Genetically engineered bacterium for producing pyrroloquinoline quinone and application of genetically engineered bacterium

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to construction and application of genetically engineered bacteria for producing PQQ. According to the invention, Escherichia coli K-12 MG1655 is used as a chassis cell, and genes pqqA and pqqBCDE, which are used for controlling the source of Gluconobacter oxydans 621H by a PT7 promoter, are integrated on a genome; performing copy number and promoter optimization on the pqqA gene, the pqqB gene, the pqqC gene, the pqqD gene and the pqqE gene in the pqq gene cluster; the method comprises the following steps: overexpressing and coding a metalloproteinase subunit TldD gene tlDd, and knocking out a coding DNA (Deoxyribose Nucleic Acid) to combine with a transcription dual-regulatory factor IscR gene iscR; enhancing the coding of the outer membrane protein A gene ompA; overexpressing a quinone protein glucose dehydrogenase coding gene gcd; the S-adenosylmethionine synthetase coding gene metK is integrated, and the efficient synthesis of the PQQ is realized through the method.

Description

Technical field: The invention belongs to the technical field of genetic engineering, and specifically relates to the construction and application of a genetically engineered bacterium for producing pyrroloquinoline quinone. Background technology: Pyrroloquinoline quinone (PQQ, 4,5-dicarbonyl-1-pyrrole-2,3-f-quinoline-2,7,9-tricarboxylic acid) is a B vitamin. Its pure product is a red powder, which is easily decomposed by light and soluble in water. It is the third oxidoreductase cofactor discovered after riboflavin nucleotides and pyridine nucleotides. It participates in the enzyme catalysis and transfer of electrons as a cofactor of some dehydrogenases in cells. There are genes that can synthesize pyrroloquinoline quinone in Gluconobacter oxydans, which are gene clusters. pqqABCDE Gene pqqA Gene encoding pyrroloquinoline quinone biosynthesis protein A, pqqB Gene encoding pyrroloquinoline quinone biosynthesis protein B, pqqC Gene encoding pyrroloquinoline quinone synthase, pqqD Gene encoding pyrroloquinoline quinone biosynthesis protein D, pqqE Encodes PqqA peptide cyclase.

[0003] Pyrroloquinoline quinone has extremely strong antioxidant properties. In the reduced state, the antioxidant activity of pyrroloquinoline quinone is much higher than that of vitamin C. It can be used in the field of food additives to play a role in preservation. Pyrroloquinoline quinone can regulate the level of free radicals in the body, eliminate inflammation in the body, maintain cardiopulmonary function, and repair mitochondrial damage. It may be a new option for the treatment of inflammatory syndromes. In addition, pyrroloquinoline quinone can also enhance the antibacterial ability of plants and improve their ability to adapt to the environment, which plays an important guiding role in plant production. It can be seen that PQQ has broad application prospects in many fields such as food, medicine and agriculture.

[0004] At present, the production methods of pyrroloquinoline quinone (PQQ) include natural product extraction, chemical synthesis, enzyme synthesis and fermentation. The production of PQQ is usually based on fermentation, with Methylophagous Bacteria ( Methylovorus sp . ) and other natural strains to ferment and produce PQQ, but this method has a series of problems such as heavy workload, unclear genetic background, difficulty in screening, and difficulty in subsequent transformation. In addition, the selected culture medium contains methanol, which is costly, has a long fermentation cycle, and is dangerous to operate. It is not suitable for large-scale industrial production of PQQ, which is a key issue restricting its industrialization. E. coli It has the advantages of clear genetic background, short growth cycle and low cultivation cost, and is widely used in synthetic biology. E. coliThe host strain for producing PQQ has the characteristics of short fermentation cycle and clear genetic background. It uses glucose as carbon source, has low production cost, replaces methanol as carbon source, has a series of advantages such as safe operation, and has the potential for large-scale production of PQQ. Escherichia coli K-12MG1655 is a chassis cell that achieves efficient synthesis of PQQ and has important industrial application value. Summary of the invention: In view of the above problems, the present invention aims to provide a genetically engineered bacterium for producing PQQ, as well as its construction and application, and formulates a corresponding fermentation process control scheme, which has good industrial application prospects.

