Application of nano-palladium-loaded escherichia coli in catalysis of aromatic aldehyde hydrogenation reaction

Abstract

The invention discloses application of nano-palladium-loaded escherichia coli in catalysis of aromatic aldehyde hydrogenation reaction, and belongs to the technical field of biological catalysis. The invention aims to provide application of nano-palladium-loaded escherichia coli in catalysis of aromatic aldehyde hydrogenation reaction. The invention provides an application of nano-palladium-loaded escherichia coli in catalysis of aromatic aldehyde hydrogenation reaction, and a method for obtaining the nano-palladium-loaded functional escherichia coli comprises the following steps: incubating recombinant escherichia coli with palladium liquid, and reacting under a micro-anaerobic condition by using formate as an enzyme substrate to obtain the nano-palladium-loaded functional escherichia coli, according to the recombinant escherichia coli, genes for coding catalytic subunits of [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2 are knocked out on the basis of original escherichia coli. The functional escherichia coli with nano-palladium loaded in cells is constructed, benzaldehyde hydrogenation is used as a template reaction to verify the catalytic ability of the functional escherichia coli, and a certain supporting effect is expected to be provided for implementation of intracellular metal-enzyme cascade catalysis.

Description

Technical Field

[0001] The invention belongs to the technical field of biocatalysis, and in particular relates to the application of nano-palladium-loaded Escherichia coli in catalyzing aromatic aldehyde hydrogenation reactions. Background Art

[0002] As the cornerstone of the chemical industry, catalysts play an important role in the production of modern fuel industry and chemical industry, and more than 80% of them adopt catalytic processes. ACS proposed the concept of "green chemistry" in the 1990s. Many of the twelve principles mentioned the safety of products and processes and the use of catalysts, indicating the importance of catalysts and the importance of safe and green preparation processes. In the field of catalysis, many metal catalysts and their oxides exhibit special properties because they can provide empty orbits or electrons in chemical reactions, thereby producing intermediates, reducing the activation energy of reactions, and making subsequent reactions easier. Biocatalysis, also known as biotransformation, is the process of chemically modifying and transforming precursor compounds using organisms or enzyme molecules to obtain organic compounds. It essentially uses enzymes as catalysts. Metal-enzyme cascade catalysis combines the wide reactivity of chemical catalysts with the high selectivity of biocatalysts. By using metal and enzyme catalysis in the same reaction system, multi-step reactions are achieved. This method not only improves the reaction efficiency, but also avoids the separation and purification of intermediates, simplifies the process flow, and is an effective way to asymmetric synthesis of high value-added chiral compounds.

[0003] Although enzyme-catalyzed reactions in cells can achieve a level of selectivity that cannot be matched by metal catalysts, the substrate range of the enzyme may be very small. If the target compound required for the reaction is not naturally produced in the cell, there may not be a naturally occurring enzyme that can catalyze the required reaction. Therefore, the use of exogenous catalysts to carry out reactions in cells in nature is an area worth exploring. The synthesis of transition metals in cells and enzyme cascade catalysis can significantly simplify the process flow and reduce the need for separation and purification, which not only reduces energy consumption in the production process, but also improves the overall economic benefits and sustainability.

[0004] Biological methods not only have certain potential in improving the catalytic activity of metals, but also the preparation process is green and mild, which meets the requirements of green chemistry. However, when used for intracellular cascade catalysis, the current synthetic route still has some shortcomings. Most of the constructed functional cells are ground and calcined for catalytic reactions, and the biosynthesis of non-natural products by metal-enzyme cascade catalysis in cells still needs further exploration. Summary of the invention

[0005] The purpose of the invention is to provide application of nano-palladium-loaded Escherichia coli in catalyzing aromatic aldehyde hydrogenation reaction.

[0006] The invention provides an application of nano-palladium-loaded Escherichia coli in catalyzing aromatic aldehyde hydrogenation reaction, and a method for obtaining functional Escherichia coli loaded with nano-palladium: after incubating recombinant Escherichia coli with palladium solution, formate is used as an enzyme substrate to react under micro-anaerobic conditions to obtain functional Escherichia coli loaded with nano-palladium; the recombinant Escherichia coli is based on the original Escherichia coli and any one or two genes encoding catalytic subunits of [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2 are knocked out.

[0007] It is further defined that the palladium solution is a Na2PdCl4 aqueous solution or a K2PdCl4 aqueous solution; the concentration of the palladium solution is 0.5-1.5mM, the incubation temperature is 20-50°C, the time is 20-30min, and the pH is 3.5-6; the water-soluble formate is a HCOONa aqueous solution or a HCOOK aqueous solution; the formate concentration in the reaction system is 5-25mM, and the reaction time is 24-72h.

