (b) Relative values ​​of grayscale analysis of Runoff bands in each lane in Figure a. The grayscale value of the WT band at 37°C was set as the reference value of 100, and the grayscale values ​​of other lanes were used as a reference to obtain their relative values; None represents the blank control, and WT represents the wild-type T7 RNA polymerase;

[0047] Figure 4 : Characterization of the activity of T7 RNA polymerase mutants in synthesizing fluorine-modified RNA by 1% agarose gel electrophoresis; wherein lanes 1-6 represent QM-F-M6, QM-F-M6-AG, QM-F-M6-Y, QM-F-M6-YAG, QM-F-M6-A, and QM-F-M6-YA mutants, respectively; WT represents wild-type T7 RNA polymerase, and None represents blank control;

[0048] Figure 5 :Fluorescence emission spectra of T7 RNA polymerase mutants binding to small molecule ThT after transcribing G-quadruplex (DNA) for 90 min (E x / E m :425 / 495). Among them, None represents a blank control, in which no polymerase is added; WT (rN) represents a positive control, in which wild-type T7 RNA polymerase transcribes G-quadruplex (RNA) using four rNTPs as substrates.

[0049] Figure 6 : Characterization results of the ability of T7 RNAP mutants to synthesize DNA in vitro; wherein, lane 4 represents QM-F-M6, and lane 5 represents QM-F-M6-S641A. DETAILED DESCRIPTION

[0050] The exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. Although the exemplary embodiments of the present disclosure are shown in the accompanying drawings, it should be understood that the present disclosure can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present disclosure and to fully convey the scope of the present disclosure to those skilled in the art.

[0051] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, any methods, equipment, and materials of the prior art that are similar or equivalent to the methods, equipment, and materials in the embodiments of the present invention may be used to implement the present invention, based on the prior art mastery of those skilled in the art and the description of the present invention.

[0052] As used herein, an amino acid "substitution" refers to replacing one amino acid with another amino acid in a polypeptide or protein.

[0053] As used herein, amino acid substitution is indicated by a first letter followed by a number followed by a second letter. The first letter indicates the substituted amino acid; the number refers to the position of the substituted amino acid, and the numbering method is to start with the first amino acid at the N-terminus of SEQ ID NO: 1 and number sequentially toward the C-terminus; the second letter indicates the amino acid used to replace the amino acid indicated by the first letter. For example, P266L means: proline (P) at position 266 is substituted with leucine (L).

[0054] Herein, the conventional one-letter or three-letter codes for the naturally occurring amino acids are used:

[0055] Alanine (Ala, A) Arginine (Arg, R)

[0056] Asparagine (Asn, N) Aspartic acid (Asp, D)

[0057] Cysteine ​​(Cys, C) Glutamic acid (Glu, E)

[0058] Glutamine (Gln, Q) Glycine (Gly, G)

[0059]

[0060] As used herein, the term "vector" refers to a nucleic acid vector into which a polynucleotide can be inserted. When a vector allows the expression of a protein encoded by a polynucleotide inserted therein, the vector is referred to as an expression vector. The vector can be transformed, transduced or transfected into a host cell to express the genetic material elements carried in the host cell. Vectors are well known to those skilled in the art, including but not limited to plasmids, bacteriophages, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC); bacteriophages such as lambda phage or M13 phage and animal viruses. Animal viruses that can be used as vectors include but are not limited to retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papovaviruses (such as SV40). The vector may contain multiple elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, the vector may contain an origin of replication.

[0061] Herein, "host cell" refers to a cell into which exogenous nucleic acid has been introduced, including the offspring of such cells. Host cells include initially transformed cells and offspring derived therefrom (regardless of the number of generations). Offspring may not be identical to parental cells in nucleic acid content, but may contain mutations. Mutant offspring with the same function or biological activity as screened or selected in the original transformed cells are included herein. Host cells are any type of cell system that can be used to generate the fusion protein of the present invention. Host cells include mammalian cultured cells such as CHO cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, yeast cells, bacterial cells such as Escherichia coli, insect cells and plant cells, etc., and are also included in transgenic animals, transgenic plants or cells contained in cultivated plants or animal tissues.

[0062] In some embodiments, a T7 RNA polymerase mutant is provided, wherein the amino acid sequence thereof is based on the amino acid sequence shown in SEQ ID NO: 1, and contains the following amino acid substitutions:

[0063] P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y.