[0006] The technical solution of the present invention is summarized as follows: One of the technical solutions provided by the present invention is a method for producing PQQ by integrating the gene into the genome of the Escherichia coli host cell pqqA ,Gene pqqBCDE ; Overexpression of the gene encoding the metalloproteinase subunit TldD tldD ; Knockout the gene encoding the DNA binding and transcription dual regulatory factor IscR iscR ; Strengthen the gene encoding outer membrane protein A ompA ; Overexpression of the gene encoding quinone protein glucose dehydrogenase gcd ; Integration of S-adenosylmethionine synthetase encoding gene metK , the efficient synthesis of PQQ is achieved by the above method; Preferably, the host is Escherichia coli K-12 MG1655; Preferably, by P trc or P T7 Promoters control gene expression; Furthermore, the gene is integrated into the genome pqqA ,Gene pqqBCDE On this basis, further pqqA, pqqB, pqqE To strengthen expression; Furthermore, the gcd The gene was overexpressed in 3 copies; Furthermore, the gene pqqA, pqqBCDE Derived from Gluconobacter oxydans ( Gluconobacter oxydans )621H; Furthermore, the gene pqqA , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 1; Furthermore, the gene pqqBCDE , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 2; Furthermore, the genepqqB , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 3; Furthermore, the gene pqqC , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 4; Furthermore, the gene pqqD , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 5; Furthermore, the gene pqqE , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 6; Furthermore, the gene encoding the metalloproteinase subunit TldD tlDd From Escherichia coli K-12MG1655, the nucleotide sequence is shown in the sequence listing SEQ ID NO. 7; Furthermore, the gene encoding the DNA binding transcription dual regulatory factor IscR iscR From Escherichia coli K-12 MG1655, the nucleotide sequence is shown in SEQ ID NO. 8 in the sequence listing; Furthermore, the gene encoding outer membrane protein A ompA From Escherichia coli K-12 MG1655, the nucleotide sequence is shown in the sequence listing as SEQ ID NO. 9; Furthermore, the gene encoding quinone protein glucose dehydrogenase gcd From Escherichia coli K-12MG1655, the nucleotide sequence is shown in the sequence listing SEQ ID NO. 10; Furthermore, the gene encoding S-adenosylmethionine synthetase metK From Escherichia coli K-12 MG1655, the nucleotide sequence is shown in the sequence listing SEQ ID NO. 11.

[0007] The second technical solution provided by the present invention is a genetically engineered bacterium that produces PQQ. The genetically engineered bacterium uses Escherichia coli as a host and integrates a gene into the genome. pqqA and pqqBCDE, At the same time, add another copy pqqA, pqqB and pqqE ; Overexpression of the gene encoding the metalloproteinase subunit TldD tlDd ; Knockout of the IscR gene encoding the DNA binding and transcriptional dual regulator iscR ; Strengthen the gene encoding outer membrane protein A ompA ; 3 copies overexpressing the gene encoding the quinone protein glucose dehydrogenase gcdGene; Integration of the gene encoding S-adenosylmethionine synthetase metK Genetically acquired.

[0008] The present invention also provides a method for constructing the genetically engineered bacteria for producing PQQ, which is specifically as follows: In the present invention, CRISPR / Cas9-mediated gene editing technology is used to Escherichia coli K-12MG1655 is directional modified, including the following steps: (1) Construct the PQQ synthesis pathway. Escherichia coli K-12 MG1655 genome integrated by P T7 Promoter-controlled pqqA Gene (nucleotide sequence as shown in SEQ ID NO. 1), pqqBCDE gene (nucleotide sequence as shown in SEQ ID NO. 2); pqqA Gene , pqqB Gene (nucleotide sequence as shown in SEQ ID NO. 3), pqqE Gene (nucleotide sequence as shown in SEQ ID NO. 6 in the sequence table) is overexpressed; overexpression of the metalloproteinase subunit TldD tlDd gene (nucleotide sequence as shown in SEQ ID NO. 7 in the sequence table); knocking out the gene encoding the DNA binding transcription dual regulatory factor IscR iscR Gene (nucleotide sequence as shown in SEQ ID NO. 8 in the sequence table); Strengthen the gene encoding outer membrane protein A ompA (The nucleotide sequence is shown in the sequence listing SEQ ID NO. 9).

[0009] (2) Increase the expression of glucose dehydrogenase. yciQ, yghE, yjiV On the top, integrated with P trc The promoter controls the gene encoding the quinone protein glucose dehydrogenase gcd Gene (nucleotide sequence is shown in sequence listing SEQ ID NO. 10).

[0010] (3) Increase SAM supply. At the pseudogene site ylbE On the top, integrated with P trc The promoter controls the gene encoding S-adenosylmethionine synthetase metK Gene (nucleotide sequence is shown in sequence listing SEQ ID NO. 11).

[0011] The third technical solution provided by the present invention is the application of the engineering bacteria described in the second technical solution in the production of PQQ; Furthermore, the method for producing PQQ by shake flask fermentation using the above genetically engineered bacteria is as follows: (1) Strain activation: Under sterile conditions, aspirate the bacterial solution from the bacterial preservation tube and inoculate it into an LB shaking tube (the inoculation volume is 2-10‰), place it in a shaker, and culture it at 35-37 ℃ and 180-240 rpm for 10-13 h.

[0012] (2) First-generation slant culture: Under sterile conditions, take three loops of bacterial liquid from the shake tube after 10-13 h of culture, streak densely on the slant solid culture medium, and culture at 35-37 ℃ for 10-13 h.