[0008] It is further defined that the concentration of the palladium solution is 1 mM, the incubation temperature is 37°C, the time is 25 min, and the pH is 3.5; the water-soluble formate is HCOONa aqueous solution or HCOOK aqueous solution; the formate concentration in the reaction system is 25 mM, and the reaction time is 24 h.

[0009] It is further defined and characterized in that the aromatic aldehyde is benzaldehyde.

[0010] The invention provides a method for whole-cell catalytic hydrogenation of aromatic aldehydes, wherein Escherichia coli loaded with nano-palladium is added into a solution of aromatic aldehydes for reaction to obtain aromatic alcohols.

[0011] It is further defined that the reaction conditions are room temperature, aqueous phase, atmospheric pressure, and stirring for 5 hours.

[0012] Further defined, the method for obtaining functional Escherichia coli loaded with nano-palladium is as follows: after incubating the recombinant Escherichia coli with palladium solution, formate is used as an enzyme substrate to react under micro-anaerobic conditions to obtain functional Escherichia coli loaded with nano-palladium; the recombinant Escherichia coli is based on the original Escherichia coli and the genes encoding the catalytic subunits of [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2 are knocked out; the sequence of the gene encoding the catalytic subunit of [NiFe] hydrogenase 1 is shown in SEQ ID NO.1; and the sequence of the gene encoding the catalytic subunit of [NiFe] hydrogenase 2 is shown in SEQ ID NO.2.

[0013] It is further defined that the palladium solution is a Na2PdCl4 aqueous solution or a K2PdCl4 aqueous solution; the concentration of the palladium solution is 0.5-1.5mM, the incubation temperature is 20-50°C, the time is 20-30min, and the pH is 3.5-6; the water-soluble formate is a HCOONa aqueous solution or a HCOOK aqueous solution; the formate concentration in the reaction system is 5-25mM, and the reaction time is 24-72h.

[0014] It is further defined that the loading amount of nano-palladium is 0.009-0.045 mmol.

[0015] It is further defined that the size of nano-palladium is 5.99±1.72 nm and nano-palladium is zero-valent.

[0016] Beneficial effects: The present invention uses Escherichia coli MC4100 as a starting strain, uses a Kan fragment with a homologous arm of a target gene to transform Escherichia coli, and uses homologous recombination technology to knock out the genes hyaB and hybC on the Escherichia coli genome, successfully constructs a genetically engineered bacterium MC4100 (ΔhyaB, ΔhybC), making it unable to express [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2, and lays an experimental foundation for the synthesis position of nano-palladium. The bacteria can adsorb palladium ions and reduce palladium ions through sodium formate as an electron donor to form black biological palladium nanoparticles. This can be achieved within the conditions of 0.4-0.5 g / L biomass, 5-25 mM sodium formate concentration, palladium ion concentration less than 2 mM, temperature 20-50°C and pH 2.2-7. The product is characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM) and X-ray photoelectron spectroscopy (XPS), indicating that Escherichia coli can adsorb and reduce palladium ions to form nanoparticles inside the cell. Compared with the current cases of palladium synthesis, the present invention uses a mild hydrogen source instead of a traditional hazardous hydrogen source, and realizes the intracellular directional synthesis of nano-palladium through strain modification. This method is expected to have great application potential in the preparation of metal nanoparticles, environmental remediation, biomedicine and chemical industries. This patent constructs functional Escherichia coli loaded with nano-palladium intracellularly, and uses benzaldehyde hydrogenation as a template reaction to verify its catalytic ability, which is expected to provide certain support for the realization of intracellular metal-enzyme cascade catalysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The XPS spectra of the cells in Control Example 1, Example 1 and Example 2;

[0018] Figure 2 GC-MS spectra of the catalytic products of Example 1 and Example 2;

[0019] Figure 3 The GC calculation results of the catalytic products of Control Example 1, Example 1 and Example 2;

[0020] Figure 4 The GC calculation results of the functional cell constructed in Example 3 after catalysis for 5 times;

[0021] Figure 5 The SEM images of the cells in Control Example 1, Example 1 and Example 3;

[0022] Figure 6 TEM dark field images of MC4100-S loaded with Pd NPs prepared under different pH conditions; AH are original TEM images of double knockout bacteria sections at pH 2.2-pH 6, A: pH 2.2; B: pH 3; C: pH 3.5; D: pH 4; E: pH 4.5; F: pH 5; G: pH 5.5; H: pH 6. DETAILED DESCRIPTION

[0023] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited by the embodiments.

[0024] Unless otherwise specified, the materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels.

[0025] Culture medium formula: LB medium: 10 g / L peptone, 5 g / L yeast powder, 10 g / L NaCl, the rest is water, 121°C, sterilization for 20 min.

