Method for detecting detection substance in sample based on nanopore

Abstract

The invention relates to the field of nanopores, in particular to a method for detecting a detection object in a sample based on nanopores. The method comprises the following steps: S101, mixing a sample with a detection system to form first annular nucleic acid with a gap; s102, adding ligase into the first annular nucleic acid with the gap, and incubating to obtain a first annular nucleic acid without a gap; s103, performing nanopore sequencing on the first circular nucleic acid product and the internal reference nucleic acid product; and S104, reading and comparing the first circular nucleic acid product and an internal reference nucleic acid product, and determining the existence and / or content of the detection substance in the sample based on a predetermined concentration-dependent curve of the detection substance. By utilizing a nanopore sequencing technology and introducing the designed circular nucleic acid, quantitative detection of miRNA and protein is realized, and the kit is suitable for clinical diagnosis.

Description

[0001] This application claims priority to Chinese invention patent application CN202311117704.2 “A method for detecting small molecule compounds based on nanopores” filed on August 31, 2023, which is incorporated by reference in its entirety. Technical Field

[0002] The present invention relates to the field of nanopores, and in particular to a method for detecting a detection object in a sample based on a nanopore. Background Art

[0003] Nanopore sequencing technology is based on nanoscale protein pores (referred to as nanopores) as biosensors, and is embedded in insulating polymer membranes. By applying a constant voltage at both ends of the polymer membrane to generate current, negatively charged single-stranded DNA or RNA molecules will be driven from the negatively charged side of the molecular membrane to the positively charged side. The migration rate of the nucleic acid chain in the nanopore is controlled by the motor protein. When the nucleic acid chain passes through the pore, the different current changes caused by different base groups are read by the signal receiver in the nanopore, and then the corresponding base recognition work is performed according to the calculation algorithm.

[0004] The existing technologies for detecting small molecules and other test objects using nanopores mainly rely on blocking time and blocking rate to analyze the test objects. Although these methods can meet the detection requirements under specific experimental conditions, they do not have "unique identifiability" and are easily interfered by the same signal. Even if AI algorithms are applied, it is difficult to truly realize the application of nanopores in complex samples by relying solely on these two variables. The document "Nanopore sequencing of DNA-barcoded probes for highly multiplexed detection of microRNA, proteins and small biomarkers" discloses a method for detecting microRNA, proteins and small molecules using nanopore sequencing technology, which designs a probe including an aptamer, a barcode and a target binding region, and analyzes the presence or absence of microRNA, protein or small molecules by analyzing the delayed events caused by the through-hole of the probe combined with microRNA, protein or small molecule. Although this method can realize the simultaneous detection of multiple miRNAs, it requires the aptamer to pass directly, resulting in a low sensitivity of the method, and it is easy to cause the blockage of the nanopore during the experiment, making it difficult to commercialize. Therefore, the existing technology is difficult to be truly applied in the commercial or medical fields. Summary of the invention

[0005] A method for analyzing the presence and / or content of a test substance in a sample based on nanopore sequencing technology, characterized in that the method comprises:

[0006] S101: mixing the sample with the detection system to form a first circular nucleic acid with a gap, wherein the detection system includes a long-chain nucleic acid probe; the detection object includes RNA or protein; when the detection object is RNA, the RNA and the long-chain nucleic acid probe form the first circular nucleic acid with a gap; when the detection object is a protein, the detection system also includes a double-stranded structure, wherein the double-stranded structure includes a first strand that specifically binds to the protein and a second strand that is complementary to the first strand, after the first strand binds to the protein, the second strand is released and forms the first circular nucleic acid with a gap with the long-chain nucleic acid probe; the RNA or the second strand is a short-chain nucleic acid;

[0007] S102 adding a ligase to the first circular nucleic acid with a gap and incubating the nucleic acid to obtain a first circular nucleic acid without a gap;