[0013] (3) Second generation slant culture: Under sterile conditions, scrape the bacterial sludge from the bacterial slant solid culture medium onto a new slant solid culture medium and streak it densely, then culture it at 35-37 ℃ for 10-13 h.

[0014] (4) Seed bottle culture: Under sterile conditions, use an inoculation loop to pick up the bacterial sludge on the slant culture medium and culture it in a seed bottle. Cultivate it at 35-37 ℃ and 180-240 rpm for 10-13 h.

[0015] (5) Shake flask culture: Under sterile conditions, add the seed solution to the shake flask at an inoculation rate of 10-15%, and culture at 35-37°C and 180-240 rpm. During the fermentation process, the pH of the fermentation liquid is adjusted to 6.8-7.2 by adding ammonia water. When the pH of the fermentation liquid containing phenol red reagent does not decrease slowly or increases, it indicates that the bacteria lack sugar. Add 60% (m / v) glucose solution and ferment for 60-84 hours. Preferably, the slant culture medium comprises: 4-6 g / L yeast powder, 8-10 g / L peptone, 8-10 g / L NaCl, 8-10 g / L beef extract, 1-2 g / L sucrose, 18-20 g / L agar powder, and the remaining ingredients are water.

[0016] Preferably, the seed culture medium comprises: 4-6 g / L yeast powder, 8-10 g / L peptone, 8-10 g / L NaCl, and the rest is water, with a pH of 6.8-7.2.

[0017] Preferably, the fermentation medium composition is: glucose 18-25 g / L, Na 2 HPO 4 ·12 H 2 O 15-20 g / L, KH 2 PO 4 2-3.5 g / L, NH 4 Cl 0.5-2 g / L, NaCl 0.2-0.8 g / L, MgSO 4 7H 2O 0.4-0.5 g / L, CaCl 2 6H 2 O 0.2-0.3 g / L, xylose 5-15 g / L, phenol red indicator 1-2%, defoamer 1-2 drops, the rest is water, pH 6.8-7.2. After 60-84 h of shake flask fermentation, the PQQ yield reaches 300-500 mg / L.

[0018] Furthermore, the method for producing PQQ by fermentation in a 2 L fermentation tank using the above genetically engineered bacteria is as follows: (1) Strain activation: Under sterile conditions, aspirate the bacterial solution from the bacterial preservation tube and inoculate it into an LB shaking tube (the inoculation volume is 2-10‰), place it in a shaker, and culture it at 35-37 ℃ and 180-240 rpm for 10-13 h.

[0019] (2) First-generation slant culture: Under sterile conditions, take three loops of bacterial liquid from the shake tube after 10-13 h of culture, streak densely on the slant solid culture medium, and culture at 35-37 ℃ for 10-13 h.

[0020] (3) Second generation slant culture: Under sterile conditions, scrape the bacterial sludge from the bacterial slant solid culture medium onto a new slant solid culture medium and streak it densely, then culture it at 35-37 ℃ for 10-13 h.

[0021] (4) Seed bottle culture: Under sterile conditions, use an inoculation loop to pick up the bacterial sludge on the slant culture medium and culture it in a seed bottle. Cultivate it at 35-37 ℃ and 180-240 rpm for 10-13 h.

[0022] (5) Fermentation tank culture: During the preparation process, weigh 800 mL of the fermentation medium components of the system, prepare and adjust the volume to 620 mL, sterilize, and inoculate the seed liquid into the fermentation medium at a 10% inoculum (80 mL), followed by 50 mL of 288-400 g / L glucose and 80-240 g / L xylose, and 50 mL of 3.2-4.8 g / L CaCl 2 The fermentation temperature was controlled at 37 °C, the dissolved oxygen was maintained at 25%-40%, and the pH electrode displayed the pH in the tank during the fermentation process. The pH was maintained at 6.8-7.2 by adding ammonia water. When the dissolved oxygen in the tank rose sharply and the pH rose slowly, indicating that the cells had consumed the substrate sugar, 80% glucose (m / v) solution was added and fermented for 60-84 h.

[0023] After 60-84 h of fermentation in a 2 L fermenter, the PQQ production reached 600-900 mg / L.

[0024] Preferably, the slant culture medium comprises: 4-6 g / L yeast powder, 8-10 g / L peptone, 8-10 g / L NaCl, 8-10 g / L beef extract, 1-2 g / L sucrose, 18-20 g / L agar powder, and the remaining ingredients are water.

[0025] Preferably, the seed culture medium comprises: 4-6 g / L yeast powder, 8-10 g / L peptone, 8-10 g / L NaCl, and the rest is water, with a pH of 6.8-7.2.

[0026] Preferably, the fermentation medium composition is: glucose 18-25 g / L, Na 2 HPO 4 ·12 H 2 O 15-20 g / L, KH 2 PO 4 2-3.5 g / L, NH 4 Cl 0.5-2 g / L, NaCl 0.2-0.8 g / L, MgSO 4 7H 2 O 0.4-0.5 g / L, CaCl 2 6H 2 O 0.2-0.3 g / L, xylose 5-15 g / L, defoamer 1-2 drops, the rest is water, pH 6.8-7.2.