[0026] Example 1. Whole cell catalysis of benzaldehyde hydrogenation reaction

[0027] 1. Construction of genetically engineered bacteria MC4100 (ΔhyaB, ΔhybC)

[0028] 1) Add 5 μL of plasmid pKD46 to 100 μL of MC4100 heat shock competent cells, mix gently, place on ice for 30 min, heat shock in a 42°C water bath for 45 s, immediately place on ice for 5 min, add 700 μL of LB liquid culture medium, place in a shaker at 30°C, 200 rpm for 1 h, centrifuge at 7000 rpm for 3 min, remove 700 μL of supernatant, resuspend the remaining bacteria, and evenly spread the bacterial solution on the solid LB culture medium with Amp with a sterile spreading stick, place in an incubator at 30°C and invert for 12-16 h to obtain strain MC4100 (pKD46). Then, the Kan-resistant fragment with the hyaB homology arm was used to electrotransform MC4100 (pKD46). The voltage of the electroporator was adjusted to 2500 V. An appropriate amount of donor DNA was aspirated and added to the bacterial solution in the ice bath. The mixture was immediately aspirated into the electroporation cup. 600 μL of LB medium was aspirated and the electroporation button was pressed at the same time. After the electroporation, LB medium was immediately added to the electroporation cup. The mixture was aspirated into a centrifuge tube. The tube was incubated at 37°C for 2 h. After centrifugation at 7000 rpm for 3 min, the supernatant was discarded and the remaining 100 μL was coated on the Kan plate. The tube was incubated at 37°C overnight to obtain the single-knockout MC4100 (ΔhyaB).

[0029] 2) The construction process of MC4100 (ΔhybC) is the same as above, except that the gene hyaB is replaced by hybC.

[0030] 3) The strain MC4100 (ΔhyaB) was made heat-shock competent, transformed with plasmid pCP20, coated on Amp plates, and cultured at 30°C overnight to heat-induce the expression of FLP recombinase and eliminate the Kan gene. The grown monoclonal was streaked on a non-resistant plate. After the colonies grew out at 30°C, the temperature was raised to 42°C and cultured overnight. The plasmid was gradually lost. The grown monoclonal was divided and streaked on Kan and Amp plates and cultured at 30°C to observe the results of resistance elimination and pCP20 plasmid loss. The same monoclonal did not grow on Kan and Amp plates. Growth on the non-resistant plate indicated that Kan was eliminated and the pCP20 plasmid was lost, thus obtaining the MC4100 (ΔhyaB) strain.

[0031] 4) Add 5 μL of plasmid pKD46 to 100 μL of MC4100 (ΔhyaB) competent cells, mix gently, place on ice for 30 min, heat shock in a 42°C water bath for 45 s, immediately place on ice for 5 min, add 700 μL of LB liquid culture medium, place in a shaker at 30°C, 200 rpm for 1 h, centrifuge at 7000 rpm for 3 min, remove 700 μL of supernatant, resuspend the remaining bacteria, and evenly spread the bacterial solution on the solid LB culture medium with Amp with a sterile spreading stick, place in an incubator at 30°C and invert for 12-16 h to obtain strain MC4100 (ΔhyaB, pKD46). Then, the Kan-resistant fragment with the hybC homology arm was used to electrotransform MC4100 (ΔhyaB, pKD46), and the voltage of the electroporator was adjusted to 2500V. An appropriate amount of donor DNA was aspirated and added to the bacterial solution in the ice bath, mixed and immediately aspirated into the electroporation cup, 600μL of LB medium was aspirated, and the electroporation button was pressed at the same time. After the electroporation, LB medium was immediately added to the electroporation cup, mixed and aspirated into a centrifuge tube, incubated at 37°C for 2h, centrifuged at 7000rpm for 3min, discarded the supernatant, and the remaining 100μL was coated on the Kan plate, and cultured at 37°C overnight. At this point, the double-knockout bacteria MC4100 (ΔhyaB, ΔhybC), MC4100-S, were obtained.