[0008] S103 performing nanopore sequencing on the first circular nucleic acid product and the internal reference nucleic acid product, wherein the first circular nucleic acid product is a PCR amplification product of a first long-chain nucleic acid obtained by rolling circle amplification of the first circular nucleic acid without a gap, and the internal reference nucleic acid is a linear nucleic acid or a circular nucleic acid;

[0009] S104: reading and comparing the first circular nucleic acid product and the internal reference nucleic acid product, and determining the presence and / or content of the detection object in the sample based on a predetermined concentration dependence curve of the detection object;

[0010] Wherein, the long-chain nucleic acid probe includes an X' region, a P' region, a first structural region N1, an identification region B, a second structural region N2, an F' region, and a Y' region; the X' region and the Y' region are complementary to the short-chain nucleic acid; the P' region and the F' region are respectively combined with the upstream primer and the downstream primer of the PCR amplification reaction; the first structural region N1 and the second structural region N2 are used to maintain the circular structure of the long-chain nucleic acid probe; the identification region B is specific to the first circular nucleic acid.

[0011] In some embodiments, the RNA is miRNA.

[0012] In some embodiments, the protein comprises CD117.

[0013] In some embodiments, the sample comprises one or more of serum, pleural effusion, peritoneal effusion, urine, cerebrospinal fluid, puncture fluid, bronchoalveolar lavage fluid, puncture fluid, pericardial fluid and bile.

[0014] In some embodiments, the sample is not pre-processed.

[0015] In some embodiments, the sample is a mixed sample.

[0016] In some embodiments, the concentration of the internal reference nucleic acid comprises 100-1000 pmol.

[0017] In some embodiments, the concentration of the internal reference nucleic acid comprises 1 nmol.

[0018] In some embodiments, the short-chain nucleic acid is a linear nucleic acid, and the long-chain nucleic acid is a circular nucleic acid.

[0019] In some embodiments, the first circular nucleic acid and the internal reference nucleic acid are padlock probe circularized.

[0020] In some embodiments, the ligase comprises splintR ligase or T4 ligase.

[0021] Compared with the prior art, the beneficial effects of the present invention include at least the following aspects:

[0022] Existing technologies for detecting biomarkers and other test objects using nanopores mainly rely on blocking time and blocking rate to analyze the test objects. Although these methods can meet the detection needs under specific experimental conditions (for example, they can only detect specific test objects), they do not have "unique identifiability" and are easily interfered by the same signal. Nanopore sequencing technology can be used for base sequence analysis of nucleic acids and is currently widely used in gene sequencing. However, there are few reports on the use of nanopore sequencing to detect biomarkers, and it is difficult to achieve quantitative analysis of the test objects, so it is only used for qualitative analysis.

[0023] Compared with conventional nanopore sensing technology, the present invention utilizes mature commercial nanopore sequencing technology (such as Oxford Nanopore Technology) and introduces designed circular nucleic acids (especially internal reference nucleic acids) to achieve quantitative detection of miRNA and protein, breaking through the limitation that it is difficult to achieve accurate quantification of miRNA and protein based on existing nanopore sequencing technology, and is more suitable for clinical diagnosis. The present invention can quickly detect miRNA and protein and can achieve rapid detection of mixed samples of multiple miRNA and proteins, with high specificity and low detection limit, and is applicable to various complex biological samples, without the need for pretreatment of biological samples, and has a wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings required for use in the embodiments or the prior art descriptions are briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, each element or part is not necessarily drawn according to the actual scale. Obviously, the drawings described below are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can also be obtained based on these drawings without paying creative labor.