[0027] Beneficial effects: The present invention uses Escherichia coli Escherichia coli K-12 MG1655 was used as the starting strain. Gluconobacter oxydans 621H source pqqA, pqqBCDE Integration into the genome enables the synthesis of PQQ; pqqA, pqqB , pqqE Gene copy number and promoter optimization; knockout of the IscR gene encoding the DNA binding transcriptional dual regulatory factor iscR ; Strengthen the gene encoding outer membrane protein A ompA ; Through multiple copy integration to P trc Promoter-controlled quinone protein glucose dehydrogenase gcd Genes, increase the bacterial demand for PQQ synthesis; increase SAM supply, integrate P trc S-adenosylmethionine synthetase gene under promoter control metK , a high-yield PQQ strain was obtained. The PQQ yield reached 600-900 mg / L in a 2 L fermenter for 60-84 h. The constructed strain can achieve efficient synthesis of PQQ using only glucose as the carbon source, and has important industrial application value. Description of the drawings: Figure 1 :P T7 - pqqBCDE Construction of gene integration fragment and electrophoresis verification diagram; Where: M: Marker; 1; Upstream homology arm; 2: Downstream homology arm; 3: P T7 - pqqBCDE Fragment; 4: original bacterial genome PCR fragment; 5: integrated genome PCR fragment.

[0029] Figure 2 : gcd Electrophoresis verification diagram of gene integration fragment; Wherein: M: 1kb DNA marker; 1: upstream homology arm; 2: downstream homology arm; 3: overlapping fragment; 4: original bacteria control; 5: strain PQQ-15 positive bacteria identification fragment.

[0030] Figure 3 : Genetically engineered bacteria fermentation yield diagram; Wherein: are the shake flask fermentation yield graphs of PQQ-13, PQQ-16 and PQQ-17 in Example 1 respectively. Specific implementation method: The present invention is described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are limited only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments, without departing from the essence and scope of the present invention, also belong to the protection scope of the present invention.

[0032] Embodiment 1: E. coli Construction of K-12 MG1655 Pyrroloquinoline Quinone Genetically Engineered Bacteria CRISPR / Cas9 gene editing technology is used to perform targeted gene modification. The gene editing method used in the present invention is referenced to the literature (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR–Cas9 meditated genome editing. Metabolic engineering, 2015,31: 13-21.).

[0033] The main methods used in the strain construction process are as follows: (1) Construction of pGRB plasmid: The target sequence (PAM: 5'-NGG-3') was designed by CRISPR RGEN Tools to cut the target gene. The forward primer and reverse primer were synthesized and annealed. 10 μL of each forward primer and reverse primer were pipetted into an EP tube, mixed evenly, and annealed by PCR to form double-stranded fragments. The DNA was pre-denatured at 95 °C for 5 min; annealed at 50 °C for 1 min to obtain a DNA fragment, which was homologously recombined with the pGRB linear vector obtained by reverse PCR. The kit used for homologous recombination was the ClonExpress®ⅡOne Step Cloning Kit series.

[0034] (2) Construction of overlapping DNA fragments for integration: The DNA fragments used for gene integration include upstream homology arms, target genes, and downstream homology arms. Upstream homology arm primers and downstream homology arm primers are designed according to the characteristics of the gene site to be integrated and synthesized into upstream and downstream homology arm fragments, which are usually about 500 bp in length; primers for gene amplification are designed based on the gene to be integrated as a template, and gene fragments are synthesized by PCR. Overlapping PCR forms overlapping fragments for gene integration.

[0035] (3) Preparation of competent cells: Culture the cells in 100 mL 2×YT medium until the OD 600 =0.2-0.4, start preparing competent cells, culture conditions are 35-37 ℃, 180-240 rpm (with pRedCas9 plasmid cultured at 32 ℃) and proceed according to routine preparation of competent cells.

[0036] (4) Transformation of pGRB plasmid and recombinant DNA: The pGRB plasmid and overlapping DNA fragments were simultaneously electroporated into electrocompetent cells containing pRedCas9. After 2 h of resuscitation of the electroporated bacteria, they were spread on LB plates containing ampicillin and spectinomycin and cultured at 32°C overnight. Colony PCR verification was performed using the upstream primer of the upstream homology arm and the downstream primer of the downstream homology arm, or specially designed identification primers, to screen for positive recombinants.