[0064] In some embodiments, a T7 RNA polymerase mutant is provided, wherein the amino acid sequence thereof is based on the amino acid sequence shown in SEQ ID NO: 1, and contains the following amino acid substitutions:

[0065] P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0066] Furthermore, it also contains any one or a combination of any two or more of the following amino acid substitutions:

[0067] S43Y;

[0068] G47A;

[0069] S641A.

[0070] It should be noted that the fusion protein obtained by connecting the label and / or protease cleavage site at the amino-terminus and / or carboxyl-terminus of the protein is usually for the purpose of facilitating expression, purification or separation. When the T7 RNA polymerase mutant provided by the present invention is coupled to the above-mentioned label and / or protease cleavage site, its function is usually not affected by the coupled label or protease cleavage site. In this case, the fusion protein obtained by coupling the label and / or protease is also within the protection scope of the present invention. As an example, the label that can be generally adopted can be selected from HIS-Tag (histidine tag), GST-Tag (glutathione sulfhydryl transferase label), MBP-Tag (maltose binding protein label), NusA-Tag (transcription termination / anti-termination protein label), etc.

[0071] In some embodiments, a T7 RNA polymerase mutant as shown in Table 1 is provided, and the "mutation site" refers to the mutation site of the wild-type T7 RNA polymerase as shown in SEQ ID NO:1.

[0072] Table 1

[0073]

[0074] In the case where the mutation site and sequence of the above-mentioned T7 RNA polymerase mutant are disclosed in the specific embodiments of the present application, those skilled in the art can construct an expression vector containing it under laboratory conditions according to conventional cloning methods (such as PCR); or, they can directly entrust a gene synthesis company to synthesize it, thereby obtaining an expression vector of the T7 RNA polymerase mutant.

[0075] In some embodiments, starting from the sequence of wild-type T7 RNA polymerase, the "megaprimer PCR technique" can be adopted to obtain T7 RNA polymerase mutants through multiple rounds of PCR cloning. In one PCR, one or more sites can be mutated; thus, through multiple rounds of PCR, the target sequence can be obtained. For example, QM-F-M6 contains 9 mutation sites and needs to be constructed by five consecutive megaprimer PCR processes. One of the megaprimer PCR mutations (P266L, S633P, Y639F) is used as an example for detailed description. The specific experimental steps are as follows:

[0076] Using the expression vector of wild-type T7 RNA polymerase as a template, the primers shown in Table 2 were designed and synthesized, wherein the underlined bold font represents the mutation site.

[0077] Table 2 Primer sequences

[0078]

[0079] The megaprimer PCR amplification method mainly involves two rounds of PCR amplification processes, and the specific operation steps of each round of amplification are as follows.

[0080] First round of PCR: Add samples according to the PCR reaction solution formula shown in Table 3. Then PCR amplification is performed to obtain a PCR product called "megaprimer".

[0081] Table 3 PCR reaction solution formula (total volume 25 μL)

[0082] Components Final concentration or volume <![CDATA[2×KOD One TM PCR Master Mix]]> 1× Plasmid template: pGEX-6p-1-GST-T7 RNAP (WT) 1ng / μL Upstream primer (P266L-F) 0.3μM Downstream primer (S633P / Y639F-R) 0.3μM DEPC water Up to 25 μL

[0083] Second round of PCR: Add samples according to the PCR reaction solution formula shown in Table 4. Then, PCR amplification is performed to obtain the PCR amplification product of the mutant plasmid: a double-stranded DNA molecule containing the complete plasmid sequence and three mutation sites (P266L, S633P, Y639F).

[0084] Table 4 PCR reaction solution formula (total volume 25 μL)

[0085]

[0086]

[0087] SpeedyCut DpnI was used to digest the template plasmid in the PCR amplification product, and then the purified PCR amplification product was transformed into E. coli DH5α competent cells. After resistance screening, plasmid extraction, and sequencing, positive clones that correctly expressed the target protein were obtained.

[0088] Thus, through the above-mentioned round of "megaprimer PCR", an expression vector of T7 RNA polymerase containing three mutation sites (P266L, S633P, Y639F) can be obtained. Using this expression vector as a template, a similar method is adopted to sequentially perform subsequent rounds of megaprimer PCR, and finally the expression vector pGEX-6p-1-GST-QM-F-M6 of QM-F-M6 can be obtained. Similarly, a similar method can be adopted to clone the T7 RNA polymerase mutants in other embodiments of the present invention.