[0025] Figure 1 A schematic diagram of a method for detecting small molecule compounds in a biological sample provided by the present invention;

[0026] Figure 2 This shows that the method provided by the present invention has high consistency;

[0027] Figure 3 The feasibility of the aTFs sensor involved in the method provided by the present invention is shown;

[0028] Figure 4 It shows that the method provided by the present invention has high specificity and sensitivity;

[0029] Figure 5A It shows that the method provided by the present invention has the ability to be applied to the simultaneous mixed detection of multiple samples;

[0030] Figure 5B The result diagram of the simultaneous detection of UA, D-2HG and L-2HG by the method provided by the present invention is shown;

[0031] Fig. 6A It shows that the method provided by the present invention can be applied to detect a variety of complex clinical samples;

[0032] Figure 6B The diagram shows the test results of the method provided by the present invention for samples of IDH wild type, IDH gene mutation and IDH mutation patients after treatment;

[0033] Figure 7 It shows that the blind test results of the method provided by the present invention have high accuracy;

[0034] Figure 8 A schematic diagram of the structure of the first circular nucleic acid in the present invention is shown;

[0035] Fig. 9 It was shown that microcrystalline cellulose can be used as a carrier to immobilize aTF protein;

[0036] Fig. 10A A result diagram showing that when no internal reference nucleic acid is added, the number of reads of the first circular nucleic acid has no dependency on the concentration of the first circular nucleic acid;

[0037] Fig. 10B A result diagram showing that after adding the internal reference nucleic acid, the number of reads of the first circular nucleic acid is dependent on the concentration of the first circular nucleic acid;

[0038] Fig. 10C A schematic diagram showing a concentration dependence curve of a first circular nucleic acid;

[0039] Fig.11A A schematic diagram showing the formation of the circular nucleic acid of Example 8;

[0040] Fig. 11B A schematic diagram of detecting RNA is shown;

[0041] Fig. 11C The detection results of miRNA155, miR10a-5p, miRNA93-5p, miRNA129-5p, and miRNA181b-5p are shown;

[0042] Fig.11D The results of the detection of miR10a-5p at different concentrations are shown;

[0043] Fig.11E The result graph shows that the detection limit of miR10a-5p is less than or equal to 100 fM;

[0044] Fig. 12A A schematic diagram of the detection protein is shown;

[0045] Fig. 12B The figure shows the detection result of CD117;

[0046] Fig.13 The heat map and concentration dependence curve of the detection of the seven designed first circular nucleic acids are shown. DETAILED DESCRIPTION

[0047] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0048] Herein "and / or" includes any and all combinations of one or more of the associated listed items.

[0049] Herein, "plurality" means two or more than two, ie, it includes two, three, four, five, etc.

[0050] It should be noted that, in this article, the terms "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0051] As used in this specification, the term "about" typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically + / - 2% of the stated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.

[0052] In this specification, some embodiments may be disclosed in a format of being in a range. It should be understood that this description of "being in a range" is only for convenience and brevity, and should not be interpreted as a rigid limitation on the disclosed range. Therefore, the description of the range should be considered to have specifically disclosed all possible sub-ranges and independent numerical values ​​within this range. For example, the description of the range 1-6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within this range, such as 1, 2, 3, 4, 5 and 6. Regardless of the breadth of the range, the above rules apply.

[0053] Example 1: Detection of small molecule compounds based on nanopore sequencing technology

[0054] Materials and Methods

[0055] 1.1 aTFs protein extraction

[0056] 1.1.1 LB medium preparation

[0057] Weigh 10g of tryptone, 5g of yeast extract, and 10g of NaCl, and dilute to 1L conical flask with Milli-Q water. Prepare 3 bottles of 1L LB medium and sterilize them in an autoclave at 121°C for 20min. After sterilization, take out the LB medium and let it cool for later use. Dispense one bottle of LB medium into 50mL centrifuge tubes, 35mL per tube, and store in a 4°C refrigerator.

[0058] 1.1.2 Plasmid transformation

[0059] Heat shock transformation of plasmid into competent E. coli BL21. Heat shock transformation: Place competent cells (80 μL) on ice, add about 200 μg of plasmid after dissolving, ice bath for 30 minutes, heat shock at 42°C for 1 minute and 30 seconds, ice bath for another 5 minutes, add 200 μL LB medium, culture at 37°C, 220 rpm for half an hour, draw 200 μL, apply to ampicillin-resistant plate, and culture at 37°C overnight.