[0032] hyaB sequence: (SEQ ID NO.1)

[0033] ATGAGCACTCAGTACGAAACTCAGGGATACACCATCAATAATGCCGGACGCCGCCTG

[0034] GTGGTCGACCCGATTACGCGCATCGAAGGCCACATGCGCTGCGAAGTGAATATTAAC

[0035] GATCAGAATGTGATCACCAATGCCGTCTCCTGCGGCACCATGTTTCGCGGGCTGGAGA

[0036] TCATCCTACAAGGGCGCGACCCGCGCGATGCGTGGGCGTTCGTTGAACGTATCTGCGG

[0037] CGTCTGTACTGGCGTACACGCCCTGGCTTCGGTTTACGCCATCGAAGATGCTATCGGT

[0038] ATTAAAGTGCCGGACAACGCCAATATCATCCGCAACATTATGCTGGCAACGCTCTGGT

[0039] GCCACGATCATCTGGTGCACTTCTATCAGCTTGCCGGGATGGACTGGATCGATGTGTT

[0040] AGATGCGCTGAAAGCCGACCCGCGGAAAACCTCCGAACTGGCGCAAAGTCTCTCCTC

[0041] TTGGCCGAAATCATCCCCTGGCTATTTCTTCGACGTACAAAACCGCCTGAAAAAATTT

[0042] GTTGAAGGCGGGCAGTTGGGGATCTTCCGCAATGGCTACTGGGGGCACCCGCAGTAC

[0043] AAACTGCCGCCAGAAGCTAACCTGATGGGCTTTGCCCACTATCTCGAAGCTCTCGATT

[0044] TCCAGCGTGAAATTGTCAAAATCCACGCGGTCTTTGGCGGTAAAAACCCGCATCCAAA

[0045] CTGGATTGTCGGCGGGATGCCTTGCGCCATCAACATTGACGAAAGCGGCGCGGTCGG

[0046] GGCAGTCAATATGGAACGCCTGAACCTGGTGCAGTCAATTATCACCCGCACGGCGGA

[0047] CTTCATTAACAACGTGATGATCCCCGACGCCTTAGCCATCGGTCAGTTCAACAAACCG

[0048] TGGAGCGAAATCGGCACTGGTCTTTCTGATAAATGCGTTCTCAGCTACGGCGCATTCC

[0049] CGGATATTGCCAACGACTTTGGCGAGAAAAGTCTGCTGATGCCTGGCGGCGCGGTGAT

[0050] TAACGGCGACTTCAACAATGTGCTGCCAGTGGATTTGGTTGATCCGCAGCAGGTGCAG

[0051] GAGTTTGTCGACCACGCCTGGTATCGATATCCCAACGATCAGGTCGGGCGTCATCCGT

[0052] TCGATGGCATCACCGACCCGTGGTACAACCCCGGCGATGTCAAAGGCAGCGATACCA

[0053] ACATTCAGCAGCTGAATGAACAGGAACGCTACTCGTGGATCAAAGCGCCACGCTGGC

[0054] GCGGTAACGCGATGGAAGTGGGGCCGCTGGCGCGCACGTTAATCGCTTATCACAAAG

[0055] GCGATGCTGCGACCGTTGAGTCGGTCGATCGCATGATGTCGGCGTTGAACCTGCCGCT

[0056] TTCCGGTATCCAGTCAACGTTAGGCCGCATTTTGTGCCGCGCGCACGAAGCGCAGTGG

[0057] GCCGCAGGTAAGTTGCAGTATTTCTTCGACAAGCTGATGACCAACCTGAAAAACGGC

[0058] AATCTCGCCACTGCTTCCACGGAAAAATGGGAACCTGCAACCTGGCCGACAGAGTGC

[0059] CGTGGTGTCGGTTTTACCGAAGCGCCGCGCGGGGCGTTAGGCCACTGGGCCGCCATTC

[0060] GCGATGGCAAGATTGATCTCTACCAGTGCGTGGTGCCGACCACCTGGAACGCCAGCCC

[0061] GCGCGATCCCAAAGGGCAGATTGGCGCTTATGAAGCGGCGCTGATGAACACCAAAAT

[0062] GGCGATCCCCGAGCAACCGCTGGAGATCCTGCGTACTCTGCACAGCTTTGACCCGTGC

[0063] CTCGCCTGTTCAACACACGTGCTGGGCGACGACGGTAGCGAGCTGATCTCCGTGCAGG

[0064] TGCGTTAA

[0065] hybC sequence: (SEQ ID NO.2)