[0089] The T7 RNA polymerase mutant provided in the embodiments of the present invention can be used as a tool enzyme for synthesizing nucleic acid molecules. In some embodiments, a method for synthesizing nucleic acid molecules is provided, which includes providing a system including a template, a substrate and the T7 RNA polymerase mutant described in the first aspect of the present invention, and synthesizing the nucleic acid molecule by transcription under the catalytic action of the T7 RNA polymerase mutant; the substrate is selected from at least one of dNTPs (2'-deoxyribonucleoside triphosphates), rNTPs (ribonucleoside triphosphates), and 2'-F-dNTPs (2'-fluoro-ribonucleoside triphosphates).

[0090] The template can be designed or selected according to the sequence of the nucleic acid molecule to be synthesized. The substrate can be specifically selected according to the type of nucleic acid molecule to be synthesized, for example, dNTPs can be used to synthesize single-stranded DNA molecules; rNTPs can be used to synthesize RNA molecules; a substrate containing 2'-F-dNTPs can be used to synthesize DNA molecules or RNA molecules with fluorine substitution at some sites; a substrate composed entirely of 2'-F-dNTPs can be used to synthesize perfluorinated DNA molecules.

[0091] Unless otherwise specified, the instruments and reagents used in the following examples can be obtained from conventional commercial channels.

[0092] Example 1 Expression and purification of T7 RNA polymerase mutants

[0093] The expression vectors of the T7 RNA polymerase mutants shown in Table 1 are provided: pGEX-6P-1-GST-QM-F-M6, pGEX-6P-1-GST-QM-F-M6-Y, pGEX-6P-1-GST-QM-F-M6-A, pGEX-6P-1-GST-QM-F-M6-YA, and pGEX-6P-1-GST-QM-F-M6-S641A; the plasmid backbone of the expression vector is pGEX-6P-1GST.

[0094] The above expression vectors were transformed into Escherichia coli BL21 (DE3) and induced to express. The specific steps included:

[0095] Pick a single clone into 4 mL of liquid LB medium and add 4 μL of Amp + Solution (100 mg / mL) was incubated at 37°C for 10 h. 4 mL of the shaken bacterial solution was inoculated into 400 mL of liquid 2×YT medium, and 400 μL of Amp + Solution (100 mg / mL) was cultured in a 37°C incubator at 250 rpm for 2 h until the bacterial OD 600 When the cell count is about 0.6-0.8, add 80 μL 0.5M IPTG and induce at low temperature (15°C, 200 rpm) for 16 hours. Then use a large high-speed centrifuge to centrifuge at 8000 rpm for 10 minutes, discard the supernatant, and collect the bacterial precipitate. After the bacterial cells are collected, use 4°C pre-cooled PBS buffer to fully resuspend the bacteria, and use ultrasonic disruption to break the cells on ice until the sample is clear and completely broken. Then centrifuge at low temperature for 15 minutes, and filter the cell lysis supernatant into a clean 50mL pre-cooled centrifuge tube with a 0.45μM filter membrane.

[0096] Gently shake the high affinity GST purification medium to fully resuspend. Pipette an appropriate amount of slurry into the gravity column and wash the high affinity GST purification medium with 10 times the column volume of pre-cooled PBS buffer. Add the prepared cell lysis supernatant to the chromatography column. After all the lysate flows out, add PBS buffer to wash the column to remove impurities. The required amount is at least 10 times the column volume, and verified with Coomassie Brilliant Blue.

[0097] Equilibrate the column with 10 column volumes of PreScission Protease digestion buffer, the components of PreScission Protease digestion buffer are 50mM Tris-HCl, 150mM NaCl, 1mM EDTA, 1mM DTT, pH 7.5. Prepare PreScission Protease: Use 2U PreScission Protease (purchased from Bio-Tech Co., Ltd.) for every 100μg GST-tagged protein, and dilute it with PreScission digestion buffer to the same volume as the gel column. After thoroughly mixing the diluted 1mL PreScission Protease with the purification medium, place the gravity column at 4℃ for digestion overnight.