[0060] 1.1.3 Bacterial culture

[0061] After a single clone grows on the plate, pick out the single clone and culture it overnight in a vial of culture medium with the corresponding antibiotics. Transfer the vials evenly to 1L culture medium and culture at 37°C for about 4-5 hours (fingers cannot be seen through the culture bottle), cool down to 16°C, add inducer with a final concentration of 0.4mM, and induce expression for about 14 hours.

[0062] 1.1.4 Bacteria collection

[0063] After induction, collect the bacteria at 3500 rpm for 15 minutes. Pour off the supernatant and resuspend the collected bacteria in buffer.

[0064] 1.1.5 Break the bacterial solution and collect the supernatant

[0065] You can choose ultrasonic or high-pressure crushing. The power of ultrasonic crushing is generally set to 180W, the time is set to 20 minutes, and the alarm temperature is set to 30℃. After crushing, centrifuge at 15000rpm and 4℃ for 40 minutes (special white centrifuge tube). Collect the supernatant and precipitate and put them on ice for later use.

[0066] 1.1.6 Hanging Ni column

[0067] The collected supernatant was mixed with nickel gel and incubated for 1 hour.

[0068] 1.1.7 Elution of protein (30 mM imidazole is sufficient to elute protein, use it next time)

[0069] After incubation, elute the protein on the gravity column, first hang out the supernatant, at this time the protein is bound to the nickel gel. First use 10mM low imidazole solution to wash the impurities, and then use 30mM high imidazole solution to elute the target protein. For each column volume washed, take 5μL of the washing solution and react with 75μL of the protein quantitative reagent. If the protein quantitative reagent changes from colorless to blue, it means that there are impurities. If it does not change color, it means that there are basically no impurities. The washing process requires about 15-20 column volumes to wash, and washing the target protein generally requires seven or eight column volumes. During the washing process, sample the washing solution and collect it in the EP tube for later use.

[0070] 1.1.8 Pass through molecular sieve to collect protein

[0071] Measure the concentration of the eluted target protein, then concentrate it to the corresponding volume and pass it through a molecular sieve. Collect the protein, concentrate it to the required concentration and store it. One injection is 1mL (the protein cannot exceed 20mg, and the protein concentration needs to be measured), use a 1mL sample loop, and use a 24mL chromatography column.

[0072] Set the program to a flow rate of 0.35 / min, a column head pressure of 2 MPa, and use automatic peak collection in 0.5 mL tubes.

[0073] 1.2 Preparation of nucleic acid samples

[0074] 1.2.1 Annealing of R1 (long-chain nucleic acid of the first circular nucleic acid) and D1 (short-chain nucleic acid of the first circular nucleic acid) (taking DhdR as an example)

[0075] PCR program: 95℃1min→75℃15min→55℃15min→37℃15min→4℃∞

[0076] Get 50 μL 8 μM R1-D1

[0077] 1.2.2 Ligation of R1-D1 by T4 ligase

[0078] PCR program: 37℃30min→65℃10min→4℃∞

[0079] Obtain 60 μL of 4 μM T4 product

[0080] Among them, the sequence information of D1 is (SEQ ID NO: 1, in the short-chain nucleic acid of the first circular nucleic acid (or the second circular nucleic acid, i.e., the internal reference nucleic acid), the underlined Indicates the P region of a short-chain nucleic acid, italic and underlined X region represents short-chain nucleic acid, italic wavy line The Y region represents a short-chain nucleic acid, with a wavy line The sequence information of R1 is (SEQ ID NO: 2, in the long-chain nucleic acid of the first circular nucleic acid (or the second circular nucleic acid), P represents a phosphate group, and the italic underlined The X' region represents a long nucleic acid chain, underlined Indicates the P' region of the long-chain nucleic acid, black indicates the structural region of the long-chain nucleic acid (from 5' to 3', respectively, the first structural region N1 (i.e., CATACCTAGAGTAAGT) and the second structural region N2 (i.e., TGCAGACATTAGTGATCATATTA)), double underline Indicates the long-chain nucleic acid identification area B, wavy line Indicates the F' region of a long nucleic acid, with an italic wavy line Represents the Y' region of a long nucleic acid.