[0066] ATGAGCCAGAGAATTACTATTGATCCGGTAACCCGTATTGAGGGGCATTTACGCATCG

[0067] ATTGCGAAATCGAAAATGGCGTCGTTTCGAAAGCATGGGCTTCCGGTACCATGTGGCG

[0068] CGGCATGGAAGAGATCGTGAAAAACCGCGATCCGCGCGATGCATGGATGATTGTGCA

[0069] ACGTATCTGTGGCGTATGTACTACCACTCACGCGCTGTCTTCCGTTCGTGCGGCAGAA

[0070] AGTGCGCTGAATATCGACGTTCCGGTTAACGCGCAATACATCCGTAACATCATTCTGG

[0071] CTGCGCACACCACGCATGACCATATTGTTCATTTCTATCAGCTTTCGGCGCTGGACTGG

[0072] GTGGACATCACTTCTGCACTGCAAGCTGACCCAACCAAAGCCTCCGAAATGCTGAAA

[0073] GGCGTTTCGACCTGGCACCTGAACAGTCCGGAAGAGTTCACCAAAGTTCAGAACAAG

[0074] ATCAAAGATCTGGTTGCCAGCGGTCAGTTGGGTATTTTCGCTAATGGCTACTGGGGTC

[0075] ATCCGGCGATGAAACTGCCGCCGGAAGTGAACCTGATTGCGGTAGCGCACTACCTGC

[0076] AAGCGTTGGAGTGCCAGCGTGACGCTAACCGCGTCGTGGCGCTGCTGGGCGGTAAAA

[0077] CGCCGCACATTCAGAACCTGGCGGTAGGTGGTGTCGCGAACCCGATCAACCTCGACG

[0078] GTTTGGGCGTGCTGAACCTTGAGCGCCTGATGTACATCAAGTCTTTCATCGACAAACT

[0079] GAGCGACTTTGTTGAGCAGGTTTATAAGGTTGATACCGCAGTTATTGCCGCGTTCTAC

[0080] CCGGAATGGCTGACACGCGGTAAAGGTGCGGTGAACTACCTGAGCGTGCCGGAATTC

[0081] CCGACCGACAGTAAAAACGGCAGCTTCCTGTTCCCGGGCGGCTACATTGAGAATGCG

[0082] GATCTGTCCTCGTATCGTCCGATCACTTCTCATTCCGATGAATACCTGATCAAAGGCAT

[0083] TCAGGAAAGCGCGAAGCACTCCTGGTATAAAGACGAAGCGCCGCAGGCACCGTGGGA

[0084] AGGCACCACCATTCCGGCTTATGATGGTTGGTCTGACGACGGGAAATATTCCTGGGTG

[0085] AAATCACCGACTTTCTACGGCAAAACGGTAGAAGTGGGGCCACTGGCTAATATGCTG

[0086] GTGAAACTGGCGGCAGGTCGCGAATCTACCCAGAACAAACTGAATGAAATCGTTGCG

[0087] ATTTATCAGAAACTGACTGGCAACACGCTGGAAGTGGCACAGCTGCACTCCACGCTG

[0088] GGCCGTATTATTGGTCGTACCGTTCACTGCTGTGAATTGCAGGATATCCTGCAAAACC

[0089] AATACAGTGCACTGATCACCAATATCGGCAAAGGCGATCACACCACCTTTGTGAAGCC

[0090] GAAATTCCGGCAACGGGTGAATTCAAAGGTGTTGGCTTCCTCGAAGCGCCGCGCGGT

[0091] ATGCTCTCTCACTGGATGGTTATTAAAGACGGTATCATCAGCAACTACCAGGCGGTTG

[0092] TTCCATCAACCTGGAACTCTGGTCCGCGTAACTTCAATGATGACGTCGGTCCTTACGA

[0093] GCAGTCGCTGGTGGGTACACCGGTTGCCGATCCGAATAAACCGCTGGAAGTGGTGCG

[0094] TACCATTCACTCCTTTGACCCGTGCATGGCCTGTGCGGTACACGTAGTGGATGCTGACGGCAACGAAGTGGTTTCAGTGAAGGTTCTGTAA.

[0095] 2. The activated strain MC4100 (ΔhyaB, ΔhybC) was inoculated into a 50 mL centrifuge tube containing 45 mL of LB liquid medium (containing 50 mg / L kanamycin) at a ratio of 1:45, and cultured overnight under anaerobic conditions at 37°C. The OD 600And diluted to 1.0±0.02. 80mL of bacterial solution was collected for each group by centrifugation at 8000rpm for 10min, and the culture medium was removed by washing twice with MOPS buffer (pH=7). 80mL of 1mM Na2PdCl4 (pH3.5) was added to the washed cells, vortexed and incubated for 25min, and centrifuged at 8000rpm for 10min to collect the cells. The precipitate was washed twice with MOPS buffer, and the supernatant was retained. The absorbance was calculated by measuring the residual palladium in the supernatant using the SnCl2 method. 80mL of 25mM sodium formate was added to the palladium-treated cells, transferred to a 250mL anaerobic bottle, and shaken at 37°C until the reaction mixture changed color (24h) to obtain Escherichia coli loaded with nano-palladium.

[0096] After the reaction, the cells were centrifuged at 8000 rpm for 10 min to collect the cells, and the cells were broken and dried overnight in a freeze dryer, and then the valence distribution of Pd was tested and analyzed using an X-ray photoelectron spectrometer. The cell precipitate can also be fixed with 2.5% glutaraldehyde overnight, dehydrated with anhydrous ethanol gradient, and then dried overnight in a freeze dryer, and the morphological changes of Escherichia coli can be observed using a scanning electron microscope.