[0037] (5) Elimination of plasmid: The selected positive recombinants were inoculated into LB shake tubes containing 0.2% arabinose, spectinomycin and ampicillin, and cultured overnight at 35-37°C and 180-240 rpm. The plates were spread on LB plates with spectinomycin and cultured for 12 h. The dotted lines were compared with the plates with spectinomycin and ampicillin. The bacteria that did not grow on the ampicillin plate but grew on the spectinomycin plate indicated that the pGRB plasmid had been lost. The selected positive recombinants were inoculated into LB shake tubes and cultured overnight at 42°C and 220 rpm. The plates were spread on LB plates and cultured for 12 h. The dotted lines were compared with the plates with spectinomycin and no antibiotics. The bacteria that did not grow on the spectinomycin plate but grew on the plate without antibiotics indicated that the pRedCas9 plasmid had been lost.

[0038] (6) The promoter used in the present invention P trc The promoter nucleotide sequence is as follows: TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC; P T7 The promoter, nucleotide sequence is as follows: TAATACGACTCACTATAGGGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC; The specific method of strain construction is as follows: (1) Construction of PQQ synthesis pathway Escherichia coli ( E. coli K12 MG 1655) genome as a template, according to the pseudogene loci lafU Design upstream and downstream homology arm primers based on the upstream and downstream sequences of the gene lafU -UF , lafU -P T7 -UR, lafU -P T7 -DF, lafU -DR, synthesized DNA fragments by PCR, obtained lafU The upstream and downstream homology arms are based on the optimized target gene pqqA Sequence (SEQ ID NO.1) to design upstream and downstream primers of the target gene pqqA- P T7 -UF, pqqA -P T7 -DR, synthesized by PCR T7 - pqqA DNA fragments were obtained to obtain the target gene P T7- pqqA , will obtain lafU The upstream and downstream homology arms, as well as the target gene P T7 - pqqA Overlapping fragments were generated by overlapping PCR lafU -P T7 - pqqA , for integrated genomic integration.

[0039] Use the gRNA search tool (http: / / www.rgenome.net / cas-designer) to find the appropriate gRNA sequence and design gRNA- lafU -S and gRNA- lafU- A sequence (primers see Table 2), and the two single-stranded primers are annealed by PCR to make the bases of the two single-stranded primers complementary to form double-stranded DNA (gRNA- lafU ), homologously recombined with the pGRB linear vector to form pGRB- lafU .Will lafU -T7- pqqA and pGRB- lafU Electric transfer E. coli After the K12 MG 1655 competent cells were revived, they were spread on LB plates with spectinomycin and ampicillin, cultured overnight at 32°C, and colony PCR was performed to verify and screen out positive recombinants. lafU Plasmid.

[0040] Using the same method as above (primers see Table 2), continue ygaY Gene integrated into pseudogene locus pqqBCDE (SEQ ID NO. 2, verification diagram as shown Figure 1 as shown), achieving successful integration pqqA and pqqBCDE The positive strain PQQ-01 was verified by shake flask fermentation to have a PQQ yield of 62.5 mg / L, achieving the synthesis of PQQ. yjgX Integration is controlled by the T7 promoter pqqA (SEQ ID NO. 1), strain PQQ-02 was obtained, and the PQQ yield was verified to be 67.7 mg / L by shake flask fermentation.

[0041] Using the same method as above (primers are shown in Table 2), the pseudogene locus of strain PQQ-02 was yeep The trc and T7 promoters were integrated into pqqBSequence (SEQ ID NO. 3), strains PQQ-03 and PQQ-04 were obtained, and the PQQ yields verified by shake flask fermentation were 68.3 mg / L and 81.8 mg / L, respectively. However, due to the excessive transcription intensity of the T7 promoter in strain PQQ-04, the bacterial OD 600 The PQQ-03 strain was significantly decreased, and although the PQQ production was increased, it had a greater impact on bacterial growth. Therefore, the strain PQQ-03 was selected for subsequent transformation experiments. In the subsequent strain transformation, the trc promoter will also be used to control gene expression.

[0042] Using the same method as above (primers are shown in Table 2), the pseudogene locus of strain PQQ-03 was rph The trc promoter-controlled pqqC (SEQ ID NO. 4) , pqqD (SEQ ID NO. 5) , pqqE (SEQ ID NO. 6) gene, and obtained single copy P trc - pqqC, P trc - pqqD, P trc - pqqE strains PQQ-05, 06, and 07 of the gene; then the pseudogene loci of strains PQQ-05, 06, and 07 were obtained ilvG The trc promoter was then integrated into pqqC, pqqD, pqqE Gene, respectively, obtained double copies of P trc - pqqC, P trc - pqqD, P trc - pqqE The strains PQQ-08, 09, and 10 with the gene were fermented in shake flasks. The fermentation results showed that: rph Integrated single copy P trc - pqqE The PQQ production effect of strain PQQ-07 was the best, reaching 74.5 mg / L, which was 9% higher than that of strain PQQ-03.