[0081] The sequence information involved in this embodiment is summarized in Table 1 below:

[0082] Table 1

[0083] 1.2.3 Treatment of T4 products with exonuclease I and exonuclease III

[0084] PCR program: 37℃30min→80℃15min→4℃∞

[0085] Obtain 70 μL of 4 μM T4 exonuclease product

[0086] 1.2.4 Re-annealing of T4 exosomes with D1

[0087] PCR program: 95℃1min→75℃15min→55℃15min→37℃15min→4℃∞

[0088] Get 80 μL of 2 μM circular nucleic acid

[0089] 1.3 Small molecule detection

[0090] 1. Pipette 400μL of bio-magnetic beads and wash twice with 500μL MQ water;

[0091] 2. Equilibrate twice with 500 μL Tris-HCl;

[0092] 3. Add 80 μL 30 μM aTFs and 920 μL Tris-HCl and incubate for 30 min.

[0093] 4. Aspirate the supernatant and wash three times with 1 mL Tris-HCl;

[0094] 5. Add 40 μL of circular nucleic acid and 960 μL of Tris-HCl and incubate for 30 min;

[0095] 6. Aspirate the supernatant and wash three times with 1 mL Tris-HCl;

[0096] 7. Add 360 μL Tris-HCl, mix thoroughly with the magnetic beads, add 50 μL of the mixture to each tube numbered 1-8, and aspirate excess Tris-HCl on the magnetic stand;

[0097] 8. Add 50 μL of the test substance to each of 8 1.5 mL centrifuge tubes;

[0098] 9. Incubate for 30 minutes;

[0099] 10. Prepare mixed nucleic acid samples No. 1-8 Note: Nucleic acid mixed samples No. 1-8 refer to 8 independent repeated experiments.

[0100] Get 50 μL of nucleic acid mixed sample No. 1-8

[0101] 11. RCA reaction

[0102] The program is: 30℃30min—65℃10min—4℃∞

[0103] Get 50 μL RCA reaction samples No. 1-8

[0104] 12. PCR reaction

[0105] The sequence of Primer F includes GGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO: 3), and the sequence of Primer R includes GCTCGGAGATTAGTTGCATAACC (SEQ ID NO: 17).

[0106] The procedure is as follows:

[0107] 1.4 PCR product purification

[0108] 1. Transfer the PCR reaction solution to a clean 1.5 mL centrifuge tube, add 3 times the volume of Buffer B3, and mix thoroughly;

[0109] Note: First add 50μL water to make up to 100μL, then add 300μL Buffer B3

[0110] 2. Transfer all the mixed solution into the adsorption column, centrifuge at 8000×g for 30s, pour out the liquid in the collection tube, and place the adsorption column in the same collection tube;

[0111] Note: Adding the filtrate to the adsorption column again and filtering it again can further improve the DNA recovery rate.

[0112] 3. Add 500 μL Wash Solution to the adsorption column, centrifuge at 9000 × g for 30 seconds, pour off the liquid, and place the adsorption column in the same collection tube;

[0113] 4. Repeat step 3 once;

[0114] 5. Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 9000×g for 1 min to remove the remaining alcohol;

[0115] 6. Add 15-40 μL Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 1-2 minutes, centrifuge at 9000×g for 1 minute, and store the obtained DNA at -20℃.

[0116] Note: If the fragment is greater than 4 kb, incubating at 37℃-60℃ for 2 minutes can significantly increase the yield. The length of the fragment obtained in this experiment is about 1 kb

[0117] 1.5 Sequencing experiments

[0118] 1. DNA end repair

[0119] 2. Connect barcode

[0120] 3. Connect Adapter

[0121] 4. Sequencing

[0122] Embodiment 2

[0123] like Figure 1 As shown, this embodiment provides a method for detecting a test object in a biological sample, comprising the following steps:

[0124] S1: adding aTF protein to the carrier, incubating for 10-30 minutes, and obtaining a first incubation product; in some embodiments, the first incubation product is a carrier loaded with aTF protein.