[0097] 3. Whole-cell catalytic hydrogenation reaction

[0098] Step 2 obtains the Escherichia coli of load nano palladium, and the bacteria are centrifuged and collected as catalyst (without breaking cells), added to another new catalytic system, and the Escherichia coli of load Pd is obtained by step 2, and the reaction mixture is centrifuged at 8000rpm for 5min, transferred to 1.5mL centrifuge tube, 9000rpm for 2min, centrifuged 3 times, and redundant water is reduced as much as possible. 10mL buffer, quantitative catalyst and benzaldehyde 1mmol are added to 10mL sealed glass tubes, hydrogen balloon is inserted, and the reaction is stirred at room temperature for 5h. After stopping the reaction, it is diluted 10 times with an equal amount of ethyl acetate extraction, and the standard curve concentration is set at 1, 2, 4, 6, 8, 10mmol / L, and TQ8050 gas chromatograph mass spectrometer and Agilent 7890B gas chromatograph are used to detect.

[0099] Figure 1 b is the XPS spectrum of the functional cells prepared under pH 3.5 conditions. Peak fitting proves the presence of 0-valent Pd in ​​the product, proving that this approach can use sodium formate to achieve Pd 2+ restoration. Figure 2 a is the GC-MS spectrum of the catalytic product of functional cells prepared under pH 3.5 conditions. The peak time is similar to that of the standard product, and it has been identified that benzyl alcohol is generated; Figure 3In the catalytic reaction of the functional cells prepared under pH 3.5 conditions, the conversion rate of benzaldehyde was 41.41% and the yield of benzyl alcohol was 17.68%, both of which proved that the functional cells prepared under this pH condition had certain catalytic properties.

[0100] Benzaldehyde conversion rate (%) = (converted benzaldehyde molar amount) / (initial benzaldehyde molar amount) × 100%;

[0101] Benzyl alcohol yield (%) = (actual molar amount of benzyl alcohol produced) / (theoretical molar amount of benzyl alcohol produced) × 100%.

[0102] Example 2. Whole cell catalysis of benzaldehyde hydrogenation reaction

[0103] 1. The activated strain MC4100 (ΔhyaB, ΔhybC) of Example 1 was inoculated into a 50 mL centrifuge tube containing 45 mL of LB liquid medium (containing 50 mg / L kanamycin) at a ratio of 1:45, and cultured overnight under anaerobic conditions at 37°C. The OD 600 And diluted to 1.0±0.02. 80mL of bacterial solution was added to each group, and the cells were collected by centrifugation at 8000rpm for 10min, and the culture medium was removed by washing twice with MOPS buffer (pH=7). 80mL of 1mM Na2PdCl4 (pH5.5) was added to the washed cells, and the cells were incubated for absorption for 25min after vortex treatment. The cells were collected by centrifugation at 8000rpm for 10min, and the precipitate was washed twice with MOPS buffer, and the supernatant was retained. The absorbance was calculated by measuring the residual palladium in the supernatant using the SnCl2 method. 80mL of 25mM sodium formate was added to the palladium-treated cells, transferred to a 250mL anaerobic bottle, and shaken at 37℃ until the reaction mixture showed a color change (24h) to obtain nano-palladium-loaded Escherichia coli. After the reaction, the cells were centrifuged at 8000rpm for 10min to collect the cells, and the cells were broken and dried overnight using a freeze dryer, and then the valence distribution of Pd was tested and analyzed using an X-ray photoelectron spectrometer.

[0104] 2. Step 1 obtains the Escherichia coli of load nano palladium, and the bacteria are centrifuged and collected as catalyst (without the need for cell crushing), added to another new catalytic system, and the Escherichia coli of load Pd is obtained by step 1, and the reaction mixture is centrifuged for 5min at 8000rpm, transferred to 1.5mL centrifuge tube, and centrifuged for 2min at 9000rpm, centrifuged 3 times, and redundant water is reduced as much as possible. 10mL buffer, quantitative catalyst and benzaldehyde 1mmol are added to 10mL sealed glass tubes, and a hydrogen balloon is inserted, and the reaction is stirred at room temperature for 5h. After the reaction is stopped, it is diluted 10 times with an equal amount of ethyl acetate extraction, and the standard curve concentration is set at 1, 2, 4, 6, 8, 10mmol / L, and TQ8050 gas chromatograph mass spectrometer and Agilent 7890B gas chromatograph are used to detect.

