Method for improving storage stability of low-concentration DNA (Deoxyribose Nucleic Acid) by utilizing stabilizer

Abstract

The invention discloses a method for improving storage stability of low-concentration DNA by using a stabilizer, the stabilizer is RNA having no homology with a detection target, the RNA is prepared by designing a DNA sequence having no homology with the detection target and through in vitro transcription, the method can be widely applied to storage of DNA samples related to pathogen detection, pollution of the DNA sequence can be avoided, and the stability of the low-concentration DNA is improved. The method does not interfere with the sequencing result, so that the sample is still stably detected after being frozen and thawed, thereby reducing the storage / preparation cost of the sample and improving the utilization rate of the sample.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for improving the storage stability of low-concentration DNA by utilizing a stabilizer. Background Art

[0002] Nucleic acid testing is a technical means widely used in the fields of medicine, biology, environment and food. However, the amount of nucleic acid available for some special samples is usually low. In addition, nucleic acid standards are needed for quantitative detection of target nucleic acids or quality control of the detection process. The stability of nucleic acid standards is crucial to the reliability and accuracy of the test results. Therefore, maintaining the stability of nucleic acids (especially low-concentration nucleic acids) during short-term and long-term storage is an urgent problem to be solved in the field of nucleic acid testing. Compared with DNA, RNA molecules are more unstable due to factors such as low base pair content, susceptibility to nuclease degradation, and susceptibility to oxidation and dehydration of sugar groups. Therefore, RNase inhibitors, chelating agents, reducing agents, pH buffers, etc. are usually added to RNA solutions to improve the storage stability of RNA. Factors affecting the storage stability of DNA mainly include temperature, tube wall adsorption, DNA length, buffer composition, etc. For low-concentration, short-fragment DNA, tube wall adsorption will not only lead to a decrease in DNA concentration, but also cause DNA denaturation. A type of standard commonly used in nucleic acid testing is artificially synthesized DNA fragments with low concentrations. Alkaline environment (such as TE buffer) and low temperature (such as -20℃ or -80℃) can improve DNA storage stability to a certain extent.

[0003] Research by Steve Smith et al. showed that adding trehalose to low-concentration DNA samples and storing them at -80°C can improve the storage stability of DNA, but DNA degradation was still detected after 12 months of storage, and the study did not test whether freezing and thawing during storage would further accelerate DNA degradation, so this method is not suitable for the storage of DNA standards with strict requirements on stability; in addition, to prevent adsorption to the tube wall, it is usually necessary to add carrier DNA / RNA to the storage solution, however, adding carrier DNA to the DNA storage solution may interfere with downstream detection, and for detection using high-throughput sequencing, adding carrier DNA will also cause waste of sequencing data. Research by Anna Baoutina et al. found that adding yeast RNA dissolved in TE buffer to DNA standards can improve the storage stability of DNA standards. The disadvantage of this method is that yeast DNA may be contaminated in yeast RNA, so for detection targeting microorganisms, this DNA storage method will introduce background in the detection results; in addition, the study did not test whether freezing and thawing during storage will cause DNA degradation.

[0004] In view of this, the present invention provides a method for improving the storage stability of low-concentration DNA using a stabilizer, which can be applied to different detection needs, reduces sample storage / preparation costs, improves sample utilization, and provides new ideas and methods for the field of nucleic acid detection. Summary of the invention

[0005] In order to make up for the deficiencies of the prior art, the object of the present invention is to provide a method for improving the storage stability of low-concentration DNA using a stabilizer.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a stabilizer for improving the storage stability of DNA, wherein the stabilizer comprises RNA having no homology with a detection target.

[0008] Furthermore, the method for preparing the RNA having no homology to the detection target is as follows: using the Alu sequence as input, designing a DNA sequence having no homology to the detection target, using the sgRNA backbone sequence in the CRISPR system as a fixed sequence, replacing the variable sequence in the sgRNA with the DNA sequence having no homology to the detection target, and amplifying and preparing an in vitro transcription template with primers containing a T7 promoter sequence, wherein the in vitro transcription template is used to transcribe RNA having no homology to the detection target.