[0098] The next day, wash the column with PreScission Protease digestion buffer and collect the effluent in a pre-cooled clean 1.5 mL centrifuge tube. Drop the flow-through into Coomassie Brilliant Blue and compare the color until the color is the same as the blank control. Mix the effluent protein solution with an equal volume of 80% glycerol, and store it in a -80°C ultra-low temperature refrigerator.

[0099] Finally, soak the purification medium column overnight with GST column treatment solution (300mM NaCl, 20mM Tris 8.0, 1.5g reduced glutathione, fixed to 500mL), then wash N column volumes, drip the flow-through until Coomassie brilliant blue does not change color (if the protein is still difficult to wash, wash with 6M guanidine hydrochloride for one column volume and then quickly rinse with water). Finally, store the column in 20% ethanol PBS buffer solution.

[0100] like Figure 1 As shown, the molecular weight and purity of the obtained T7 RNA polymerase were characterized by SDS-polyacrylamide gel electrophoresis experiment, wherein lane 11 is QM-F-M6, lane 32 is QM-F-M6-Y, lane 34 is QM-F-M6-A, lane 35 is QM-F-M6-YA, lane 12 is QM-F-M6-S641A, lane 13 is wild-type T7 RNA polymerase, and M represents PageRuler Unstained Protein Ladder (10kDa to 200kDa).

[0101] The electrophoresis results showed that the bright band of the T7 RNA polymerase mutant was located near the 100 kDa standard band, which was consistent with the expected molecular weight of 99 kDa. Most proteins had no mixed bands, and a few had light mixed bands but the concentration was low and did not affect subsequent experiments.

[0102] Example 2 Characterization of the activity of T7 RNA polymerase mutants in transcribing conventional RNA molecules

[0103] (1) Preparation of dsDNA-1 transcription template

[0104] In a 50 μL system, equal amounts of sense strand-1 and antisense strand-1 DNA (as shown in Table 5) were added to a final concentration of 20 μM, and then 12.5 μL 10 mM MgCl2 and 17.5 μL DEPC water were added to make up the final concentration. The solution was mixed evenly by a mixer and placed in a PCR instrument for annealing and hybridization to obtain double-stranded DNA molecules, which were stored at -20°C as dsDNA transcription templates.

[0105] Table 5 dsDNA-1 transcription template sequence

[0106]

[0107] (2) Fluorescent RNA transcription and its fluorescence monitoring experiment

[0108] In a 20μL reaction system, add the above 1μL dsDNA-1 transcription template (final concentration of 1μM), 4μL 5× transcription reaction buffer, T7 RNA polymerase with a final concentration of 1μM, 2μL rNTPs (final concentration of 2.5mM), HBC530 dye with a final concentration of 10μM, and finally fill to 20μL with DEPC water (also set up: a blank control group without T7 RNA polymerase), mix and centrifuge, take 20μL sample and measure the fluorescence intensity of the reaction with a microplate reader, set the reaction temperature to 37℃, the excitation wavelength to 488nm, the absorption wavelength to 530nm, and read the data every 30s. The results are as follows Figure 2 The fluorescence value shown represents the fluorescence value at 4 hours of transcription. It can be seen that the QM-F-M6 mutant has an RNA transcription efficiency comparable to that of the wild-type T7 RNA polymerase.

[0109] Example 3 Characterization of the activity of T7 RNA polymerase mutants in transcribing 2'-F modified RNA molecules

[0110] (1) Preparation of dsDNA-2 transcription template

[0111] The template for in vitro transcription was prepared by PCR technology, specifically, a DNA fragment containing T7 promoter, T7 terminator and transcript coding sequence in the laboratory plasmid pET-28a(+)-4pepper was amplified by forward and reverse primers (sequence as shown in SEQ ID NO: 16). The PCR reaction system (200 μL) was as follows: 0.3 μM forward and reverse primers (as shown in Table 6), 100 μL 2×PrimeSTAR Mix DNA polymerase, 1 ng / μL template plasmid, and finally filled with DEPC water. After mixing the components of the reaction system, PCR amplification was performed, and the obtained PCR amplification product was purified using an agarose gel DNA recovery kit to prepare a dsDNA-2 transcription template.