[0043] Finally, the pseudogene loci of strain PQQ-07 were cloned in the same manner as above (primers are shown in Table 2). yjiT Integration of genes controlled by the trc promoter tlDd (SEQ ID NO. 7), knocking out the gene encoding the DNA binding transcriptional dual regulatory factor IscR iscR (SEQ ID NO. 8), at the pseudogene site ilvG Integration is controlled by the trc promoter ompASequence (SEQ ID NO.9) was prepared to improve the efficiency of PQQ output from cells. During the process, strains PQQ-11, PQQ-12, and PQQ-13 were obtained respectively. The PQQ yields after shake flask fermentation were 93.2 mg / L, 96.1 mg / L, and 96.2 mg / L, respectively. The yield of strain PQQ-13 was 29.1% higher than that of strain PQQ-07. Figure 3 .

[0044] (2) Increasing the demand for PQQ synthesis Escherichia coli ( E. coli K12 MG 1655) genome as a template, according to the pseudogene loci yciQ Design upstream and downstream homology arm primers based on the upstream and downstream sequences of the gene yciQ -UF, yciQ -P trc - UR, yciQ -P trc - DF, yciQ -DR, synthesized by PCR yciQ The upstream and downstream homology arms of the target gene gcd Sequence (SEQ ID NO.10) was used to design upstream and downstream primers of the target gene. gcd -P trc -UF, gcd -P trc -DR, synthesized by PCR as DNA fragment P trc -gcd , and then by overlapping PCR yciQ Gene upstream and downstream homology arms and P trc -gcd Forming fragments yciQ- trc -gcd Use the gRNA search tool (http: / / www.rgenome.net / cas-designer) to find the appropriate gRNA sequence and design gRNA- yciQ -S and gRNA- yciQ -A sequence, and the two single-stranded primers are annealed by PCR to complement each other to form double-stranded DNA (gRNA- yciQ ), homologously recombined with the pGRB linear vector to form pGRB- yciQ . yciQ -trc- gcd and pGRB- yciQ The cells were electroporated into competent cells of strain PQQ-13, and after recovery, they were spread on LB plates with spectinomycin and ampicillin, cultured overnight at 32°C, and colony PCR was performed to verify and screen out positive recombinants.yciQ Plasmid, finally successfully integrated gcd The positive strain was isolated and strain PQQ-14 was obtained.

[0045] In the above method, yghE , yjiV The pseudogene locus is integrated with a trc promoter-controlled gcd The strains PQQ-15 and PQQ-16 were obtained by PCR. The fermentation results showed that the PQQ yield of strain PQQ-16 was the highest, at 256 mg / L. The yield of strain PQQ-16 was 1.66 times higher than that of strain PQQ-13. Figure 3 .

[0046] (3) Increase SAM supply Escherichia coli ( E. coli K12-MG 1655) genome as a template, according to the pseudogene loci ylbE Design upstream and downstream homology arm primers based on the upstream and downstream sequences of the gene ylbE -UF, ylbE -P trc -UR, ylbE -P trc -DF, ylbE -DR, synthesized by PCR ylbE The upstream and downstream homology arms of the target gene metK Sequence (SEQ ID NO.11) to design upstream and downstream primers of the target gene metK -P trc -UF, metK -P trc -DR, synthesized by PCR trc -metK The DNA fragments were then transformed into ylbE The upstream and downstream homology arms and P trc -metK Overlapping fragments ylbE -trc- metK Use the gRNA search tool (http: / / www.rgenome.net / cas-designer) to find the appropriate gRNA sequence and design gRNA- ylbE -S and gRNA- ylbE -A sequence, and the two single-stranded primers are annealed by PCR to complement each other to form double-stranded DNA (gRNA- ylbE ), homologously recombined with the pGRB linear vector to form pGRB- ylbE . The overlapping fragments ylbE -trc- metK and pGRB-YlB The cells were electroporated into competent cells of strain PQQ-16, and after recovery, they were spread on LB plates with spectinomycin and ampicillin, cultured overnight at 32°C, and colony PCR was performed to verify and select positive recombinants. YlB Plasmid, finally successfully integrated P trc -metK The positive strain was obtained to obtain strain PQQ-17, and the yield was shown in Figure 3 .

[0047] The engineered strain was subjected to shake flask fermentation test (the fermentation method is shown in Example 3). The fermentation results showed that: metK The PQQ yield of strain PQQ-17 with the gene was 423 mg / L. After fermentation test in a 2 L fermenter (the fermentation method is shown in Example 4), the PQQ yield was 856 mg / L, and the PQQ shake flask fermentation yield was 5.8 times higher than that of strain PQQ-01. The results are summarized in Table 1.

[0048] Table 1 Strain information during strain construction

[0049] Note: The fermentation method corresponding to the shake flask fermentation yield in Table 1 is Example 3. Table 2 Primers involved in strain construction

[0050]

[0051]

[0052] Example 2: Production of PQQ by Genetically Engineered Bacteria PQQ-17 Shake Flask Fermentation Production Method (1) Strain activation: Under sterile conditions, aspirate the bacterial solution from the bacterial preservation tube and inoculate it into an LB shaking tube (inoculation volume is 3‰), place it in a shaker, and shake and culture it at 35°C and 180 rpm for 11 h.