[0009] Alu sequences are widely distributed repetitive elements in mammalian genomes, with about 500,000 copies in the human genome. This DNA sequence contains the recognition sequence AGCT for the restriction endonuclease AluI, so it is called an Alu repeat sequence. The typical human genome Alu sequence is 282bp long and consists of two homologous but different subunits. The subunits are derived from the 7SLRNA gene with deletion mutations and point mutations. The two subunits are connected by a dense sequence of adenine nucleotides. There is an irrelevant 31bp insertion fragment in the right subunit, called IH. There is a positive repeat sequence at each end of the Alu sequence and a poly (A) tail at the end. Studies have found that the Alu sequence plays an intermediary role between enhancer and promoter RNA, forming an RNA double strand through base pairing, and determining the enhancer-promoter pairing selection specificity.

[0010] As used herein, the term "sgRNA" generally refers to an RNA sequence or molecule (or a set of RNA molecules) that can bind to a Cas protein and help target the Cas protein to a specific position within a target polynucleotide (e.g., DNA or RNA). Guide RNA may include a crRNA segment and a tracrRNA segment. The term "crRNA" or "crRNA segment" refers to an RNA molecule or a portion thereof, which includes a guide sequence, a stem sequence, and optionally a 5' overhang sequence targeting a polynucleotide. The term "tracrRNA" or "tracrRNA segment" is further defined below and refers to an RNA molecule or a portion thereof including a protein binding segment (e.g., a protein binding segment that can interact with a CRISPR-associated protein (e.g., Cas9)). The term "guide RNA" also encompasses a single guide RNA (sgRNA), wherein the crRNA segment and the tracrRNA segment are located in the same RNA molecule. The term "guide RNA" also includes a group of two or more RNA molecules together, wherein the crRNA segment and the tracrRNA segment are located in separate RNA molecules. The complete sgRNA contains the user-defined targeting sequence crRNA sequence (CRISPR-derived RNA) and the universal Cas9 nuclease recruitment sequence tracrRNA (trans-activating RNA), that is, sgRNA = crRNA + tracrRNA. The crRNA sequence is custom designed according to the specific site of the target gene. It is a 20-nucleotide sequence homologous to the target site. Different custom crRNA sequences can be designed to target different target genes.

[0011] In the present invention, the terms "DNA" and "RNA" are intended to include polymeric forms of nucleotides of any length, containing deoxyribonucleotides, ribonucleotides and / or their analogs, including DNA, RNA and DNA / RNA hybrids, which also include DNA or RNA analogs, such as those containing modified backbones (e.g., peptide nucleic acids (PNA) or thiophosphates) or modified bases. Therefore, the DNA and RNA of the present invention include DNA, cDNA, mRNA, recombinant nucleic acids, etc. in prokaryotes, eukaryotes, viruses, viroids, and nucleic acid molecule libraries.

[0012] In the present invention, the term "homology", also known as "identity", refers to a nucleotide sequence that is at least 60% identical, at least 65% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or 100% identical to the detection target sequence of the present invention. In order to determine sequence homology, sequence alignment can be performed in various ways known to those skilled in the art, for example, using BLAST, BLAST-2, ALIGN, NEEDLE, Megalign (DNASTAR), Snapgene or DNAMAN software, etc. Those skilled in the art can determine appropriate parameters for alignment, including any algorithm required to achieve optimal alignment in the full-length sequence being compared.

[0013] Furthermore, the concentration of the RNA having no homology to the detection target is 20 ng / μl to 100 ng / μl.

[0014] Furthermore, the concentration of the RNA having no homology to the detection target is 50 ng / μl.

[0015] Furthermore, the length of the DNA sequence having no homology to the detection target is 20 bp.

[0016] Furthermore, the source of the detection target includes one or more of prokaryotes, eukaryotes, viruses, viroids and nucleic acid molecule libraries.

[0017] Furthermore, the detection target concentration is greater than or equal to 0.005 pg / μl.

[0018] Furthermore, the stabilizer also includes a buffer.

[0019] In the present invention, the term "buffer" refers to a buffer system used to maintain a normal and stable pH value of the experimental system, generally referring to a pH regulator that does not interfere with the main system or subsequent operations in the experiment. In some embodiments, the pH buffer is formulated to adjust the pH value of the composition to a preselected range. In some embodiments, the buffer can be a NaAc-HAc buffer, a Tris-HCl buffer, a Tris-EDTA buffer (TE buffer), etc.

[0020] Furthermore, the buffer is TE buffer.

[0021] Furthermore, the stabilizer also includes any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.