[0125] In some embodiments, the carrier comprises magnetic beads.

[0126] In some embodiments, the magnetic beads include His-Tag protein purification magnetic beads.

[0127] In some embodiments, the carrier further comprises microcrystalline cellulose or Ni-NTA nickel column.

[0128] S2 adds the first circular nucleic acid to the first incubation product, incubates for 10-30 minutes, and obtains a second incubation product; in some embodiments, the second incubation product is the carrier loaded with the aTF protein bound to the first circular nucleic acid. In S2, the first circular nucleic acid specifically binds to the aTF protein on the carrier.

[0129] In some embodiments, the amount of the first circular nucleic acid added is greater than the amount of the aTF protein added. In some embodiments, the amount of the first circular nucleic acid added is 0.1 nM-20 μM.

[0130] S3 adding the biological sample to the second incubation product, incubating for 10-30 minutes, to obtain a third incubation product;

[0131] In S3, the detection object (such as a small molecule compound, a metal ion) in the biological sample specifically binds to the aTF protein, causing the first circular nucleic acid to fall off from the aTF protein.

[0132] In some embodiments, the biological sample comprises one or more of serum, pleural effusion, peritoneal effusion, urine, cerebrospinal fluid, puncture fluid, bronchoalveolar lavage fluid, puncture fluid, pericardial fluid and bile.

[0133] In some embodiments, the biological sample is derived from a human.

[0134] In some embodiments, the volume of the biological sample comprises 10-100 μL.

[0135] In some embodiments, the volume of the biological sample comprises 50 μL.

[0136] S4 separating and purifying the first circular nucleic acid in the third incubation product to obtain a first purified product;

[0137] S5: adding a certain concentration of the second circular nucleic acid to the first purified product, and performing a rolling circle amplification (RCA) reaction to obtain a first long-chain nucleic acid and a second long-chain nucleic acid;

[0138] The second circular nucleic acid is an internal reference nucleic acid; the first long-chain nucleic acid and the second long-chain nucleic acid are rolling circle amplification products of the first circular nucleic acid and the second circular nucleic acid, respectively.

[0139] S6 performs a PCR amplification reaction using the first long-chain nucleic acid and the second long-chain nucleic acid as templates to obtain a PCR amplification product;

[0140] S7 performs nanopore sequencing on the PCR amplification product after pre-sequencing treatment;

[0141] S8 reads and compares the first long-chain nucleic acid and the second long-chain nucleic acid to analyze the presence and / or content of the small molecule compound in the biological sample.

[0142] In some embodiments, the pre-sequencing treatment includes library preparation and / or library quality inspection of the PCR amplification product. In some embodiments, the library preparation includes purification, end repair, and connection adapters.

[0143] In some embodiments, the detection substance is a small molecule compound or a metal ion.

[0144] In some embodiments, the aTF protein includes one or more of DhdR, LhgR, HucR, LldR, OtrR, HosA, TetR, TtgR, BlcR, BenR, SmtB, SRTF1, CtcS, MphR, MobR, MerR and PbrR. aTF (allosteric transcription factor) protein is a type of regulatory protein widely distributed in bacteria. This type of protein contains a DNA binding domain and a small molecule recognition domain. The binding of small molecules can change the conformation of the DNA binding domain and dissociate (or bind) at a specific DNA binding sequence.

[0145] In some embodiments, the small molecule compound may include one or more of D-2HG (D-dihydroxyglutaric acid), L-2HG (L-dihydroxyglutaric acid), UA (uric acid), Lactate (lactic acid), OTC (Oxytetracycline), 4-Hydroxybenzoic acid (parahydroxybenzoic acid), TC (Tetracyclines), Carbaryl (Civet), Hippuric (hippuric acid), cocaine and Progesterone (progesterone).