[0053] (2) First-generation slant culture: Under sterile conditions, take two loops of bacterial culture from the shake tube after 11 h of culture, streak densely on the slant solid culture medium, and culture at 35°C for 11 h.

[0054] (3) Second generation slant culture: Under sterile conditions, scrape the bacterial sludge from the bacterial slant solid culture medium onto a new slant solid culture medium and streak it densely, then culture it at 35°C for 11 h.

[0055] (4) Seed bottle culture: Use an inoculation loop to inoculate the bacteria on the slant into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium to prepare the seed solution. Seal the flask with twelve layers of gauze and shake at 35°C and 180 rpm for 11 h. (5) Fermentation culture: The seed liquid was inoculated into the fermentation medium at a rate of 10% (V:V) and cultured at 35°C and 180 rpm with shaking. During the fermentation process, ammonia water was added to maintain the pH at 6.8-7.2. When the phenol red indicator showed that the pH did not decrease slowly or even increased, indicating that the bacteria were lacking sugar, 0.5 mL of 60% glucose (m / v) solution was added and fermented for 72 h.

[0056] The components of the slant culture medium are: yeast powder 4 g / L, peptone 9 g / L, NaCl 9 g / L, beef extract 9 g / L, sucrose 1 g / L, agar powder 18 g / L, and the rest is water.

[0057] The composition of the seed culture medium is: yeast powder 4 g / L, peptone 9 g / L, NaCl 9 g / L, and the rest is water, pH 6.9.

[0058] The fermentation medium composition is: glucose 18 g / L, Na 2 HPO 4 ·12 H 2 O 16.62 g / L, KH 2 PO 4 2 g / L, NH 4 Cl 0.8 g / L, NaCl 0.4 g / L, MgSO 4 7H 2 O 0.4 g / L, CaCl 2 6H 2 O 0.2 g / L, xylose 8 g / L, phenol red indicator 2%, 1 drop of defoamer, and the rest is water, pH 6.8-7.2.

[0059] The fermentation results showed that the PQQ yield of strain PQQ-17 reached 365 mg / L after 72 h of shake flask fermentation in M9 fermentation medium, which has high industrial value.

[0060] Example 3: Production of PQQ by Genetically Engineered Bacteria PQQ-17 Shake Flask Fermentation Production Method (1) Strain activation: Under sterile conditions, aspirate the bacterial solution from the bacterial preservation tube and inoculate it into an LB shaking tube (inoculation volume is 2‰), place it in a shaker, and shake and culture it at 37°C and 220 rpm for 12 h.

[0061] (2) First-generation slant culture: Under sterile conditions, take 3 loops of bacterial liquid from the shake tube after 12 h of culture, streak densely on the slant solid culture medium, and culture at 37°C for 12 h.

[0062] (3) Second generation slant culture: Under sterile conditions, scrape the bacterial sludge from the bacterial slant solid culture medium onto a new slant solid culture medium and streak it densely, then culture it at 37°C for 12 h.

[0063] (4) Seed bottle culture: Use an inoculation loop to inoculate the bacteria on the slant into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium to prepare the seed solution. Seal the flask with twelve layers of gauze and shake at 37°C and 220 rpm for 12 h. (5) Fermentation culture: The seed liquid was inoculated into the fermentation medium at a rate of 10% (V:V). The culture was shaken at 37 °C and 220 rpm. During the fermentation process, the pH was maintained at 6.8-7.2 by adding ammonia water. When the phenol red indicator showed that the pH did not decrease slowly or even increased, indicating that the bacteria were lacking sugar, 1 mL of 60% glucose (m / v) solution was added and the culture was fermented for 72 h.

[0064] The components of the slant culture medium are: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, beef extract 10 g / L, sucrose 1 g / L, agar powder 20 g / L, and the rest is water.

[0065] The components of the seed culture medium are: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, and the rest is water, pH 6.8-7.2.

[0066] The fermentation medium composition is: glucose 20 g / L, Na 2 HPO 4 ·12 H 2 O 17.12 g / L, KH 2 PO 4 3 g / L, NH 4 Cl 1 g / L, NaCl 0.5 g / L, MgSO 4 7H 2 O 0.492 g / L, CaCl 2 6H 2 O 0.219 g / L, xylose 10 g / L, phenol red indicator 2%, defoamer 1-2 drops, the rest is water, pH 6.8-7.2.

[0067] The fermentation results showed that the PQQ yield of strain PQQ-17 reached 423 mg / L after 72 h of shake flask fermentation in M9 fermentation medium, which has high industrial value.

[0068] Example 4: Production of PQQ by Fermentation in a 2 L Fermentation Tank Using Genetically Engineered Bacteria PQQ-17 (1) Strain activation: Under sterile conditions, aspirate the bacterial solution from the bacterial preservation tube and inoculate it into an LB shaking tube (inoculation volume is 2‰), place it in a shaker, and shake and culture it at 37°C and 220 rpm for 12 h.