[0022] The term "pharmaceutically acceptable" used in the present invention is used herein to refer to compounds, materials, compositions and / or dosage forms that are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions or other problems or complications within the scope of reasonable medical judgment, and that meet a reasonable benefit / risk ratio. Suitable carriers can be large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids and amino acid copolymers. Such carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers or excipients or diluents in the context of the present invention may refer to non-toxic solid, semi-solid or liquid fillers, diluents, encapsulating materials or any type of formulation aids. The pharmaceutically acceptable carrier may also be a binder, a wetting agent, a disintegrant, an emulsifier, a cosolvent, a solubilizing agent, an osmotic pressure regulator, a surfactant, a colorant, a pH regulator, an antioxidant or an antibacterial agent.

[0023] Furthermore, the DNA may or may not be frozen and thawed.

[0024] The second aspect of the present invention provides a method for improving the storage stability of low-concentration DNA, the method comprising: using the stabilizer described in the first aspect of the present invention.

[0025] Furthermore, the source of the low-concentration DNA includes one or more of prokaryotes, eukaryotes, viruses, viroids and nucleic acid molecule libraries.

[0026] Furthermore, the concentration of the low-concentration DNA is greater than or equal to 0.005 pg / μl.

[0027] The third aspect of the present invention provides a product for improving the storage stability of low-concentration DNA, wherein the product comprises the stabilizer according to the first aspect of the present invention.

[0028] Furthermore, the product is selected from the group consisting of probe sets, primer sets, kits, chips, test strips, high-throughput sequencing, systems, equipment, and devices.

[0029] The fourth aspect of the present invention provides the use of the stabilizer described in the first aspect of the present invention, and the use includes any one of the following: 1) use in the preparation of a product for improving the storage stability of low-concentration DNA; 2) use in DNA storage; 3) use in quality control of in vitro nucleic acid detection methods; 4) use in the preparation of nucleic acid detection quality control products.

[0030] Furthermore, the source of the low-concentration DNA includes one or more of prokaryotes, eukaryotes, viruses, viroids and nucleic acid molecule libraries.

[0031] Furthermore, the concentration of the low-concentration DNA is greater than or equal to 0.005 pg / μl.

[0032] Furthermore, the storage temperature of the DNA is 4°C to -80°C.

[0033] Furthermore, the storage time of the DNA storage is 0 to 12 months.

[0034] Furthermore, the storage time of the DNA storage is 0 to 6 months.

[0035] Furthermore, the DNA may or may not be frozen and thawed.

[0036] Furthermore, the product is selected from the group consisting of probe sets, primer sets, kits, chips, test strips, high-throughput sequencing, systems, equipment, and devices.

[0037] Advantages and beneficial effects of the present invention: The method for preparing a stabilizer provided by the present invention can be applied to different detection requirements, and the RNA sequence in the stabilizer can be flexibly designed and synthesized according to the requirements; it can avoid the contamination of DNA sequences and will not interfere with the sequencing results; it can ensure that the sample can still be stably detected after freezing and thawing, thereby reducing the sample storage / preparation cost and improving the sample utilization rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the detection result of high-concentration and low-concentration internal reference prepared with stabilizer after storage for 6 months.

[0039] Figure 2 This is the detection result of high-concentration and low-concentration internal reference prepared with sterile water after storage for 3 weeks.

[0040] Figure 3 This is the detection result of high-concentration and low-concentration internal reference prepared with TE buffer after storage for 3 weeks. DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvement by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0042] The DNA internal reference used in the metagenomic detection process is usually one or several artificially synthesized DNA fragments with a length of 1 to 2 kb. In order to avoid the internal reference sequence occupying the sequencing data volume, the amount of internal reference added in actual use is usually very low (<1ng). In order to facilitate use and ensure the accuracy of the added amount, the concentration of the internal reference is usually low (≤1ng / μl). The main problem with low-concentration internal references is poor storage stability and cannot be stored for a long time. Therefore, the internal reference is usually prepared into a high-concentration storage solution and then diluted when used, which increases the complexity of experimental operations. At the same time, the volatility of the internal reference dilution in different experimental batches will also affect the quantitative accuracy of the internal reference. The reasons for the poor storage stability of low-concentration internal references mainly include two aspects: one is nuclease degradation, and the other is tube wall adsorption. Since nucleases usually require the presence of metal ions (such as Ca2+, Mg2+) to function, dissolving the internal reference in TE buffer can inhibit nuclease degradation. At the same time, the alkaline environment can also inhibit DNA hydrolysis. DNA is easily adsorbed by the tube wall because the centrifuge tubes used in the experiment are mostly made of polypropylene, and the surface charge of polypropylene polymers will cause DNA binding (especially in the presence of high ions). In order to prevent DNA from binding to the tube wall, RNA sequences that are not homologous to the detection target can be added to the internal reference.