[0105] Figure 1 c is the XPS spectrum of the functional cells prepared under pH 5.5 conditions. Peak fitting proves the presence of 0-valent Pd in ​​the product, proving that this approach can use sodium formate to achieve Pd 2+ restoration. Figure 2 b is the GC-MS spectrum of the catalytic product of functional cells prepared under pH 5.5 conditions. The peak time is similar to that of the standard product, and it has been identified that benzyl alcohol is generated; Figure 3 In the catalytic reaction of the functional cells prepared under pH 5.5 conditions, the conversion rate of benzaldehyde was 40.19% and the yield of benzyl alcohol was 9.56%, both of which proved that the functional cells prepared under this pH condition had certain catalytic properties.

[0106] Example 3. Cyclic catalytic test of functional Escherichia coli

[0107] The functional cells after catalysis were obtained according to Example 1, extracted and washed once with ethyl acetate, washed twice with MOPS buffer, and the catalytic process was repeated 5 times, and detected using an Agilent 7890B gas chromatograph. The final cell precipitate was fixed with 2.5% glutaraldehyde overnight, dehydrated with anhydrous ethanol gradient, and then dried overnight in a freeze dryer, and the morphological changes of Escherichia coli were observed using a scanning electron microscope.

[0108] Figure 4 The GC results of the functional cells prepared under Na2PdCl4 pH3.5 conditions after 5 cycles of catalysis showed that the conversion rate of benzaldehyde remained at around 41% without a significant decrease. The stability test experiment showed that the constructed functional cells had a certain catalytic stability, providing data support for the realization of subsequent intracellular enzyme cascade catalysis. Figure 5 b and Figure 5 c are the morphology of functional cells after loading nano-palladium and cyclic catalysis, respectively. Figure 5 The morphology of the blank E. coli in a showed no obvious damage or breakage, indicating that the constructed functional cells had a certain loading capacity.

[0109] Figure 6 In order to study the effect of pH conditions on the location of Pd synthesis in the cell, MC4100-S synthesized Pd NPs under different pH conditions, and TEM was used to observe and analyze the location of Pd synthesis. It can be clearly seen that there are no white particles in the product spectrum under pH 2.2 conditions, while there are obvious white particles at pH 3-6. In addition, considering the effect of Os in the early stage, the products of this batch of experiments were not treated with Os. This shows that FDH inactivation under pH 2.2 conditions cannot reduce Pd 2+ , while pH3-6 conditions can achieve intracellular synthesis of Pd. From the product location, white particles are mostly located on the cytoplasm side under pH3-4 conditions, while white particles are mostly located on the inner membrane surface and periplasmic space under pH4.5-6 conditions.

[0110] Loading test method: Use an ELISA reader to monitor the removal of Pd(II) from the test solution. Dissolve 0.6g SnCl2 powder in 10mL concentrated HCl (25% v / v) to prepare Sn(II) reagent. For Pd(II) determination, add 160μL SnCl2 solution to a 96-well plate, then add 40μL Pd 2+ The sample solution and the blank group were Pd 2+ The sample solution was replaced with MOPS buffer, and the mixed solution was shaken at 30°C for 1 hour and then the absorbance at 463 nm was measured. The Pd content in the solution can be calculated according to the formula obtained from the standard curve. 2+ concentration;

[0111] The result was 0.009-0.045 mmol from pH 7-pH 2.2, the particle size was 5.99±1.72 nm, and it was tested under pH 3.5 conditions.

[0112] Comparative Example 1. Catalytic performance test of Escherichia coli (pH 5.5)

[0113] 1. The activated strain MC4100 (ΔhyaB, ΔhybC) was inoculated into a 50 mL centrifuge tube containing 45 mL of LB liquid medium (containing 50 mg / L kanamycin) at a ratio of 1:45, and cultured overnight at 37°C under microaerobic conditions. The OD 600And diluted to 1.0±0.02. 80mL of bacterial liquid was collected by centrifugation at 8000rpm for 10min in each group, and the cells were washed twice with MOPS buffer (pH=7) to remove the culture medium. 80mL of 20mM MOPS buffer (pH5.5) was added to the washed cells, incubated for 25min after vortex treatment, and centrifuged at 8000rpm for 10min to collect the cells, and the precipitate was washed twice with MOPS buffer. 80mL of 25mM sodium formate was added to the cells, transferred to a 250mL anaerobic bottle, and oscillated for 24h to obtain the treated Escherichia coli. After the reaction, the cells were collected by centrifugation at 8000rpm for 10min, the cells were broken and dried overnight in a freeze dryer, and then tested and analyzed using an X-ray photoelectron spectrometer. The cell precipitate can also be fixed with 2.5% glutaraldehyde overnight, dehydrated with anhydrous ethanol gradient, and then dried overnight in a freeze dryer, and the morphological changes of Escherichia coli can be observed using a scanning electron microscope.