[0112] Table 6 Primer sequences

[0113] name Sequence (5'-3') SEQ ID NO: Upstream primer TAATACGACTCACTATAGGGGAATTGTGAGCGG 17 Downstream primer CAAAAAACCCCTCAAGACCCGTTTAGAGGC 18

[0114] (2) In vitro transcription reaction system

[0115] In a 40μL reaction system, add 1μM dsDNA-2 transcription template, 1× transcription reaction buffer, 1μM mutant QM-F-M6, 2.5mM rATP, 2.5mM rGTP, 2.5mM 2'-F-dCTP and 2.5mM 2'-F-dUTP, and finally fill to 40μL with DEPC water. After mixing, divide it into 2 groups, each with 20μL reaction system, and incubate at 30℃ and 37℃ for 4h, respectively. After incubation at 70℃ for 10min to terminate the reaction, 0.25U DNase I was added to each group to digest the template DNA. After adding 3μL 6×DNALoading loading buffer to each group, 10μL was taken for loading. Electrophoresis was performed on 1% agarose gel at room temperature. The results are as follows. Figure 3 As shown. The efficiency of the QM-F-M6 mutant in synthesizing chemically modified RNA molecules is basically the same as that of the positive control, or even slightly better. Therefore, the successful construction of the QM-F-M6 mutant provides a new and efficient tool for the in vitro isothermal enzymatic synthesis of non-natural fluorinated RNA molecules. This breakthrough overcomes the limitations of T7 RNA polymerase mutants in the prior art in synthesizing long-chain chemically modified molecules.

[0116] Example 4 Characterization of the activity of T7 RNA polymerase mutants in transcribing perfluorinated DNA molecules

[0117] In a 20μL reaction system, add 1μM dsDNA-2 transcription template, 1× transcription reaction buffer, 1μM T7 RNA polymerase, 2.5mM 2'-F-dNTP, and finally fill to 20μL with DEPC water. Mix well and incubate at 37℃ for 4h. After incubation at 70℃ for 10min to terminate the reaction, add 0.25U DNase I to each group to digest the template DNA. Add 3μL 6×DNA Loading buffer to each group and take 10μL for loading. Perform electrophoresis on 1% agarose gel at room temperature. The results are as follows: Figure 4 shown.

[0118] Generally speaking, the incorporation of more C2' chemically modified nucleotide substrates will lead to a significant decrease in catalytic efficiency. In particular, when all nucleotides are chemically modified, the synthesis efficiency often reaches the lowest. The experimental results of this example show that the two mutants QM-F-M6 and QM-F-M6-YA have a higher ability to synthesize perfluorinated DNA molecules.

[0119] Example 5: Characterization of the activity of T7 RNA polymerase mutants in transcribing single-stranded DNA molecules

[0120] (1) As shown in Table 7, 1 μM T7 RNA polymerase, 2.5 mM dNTPs, 1× transcription reaction buffer, and 600 nM double-stranded DNA transcription template were added to a 20 μL reaction system, and finally filled to 20 μL with DEPC water. After four hours of in vitro transcription, the reaction was terminated by incubation at 80°C for 20 min. Then, 10 μM ThT dye, K + (The final concentrations were 1mM, 10mM, 20mM, 50mM, 80mM, and 100mM, respectively), and the fluorescence spectrum was scanned with an ELISA reader, with an excitation wavelength of 429nm. The results are shown in Figure 5 As shown in the figure, as the potassium ion concentration increases, the fluorescence signal also increases accordingly, and finally reaches a platform at 80mM. When all aptamers are correctly folded and bound to small molecules, increasing the potassium ion concentration does not lead to more aptamer folding and small molecule binding, so the fluorescence signal reaches a stable state. In addition, the mutant QM-F-M6 is ten times more efficient in synthesizing DNA G-quadruplexes than the positive control (wild-type T7 RNA polymerase), which shows its superior performance under specific conditions.

[0121] Table 7 Fluorescence kinetics reaction solution formula

[0122] Components Addition amount T7 RNA polymerase 1μM Double-stranded DNA template 500nM 5× Transcription Reaction Buffer 1× dNTPs 2.5mM T 10μM <![CDATA[K + ]]> 100mM DEPC water Make up to 20 μL

[0123] (2) The total volume of each reaction solution was set to 20 μL, and the preparation process was carried out on ice. The reaction solution formula is shown in Table 8. The positive control group was added with wild-type T7 RNA polymerase and rNTPs substrate; the blank control group was the same as the positive control group except that no polymerase was added; different T7 RNA polymerase mutants and chemically modified substrates required for specific experiments were added to the experimental group.