[0043] The method for preparing an internal reference storage stabilizer of the present invention comprises three steps: step 1, taking the primate-specific repetitive element Alu sequence contained in the human genome as input, designing a 20 bp DNA sequence with no homology to the detection target (such as the nucleic acid of the detection microorganism), and in order to ensure the efficiency and specificity of PCR amplification, the present invention uses the sgRNA (single guide RNA) backbone sequence in the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system as a fixed sequence, replaces the variable sequence in the sgRNA with the designed 20 bp DNA sequence, and performs PCR amplification with primers containing a T7 promoter sequence to prepare an in vitro transcription template; step 2, preparing RNA by in vitro transcription; step 3, diluting the prepared RNA to 50 ng / μl with TE buffer to obtain a stabilizer. To test the effect of adding stabilizers on the storage stability of internal references, the internal references were diluted with stabilizers to 1 ng / μl (the concentrations of the 10 internal reference sequences were 0.05-500 pg / μl) and 0.1 ng / μl (the concentrations of the 10 internal reference sequences were 0.005-50 pg / μl). As a control, a group of samples diluted with nuclease-free water with a concentration of 1 ng / μl (the concentrations of the 10 internal reference sequences were The internal references are 0.05-500pg / μl) and 0.1ng / μl (where the concentrations of the 10 internal reference sequences are 0.005-50pg / μl, respectively), and a group of internal references diluted with TE buffer with concentrations of 1ng / μl (where the concentrations of the 10 internal reference sequences are 0.05-500pg / μl) and 0.1ng / μl (where the concentrations of the 10 internal reference sequences are 0.005-50pg / μl, respectively). Considering that the internal reference is used in actual applications to perform relevant quantitative analysis by analyzing the RPM (reads per million) detected by sequencing of the internal reference, therefore, as long as a certain amount of internal reference is added to a certain amount of test nucleic acid, the RPM detected by sequencing is always maintained at the same level, indicating that the internal reference has good stability and will not affect the quantitative accuracy. Therefore, the present invention immediately determines the detection RPM of the three sets of internal references prepared by high-throughput sequencing, and stores the prepared internal references at 4°C and -20°C, respectively. Thereafter, the RPM of the internal references in the same tube is detected by high-throughput sequencing at regular intervals to determine the stability of the internal references during storage.

[0044] The present invention is further described in detail below in conjunction with the accompanying drawings and examples. The experimental methods in the following examples are conventional methods unless otherwise specified, and the materials and reagents used in the following examples are commercially available unless otherwise specified. The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Simple improvements to the present invention made according to the essence of the present invention all belong to the scope of protection claimed in the present invention.

[0045] Example 1 Preparation of stabilizer

[0046] 1. Experimental materials:

[0047] PCR template:

[0048] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 1).

[0049] Forward primer: AAAAGCACCGACTCGGTGCC (SEQ ID NO: 2).

[0050] Reverse Primer:

[0051] TTCTAATACGACTCACTATAGTCCCAAAGTGCTGGGATTACGTTTTAGAGCTAGA (SEQ ID NO: 3).

[0052] NEBNext High-Fidelity 2X PCR Master Mix, NEB.

[0053] HiScribe TM T7 Quick High Yield RNA Synthesis Kit, NEB.

[0054] RNA Clean & Concentrator-5, ZYMO RESEARCH.

[0055] Nuclease-free water, Thermo Fisher Scientific.

[0056] AMPure XP Beads, Beckman.

[0057] TE buffer (10 mM Tris, 0.1 mM EDTA, pH 8.0), Sangon Biotechnology.

[0058] 2. Experimental Methods

[0059] 1. Prepare in vitro transcription template. The reaction system and reaction conditions are shown in Table 1.

[0060] Table 1. Reaction system and conditions for preparing templates

[0061]

[0062] 2. Purify the PCR product using 2×XP magnetic beads.

[0063] 3. Perform in vitro transcription. The reaction system and reaction conditions are shown in Table 2.

[0064] Table 2. In vitro transcription reaction system and conditions

[0065]

[0066] 4. After the reaction is completed, add 20 μl of nuclease-free water and 2 μl of DNase I to the reaction system, mix well and incubate at 37°C for 15 minutes.

[0067] 5. Purify the reaction product of step 4 using RNA Clean&Concentrator-5.

[0068] 6. Dilute the RNA obtained in step 5 to 50 ng / μl with TE buffer to obtain the internal reference stabilizer.