[0146] In some embodiments, the metal ions may include one or more of Mercury, Zinc, and Plumbum.

[0147] In some embodiments, the corresponding relationship between the aTF protein and the small molecule compound / metal ion is shown in Table 2 below:

[0148] Table 2

[0149] The method provided in this embodiment uses aTF protein to convert small molecule compounds into nucleic acid signals. In the method provided in this embodiment, aTF protein first binds to a specific nucleic acid sequence (for example, region X and region Y of the short-chain nucleic acid of the first circular nucleic acid); when the small molecule compound is added, the aTF protein binds to the small molecule compound and releases the first circular nucleic acid. The structure of the first circular nucleic acid is as follows Figure 8 As shown, the first circular nucleic acid includes a short-chain nucleic acid and a long-chain nucleic acid. The short-chain nucleic acid includes a P region, an X region, a Y region and an F region from the 5' end to the 3' end, wherein the X region and the Y region are used as a whole to specifically bind to the aTF protein, and the P region and the F region are used to bind to the upstream primer and the downstream primer of the PCR amplification reaction respectively. The long-chain nucleic acid includes a first region complementary to the short-chain nucleic acid, a first structural region N1, an identification region B and a second structural region N2, and the first region includes an X' region complementary to the X region, a P' region complementary to the P region, an F' region complementary to the F region and a Y' region complementary to the Y region. That is, the long-chain nucleic acid includes an X' region, a P' region, a first structural region N1, an identification region B and a second structural region N2, an F' region and a Y' region from the 5' end to the 3' end. Accordingly, the X' region and the Y' region of the long-chain nucleic acid as a whole can realize the sensing of the short-chain nucleic acid.

[0150] It should be understood that the P region and F region (as well as the complementary P' region and F' region) in the first circular nucleic acid can be designed according to the specific PCR amplification reaction; the first structural region N1 and the second structural region N2 can be arbitrarily designed so that the long-chain nucleic acid is circular. The identification region B is an identification code of the small molecule compound corresponding to the first circular nucleic acid, which is used to distinguish different first circular nucleic acids, thereby distinguishing different small molecule compounds. Specifically, the identification code can be recognized by the nanopore and corresponds to a uniquely determined small molecule compound, thereby enabling the nanopore to specifically detect the presence and / or content of the small molecule compound. In some embodiments, the length of the identification region B is ≥ 5 bases.

[0151] Referring to Table 1, the specific sequences of the short-chain nucleic acid and the long-chain nucleic acid in the first circular nucleic acid can be adjusted according to the specific small molecule compound and aTF protein. The present invention has no limitation on the length of each region as long as a circular nucleic acid can be formed. In some embodiments, the sequence of the short-chain nucleic acid in the first circular nucleic acid for detecting DhdR can be SEQ ID NO: 1, and the sequence of the long-chain nucleic acid can be SEQ ID NO: 2.

[0152] For LhgR, the sequence of the short-chain nucleic acid in the corresponding first circular nucleic acid may be SEQ ID NO: 19; and the sequence of the long-chain nucleic acid may be SEQ ID NO: 20.

[0153] For HucR, the sequence of the short-chain nucleic acid in the corresponding first circular nucleic acid may be SEQ ID NO: 23; and the sequence of the long-chain nucleic acid may be SEQ ID NO: 24.

[0154] For SRTF1, the sequence of the short-chain nucleic acid in the corresponding first circular nucleic acid may be SEQ ID NO:21; and the sequence of the long-chain nucleic acid may be SEQ ID NO:22.

[0155] For LIdR, the sequence of the short-chain nucleic acid in the corresponding first circular nucleic acid may be SEQ ID NO:25; and the sequence of the long-chain nucleic acid may be SEQ ID NO:26.

[0156] In some embodiments, the short-chain nucleic acid is a linear nucleic acid, and the long-chain nucleic acid is a circular nucleic acid.