[0114] 2. According to step 1, the treated Escherichia coli was obtained, and the bacteria were centrifuged and collected as catalysts (without breaking the cells), and added to another new catalytic system. According to step 1, the treated Escherichia coli was obtained, and the reaction mixture was centrifuged at 8000rpm for 5min, transferred to a 1.5mL centrifuge tube, and centrifuged at 9000rpm for 2min, centrifuged 3 times, and excess water was reduced as much as possible. 10mL buffer was added to a 10mL sealed glass tube, 1mmol of the quantitative catalyst and benzaldehyde was inserted, and a hydrogen balloon was inserted, and the reaction was stirred at room temperature for 5h. After stopping the reaction, the mixture was extracted with an equal amount of ethyl acetate and diluted 10 times. The standard curve concentration was set to 1, 2, 4, 6, 8, 10mmol / L, and the Agilent7890B gas chromatograph was used for detection.

[0115] Figure 1 a is the XPS spectrum of blank E. coli. It can be clearly seen that there is no obvious Pd 2+ and Pd 0 The peaks appear to provide certain comparisons for the results of the examples. Figure 3 The benzaldehyde conversion rate of the blank E. coli catalytic group was 20.37%, but no benzyl alcohol was produced, indicating that the blank E. coli could not catalyze the hydrogenation of benzaldehyde. Its conversion rate was presumably attributed to the aldehyde dehydrogenase present in the strain, which provided a certain comparison for the catalytic experiment in the example.

[0116] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Application of nano-palladium-loaded Escherichia coli in catalyzing the hydrogenation reaction of aromatic aldehydes, characterized in that: A method for obtaining functional Escherichia coli loaded with nano-palladium: after incubating the recombinant Escherichia coli with palladium solution, using formate as an enzyme substrate to react under micro-anaerobic conditions to obtain functional Escherichia coli loaded with nano-palladium; the recombinant Escherichia coli is based on the original Escherichia coli and any one or two of the genes encoding the catalytic subunits of [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2 are knocked out.

2. The use according to claim 1, characterized in that: The palladium solution is a Na2PdCl4 aqueous solution or a K2PdCl4 aqueous solution; the concentration of the palladium solution is 0.5-1.5mM, the incubation temperature is 20-50°C, the time is 20-30min, and the pH is 3.5-6; the water-soluble formate is a HCOONa aqueous solution or a HCOOK aqueous solution; the formate concentration in the reaction system is 5-25mM, and the reaction time is 24-72h.

3. The use according to claim 1, characterized in that: The concentration of the palladium solution is 1 mM, the incubation temperature is 37° C., the incubation time is 25 min, and the pH is 3.5; the water-soluble formate is HCOONa aqueous solution or HCOOK aqueous solution; the formate concentration in the reaction system is 25 mM, and the reaction time is 24 h.

4. The use according to claim 1, characterized in that The aromatic aldehyde is benzaldehyde.

5. A method for whole-cell catalytic hydrogenation of aromatic aldehydes, characterized in that: Aromatic alcohols are obtained by adding Escherichia coli loaded with nano-palladium to a solution of aromatic aldehydes for reaction.

6. The method according to claim 5, characterized in that The reaction conditions are room temperature, aqueous phase, atmospheric pressure, and stirring for 5 hours.

7. The method according to claim 5, characterized in that A method for obtaining functional Escherichia coli loaded with nano-palladium: after incubating recombinant Escherichia coli with palladium solution, using formate as an enzyme substrate to react under micro-anaerobic conditions to obtain functional Escherichia coli loaded with nano-palladium; the recombinant Escherichia coli is based on the original Escherichia coli and the genes encoding the catalytic subunits of [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2 are knocked out; the sequence of the gene encoding the catalytic subunit of [NiFe] hydrogenase 1 is shown in SEQ ID NO.1; and the sequence of the gene encoding the catalytic subunit of [NiFe] hydrogenase 2 is shown in SEQ ID NO.

2.

8. The method according to claim 7, characterized in that The palladium solution is a Na2PdCl4 aqueous solution or a K2PdCl4 aqueous solution; the concentration of the palladium solution is 0.5-1.5mM, the incubation temperature is 20-50°C, the time is 20-30min, and the pH is 3.5-6; the water-soluble formate is a HCOONa aqueous solution or a HCOOK aqueous solution; the formate concentration in the reaction system is 5-25mM, and the reaction time is 24-72h.

9. The method according to claim 5, characterized in that The loading amount of nano-palladium is 0.009-0.045mmol.

10. The method according to claim 5, characterized in that The size of nanopalladium is 5.99±1.72nm, and nanopalladium is zero-valent.

Images