[0069] 3. Experimental Results

[0070] In this example, 1 μg of DNA template was transcribed in vitro to obtain about 12 μg of RNA, which was diluted to 50 ng / μl with TE to obtain 240 μl of internal reference stabilizer.

[0071] Example 2 Stabilizers for low-concentration DNA storage stability test

[0072] 1. Experimental materials:

[0073] Human genomic DNA, Promega.

[0074] Library construction kit, NoviZan.

[0075] The internal control stabilizer prepared in Example 1.

[0076] Nuclease-free water, Thermo Fisher Scientific.

[0077] AMPure XP Beads, Beckman.

[0078] TE buffer (10 mM Tris, 0.1 mM EDTA, pH 8.0), Sangon Biotechnology.

[0079] 2. Experimental Methods

[0080] 1. The internal reference containing 10 sequences (length ~1kb) was diluted to two concentrations of 1.1111 ng / μl (high concentration internal reference) and 0.11111 ng / μl (low concentration internal reference) with stabilizer, TE buffer and nuclease-free water, respectively. The concentrations of the 10 sequences are shown in Table 3.

[0081] Table 3. Sequence concentration table

[0082]

[0083] 2. Dilute human genomic DNA to 0.1 ng / μl.

[0084] 3. Take 2 μl of human genomic DNA with a concentration of 0.1 ng / μl, add 1 μl of high-concentration internal reference prepared with stabilizer, obtain sample A and directly proceed with library construction and sequencing, with 3 technical replicates.

[0085] 4. Take 2 μl of human genomic DNA with a concentration of 0.1 ng / μl, add 1 μl of high-concentration internal reference prepared with TE buffer, obtain sample B, and directly construct the library and sequence it, with 3 technical replicates.

[0086] 5. Take 2 μl of human genomic DNA with a concentration of 0.1 ng / μl, add 1 μl of high-concentration internal reference prepared with nuclease-free water, obtain sample C and directly proceed with library construction and sequencing, with 3 technical replicates.

[0087] 6. Take 2 μl of human genomic DNA with a concentration of 0.1 ng / μl, add 1 μl of low-concentration internal reference prepared with stabilizer, obtain sample D and directly proceed with library construction and sequencing, with 3 technical replicates.

[0088] 7. Take 2 μl of human genomic DNA with a concentration of 0.1 ng / μl, add 1 μl of low-concentration internal reference prepared with TE buffer, obtain sample E and directly proceed with library construction and sequencing, with 3 technical replicates.

[0089] 8. Take 2 μl of human genomic DNA with a concentration of 0.1 ng / μl, add 1 μl of low-concentration internal reference prepared with nuclease-free water, obtain sample F and directly proceed with library construction and sequencing, with 3 technical replicates.

[0090] 9. Analyze the RPM detected by sequencing 10 internal reference sequences.

[0091] 10. Store the remaining prepared internal reference at 4°C and -20°C respectively.

[0092] 11. At regular intervals, perform library construction, sequencing, and data analysis on the same tube of internal reference according to steps 4 to 10.

[0093] 3. Experimental Results

[0094] 1. The 10 sequences of the high-concentration internal reference prepared with stabilizer were stored at -20℃ for 6 months and after 6 freeze-thaw cycles, and they were still able to be stably detected, indicating that the internal reference had not been degraded; the 10 sequences of the low-concentration internal reference prepared with stabilizer were stored at -20℃ for 6 months and after 6 freeze-thaw cycles, and they were still able to be stably detected, indicating that the internal reference had not been degraded; the 10 sequences of the low-concentration internal reference prepared with stabilizer were stored at 4℃ for 6 months, and they were still able to be stably detected, indicating that the internal reference had not been degraded. The results are as follows: Figure 1 shown.

[0095] 2. The RPM of 10 sequences in the high-concentration internal reference prepared with sterile water was significantly reduced after being stored at -20℃ for 3 weeks and undergoing 3 freeze-thaw cycles, indicating that the internal reference has been degraded to a large extent; the RPM of 10 sequences in the low-concentration internal reference prepared with sterile water was significantly reduced after being stored at -20℃ for 3 weeks and undergoing 3 freeze-thaw cycles, indicating that the internal reference has been degraded to a large extent; the RPM of 10 sequences in the low-concentration internal reference prepared with sterile water was significantly reduced after being stored at 4℃ for 3 weeks, indicating that the internal reference has been degraded to a large extent. The results are as follows: Figure 2 shown.