[0124] Table 8 In vitro transcription reaction solution formula

[0125] Components Final concentration or volume T7 RNA polymerase 1μM Double-stranded DNA template 500nM 5× Transcription Reaction Buffer 1× dNTPs 2.5mM DEPC water Make up to 20 μL

[0126] In vitro transcription: The mixed reaction solution was shaken and centrifuged, and then incubated at 37°C for 4 hours. After transcription, the polymerase was inactivated and the reaction was terminated by incubating at 80°C for 20 minutes. 3 μL 6× DNA Loading buffer was added to each group, and 10 μL was loaded. Electrophoresis was performed on 1% agarose gel at room temperature. The results were as follows: Figure 6 As shown, QM-F-M6 and QM-F-M6-S641A have the function of synthesizing DNA in vitro.

[0127] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed by the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention shall be based on the protection scope of the claims.

Claims

1. A T7 RNA polymerase mutant, characterized in that: The T7 RNA polymerase mutant is a protein described in any one of the following a1-a3: a1: A protein having the following amino acid substitutions based on the wild-type T7 RNA polymerase shown in SEQ ID NO: 1: P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y; a2: A protein obtained by replacing the protein described in a1 with amino acids containing one or a combination of any two or more of the following groups: S43Y; G47A; S641A; a3: A fusion protein obtained by connecting a tag and / or a protease cleavage site to the amino and / or carboxyl termini of the protein described in a1 or a2, wherein the tag and the protease cleavage site do not affect the function of the T7 RNA polymerase mutant.

2. The T7 RNA polymerase mutant according to claim 1, characterized in that The T7 RNA polymerase mutant is a protein described in any one of b1 or b2: b1: A protein having any of the following amino acid substitutions based on the wild-type T7 RNA polymerase shown in SEQ ID NO: 1: P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y; S43Y, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y; G47A, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y; S43Y, G47A, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y; P266L, S430P, N433T, S633P, Y639F, S641A, V689Q, V783M, F849I, F880Y; b2: A fusion protein obtained by connecting a tag and / or a protease cleavage site to the protein described in b1 at the amino terminus and / or carboxyl terminus, wherein the tag and the protease cleavage site do not affect the function of the T7 RNA polymerase mutant.

3. A coding gene, characterized in that The coding gene encodes the T7 RNA polymerase mutant according to claim 1 or 2.

4. A carrier, characterized in that The vector comprises the coding gene according to claim 2; Preferably, the vector is selected from one of the following groups: a plasmid, a bacteriophage, a cosmid, an artificial chromosome, a plant cell virus, a mammalian cell virus or a retrovirus.

5. A host cell, characterized in that The host cell expresses the T7 RNA polymerase mutant according to claim 1 or 2, and / or contains the encoding gene according to claim 3, and / or contains the vector according to claim 4.

6. The method for preparing the T7 RNA polymerase mutant according to claim 1 or 2, characterized in that: include: The host cell of claim 5 is allowed to express the T7 RNA polymerase mutant, and the T7 RNA polymerase mutant is isolated and purified.

7. Use of the T7 RNA polymerase mutant according to claim 1 or 2, and / or the encoding gene according to claim 3, and / or the vector according to claim 4, and / or the host cell according to claim 5 in synthesizing nucleic acid molecules.

8. The use according to claim 7, characterized in that The nucleic acid molecule has a modification; preferably, the modification comprises a fluorine substitution; and / or, the nucleic acid molecule is single-stranded; And / or, the nucleic acid molecule is DNA or RNA.

9. A method for synthesizing a nucleic acid molecule, characterized in that: include: A system comprising a template, a substrate and the T7 RNA polymerase mutant according to claim 1 or 2 is provided, wherein the nucleic acid molecule is synthesized by transcription under the catalytic action of the T7 RNA polymerase mutant; the substrate is selected from at least one of dNTPs, rNTPs and 2'-F-dNTPs.

10. The method for synthesizing nucleic acid molecules according to claim 9, wherein The transcription reaction conditions include incubation at 30-37°C; preferably, the incubation time is 2-6h; and / or, the nucleic acid molecule has a modification; preferably, the modification comprises a fluorine substitution; and / or, the nucleic acid molecule is single-stranded; And / or, the nucleic acid molecule is DNA or RNA.

Images