[0069] (2) First-generation slant culture: Under sterile conditions, take 3 loops of bacterial liquid from the shake tube after 12 h of culture, streak densely on the slant solid culture medium, and culture at 37°C for 12 h.

[0070] (3) Second generation slant culture: Under sterile conditions, scrape the bacterial sludge from the bacterial slant solid culture medium onto a new slant solid culture medium and streak it densely, then culture it at 37°C for 12 h.

[0071] (4) Seed bottle culture: Use an inoculation loop to inoculate the bacteria on the slant into a 500 mL Erlenmeyer flask containing 80 mL of seed culture medium to prepare the seed solution. Seal the flask with twelve layers of gauze and shake at 37°C and 220 rpm for 12 h. (5) Fermentation culture: During the preparation process, weigh 800 mL of the culture medium components corresponding to the fermentation broth, prepare and adjust the volume to 620 mL, sterilize, and then inoculate the seed liquid into the fermentation medium at a rate of 10% (80 mL). Then, add 50 mL of 320 g / L glucose and 160 g / L xylose, and 50 mL of 3.504 g / L CaCl 2 The solution was maintained at a temperature of 37 °C and a dissolved oxygen of 30%. During the fermentation process, the pH in the tank was displayed by a pH electrode and the pH was maintained at 6.8-7.2 by adding ammonia water. When the dissolved oxygen in the tank increased sharply and the pH increased slowly, indicating that the cells had consumed the substrate sugar, 80% glucose (m / v) solution was added and fermented for 72 h. The components of the slant culture medium are: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, beef extract 10 g / L, sucrose 1 g / L, agar powder 20 g / L, and the rest is water.

[0072] The components of the seed culture medium are: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, and the rest is water, pH 6.8-7.2.

[0073] The fermentation medium composition is: glucose 20 g / L, Na2 HPO 4 ·12 H 2 O 17.12 g / L, KH 2 PO 4 3 g / L, NH 4 Cl 1 g / L, NaCl 0.5 g / L, MgSO 4 7H 2 O 0.492 g / L, CaCl 2 6H 2 O 0.219 g / L, xylose 10 g / L, phenol red indicator 2%, defoamer 1-2 drops, the rest is water, pH 6.8-7.2.

[0074] The fermentation results showed that the strain was cultured in a 2 L fermenter using M9 fermentation medium for 72 h, and the PQQ yield reached 856 mg / L, which has high industrial value.

Claims

1. A method for producing PQQ, characterized in that: Integration into the E. coli genome pq Genes and qqb Simultaneous pairing of genes pqqA, pqqB , QUR Gene overexpression; Overexpression of the gene encoding the metalloproteinase subunit TldD tD ; Knockout of the IscR gene encoding the DNA binding and transcriptional dual regulator iqR ; Enhance outer membrane protein gene ompA ; Overexpression of the gene encoding quinone protein glucose dehydrogenase gcd ; Integration of S-adenosylmethionine synthetase encoding gene metK ; The efficient synthesis of PQQ is achieved through the above method.

2. A method for producing PQQ according to claim 1, characterized in that: The gene gcd Overexpression of 3 copies.

3. A genetically engineered bacterium for producing PQQ, characterized in that: Integration into the E. coli genome pq Genes and qqb Genes with one more copy pqqA, pqqB and QUR ; Overexpression of the gene encoding the metalloproteinase subunit TldD tD ; Knockout of the IscR gene encoding the DNA binding and transcriptional dual regulator iqR ; Enhance outer membrane protein gene ompA ; 3 copies of the gene encoding quinone protein glucose dehydrogenase overexpressed gcd ; Integration of S-adenosylmethionine synthetase encoding gene metK Obtained.

4. A genetically engineered bacterium for producing PQQ according to claim 3, characterized in that: The host is Escherichia coli K-12 MG1655.

5. A genetically engineered bacterium for producing PQQ according to claim 3, characterized in that: By P trc or P T7 Promoters control gene expression.

6. A genetically engineered bacterium for producing PQQ according to claim 3, characterized in that: The gene pq , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 1; The gene qqb , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 2; The gene ikB , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 3; The gene PcqI , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 4; The gene qqh , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 5; The gene pq , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 6; The gene encoding the metalloproteinase subunit TldD tD , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 7; The IscR gene encoding the DNA binding transcription dual regulatory factor iqR , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 8; The gene encoding outer membrane protein A ompA , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 9; The gene encoding quinone protein glucose dehydrogenase gcd , the nucleotide sequence is shown in the sequence listing SEQ ID NO. 10; The gene encoding S-adenosylmethionine synthetase metK The nucleotide sequence is shown in the sequence listing SEQ ID NO.

11.

7. Use of the genetically engineered bacteria according to any one of claims 3 to 6 in producing PQQ.

Images