[0096] 3. The RPM of 10 sequences in the high-concentration internal reference prepared with TE buffer was significantly reduced after being stored at -20℃ for 3 weeks and undergoing 3 freeze-thaw cycles, indicating that the internal reference has been degraded to a large extent; the RPM of 10 sequences in the low-concentration internal reference prepared with TE buffer was significantly reduced after being stored at -20℃ for 3 weeks and undergoing 3 freeze-thaw cycles, indicating that the internal reference has been degraded to a large extent; the RPM of 10 sequences in the low-concentration internal reference prepared with TE buffer was significantly reduced after being stored at 4℃ for 3 weeks, indicating that the internal reference has been degraded to a large extent. The results are as follows Figure 3 shown.

[0097] The present invention designs a DNA sequence that is not homologous to the detection target, and uses this DNA as a template for in vitro transcription to synthesize an RNA sequence that is not homologous to the detection target, and then adds the synthesized RNA as a stabilizer to the low-concentration DNA and stores it at 4°C or -20°C. The DNA stored by this method will not cause degradation or tube wall adsorption within a certain period of time even if it is repeatedly frozen and thawed during storage, thereby simplifying the sample storage process and reducing storage costs, while improving sample utilization; in addition, the stabilizer prepared by this method will not interfere with the test results, so it can be widely used in technical fields with different detection requirements.

[0098] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A stabilizer for improving the storage stability of DNA, characterized in that: The stabilizer includes RNA having no homology to the detection target.

2. The stabilizer according to claim 1, characterized in that The method for preparing the RNA having no homology to the detection target is as follows: using the Alu sequence as input, designing a DNA sequence having no homology to the detection target, using the sgRNA backbone sequence in the CRISPR system as a fixed sequence, replacing the variable sequence in the sgRNA with the DNA sequence having no homology to the detection target, amplifying and preparing an in vitro transcription template with a primer containing a T7 promoter sequence, and transcribing the RNA having no homology to the detection target with the in vitro transcription template; Preferably, the concentration of the RNA having no homology to the detection target is 20 ng / μl to 100 ng / μl; Preferably, the concentration of the RNA having no homology to the detection target is 50 ng / μl.

3. The stabilizer according to claim 2, characterized in that The length of the DNA sequence having no homology to the detection target is 20 bp.

4. The stabilizer according to claim 1, characterized in that The source of the detection target includes one or more of prokaryotes, eukaryotes, viruses, viroids and nucleic acid molecule libraries; Preferably, the concentration of the detection target is greater than or equal to 0.005 pg / μl.

5. The stabilizer according to claim 1, characterized in that The stabilizer also includes a buffer; Preferably, the buffer is TE buffer; Preferably, the stabilizer further comprises any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent; Preferably, the DNA may or may not be subjected to freeze-thaw cycles.

6. A method for improving the storage stability of low-concentration DNA, characterized in that: The method comprises the steps of: using the stabilizer according to any one of claims 1 to 5.

7. The method according to claim 6, characterized in that The source of the low-concentration DNA includes one or more of prokaryotes, eukaryotes, viruses, viroids, and nucleic acid molecule libraries; Preferably, the concentration of the low-concentration DNA is greater than or equal to 0.005 pg / μl.

8. A product for improving the storage stability of low-concentration DNA, characterized in that: The product comprises the stabilizer according to any one of claims 1 to 5; Preferably, the product is selected from the group consisting of a probe set, a primer set, a kit, a chip, a test paper, a high-throughput sequencing, a system, a device, and an apparatus.

9. Use of the stabilizer according to any one of claims 1 to 5, characterized in that: The application includes any of the following: 1) Application in the preparation of products for improving the storage stability of low-concentration DNA; 2) Application in DNA storage; 3) Application in quality control of in vitro nucleic acid detection methods; 4) Application in the preparation of nucleic acid testing quality control products.

10. The use according to claim 9, characterized in that: The source of the low-concentration DNA includes one or more of prokaryotes, eukaryotes, viruses, viroids, and nucleic acid molecule libraries; Preferably, the concentration of the low-concentration DNA is greater than or equal to 0.005 pg / μl; Preferably, the storage temperature of the DNA storage is 4°C to -80°C; Preferably, the storage time of the DNA storage is 0 to 12 months; Preferably, the storage time of the DNA storage is 0 to 6 months; Preferably, the DNA may or may not be frozen and thawed; Preferably, the product is selected from the group consisting of a probe set, a primer set, a kit, a chip, a test paper, a high-throughput sequencing, a system, a device, and an apparatus.

Images