[0157] Further, the present invention enables nanopore sequencing technology to be used for nucleic acid quantification by adding a certain known amount of internal reference nucleic acid (i.e., a second circular nucleic acid, for example, 1 nmol). Wherein, the structure of the second circular nucleic acid is substantially the same as that of the first circular nucleic acid (i.e., the short-chain nucleic acid includes the P region, the X region, the Y region, and the F region from the 5' end to the 3' end, and the long-chain nucleic acid includes the X' region, the P' region, the first structural region N1, the identification region B, and the second structural region N2, the F' region, and the Y' region from the 5' end to the 3' end), the difference being that the identification region B is different, i.e., the long-chain nucleic acid of the second circular nucleic acid differs from the identification region B of the long-chain nucleic acid of the first circular nucleic acid by at least one base. In some embodiments, the long-chain nucleic acid of the second circular nucleic acid is the same as the P' region and the F' region of the long-chain nucleic acid of the first circular nucleic acid. In some embodiments, the short-chain nucleic acid of the second circular nucleic acid may be the same as the short-chain nucleic acid of the first circular nucleic acid. In some embodiments, the short-chain nucleic acid of the second circular nucleic acid may be different from the short-chain nucleic acid of the first circular nucleic acid.

[0158] Furthermore, rolling circle amplification products and corresponding PCR amplification products of the first circular nucleic acid and the second circular nucleic acid are amplified through rolling circle amplification and PCR amplification processes, and nanopore sequencing is performed.

[0159] In some embodiments, the read comparison includes obtaining a ratio of the read numbers of the first long-chain nucleic acid and the second long-chain nucleic acid and obtaining the concentration of the small molecule compound based on a reference standard.

[0160] In some embodiments, the reference standard includes a concentration dependence curve of the test substance. In some embodiments, the method for drawing the concentration dependence curve of the test substance includes using nanopore sequencing technology to detect samples containing known different concentrations of the test substance, obtaining the ratio of the number of reads of the first long-chain nucleic acid (corresponding to the first circular nucleic acid) and the second long-chain nucleic acid (corresponding to the internal reference nucleic acid) under different concentrations of the test substance, and then obtaining the concentration dependence curve (for example Figure 4 In some specific embodiments, the concentration of the detection substance includes 0, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 50, 100, 1000 μM.

[0161] Figure 2 The horizontal axis represents the ratio of the added known first circular nucleic acid to the second circular nucleic acid, and the vertical axis represents the ratio of the first circular nucleic acid to the second circular nucleic acid obtained by sequencing. Figure 2 The results show that the input ratio (i.e., the concentration ratio of the added known first circular nucleic acid and the second circular nucleic acid) and the output ratio (i.e., the ratio of the number of reads of the PCR amplification products of the first circular nucleic acid and the second circular nucleic acid) are basically consistent. Since the amount of the second circular nucleic acid is determined in the method of the present invention, the content of the first circular nucleic acid can be determined by the ratio of the number of reads of the PCR amplification products of the first circular nucleic acid and the second circular nucleic acid, thereby achieving qualitative and quantitative detection of small molecule compounds.

[0162] Figure 3 In the figure, a, b, and c respectively show the extraction of three aTFs proteins; d shows the preparation of circular nucleic acids and rolling circle amplification; the EMSA gel in e shows the binding of circular nucleic acids and aTFs. As the concentration of aTFs increases, the first circular nucleic acid is completely bound; the EMSA gel in f shows the feasibility of aTFs as sensors. As the target small molecule compounds increase, the circular nucleic acids gradually fall off (the experimental results of this example are based on magnetic beads, unless otherwise stated).

[0163] Figure 4 In the figure, a, b, and c show the specific capabilities (left) and calibration curves (right) of three different aTFs sensors, respectively. Figure 4 This indicates that the sensor involved in the present invention has high specificity and sensitivity, can use nanopore sequencing technology to achieve quantitative detection of small molecule compounds, and can detect the concentration of small molecule compounds at the μM level. Figure 4 In it, D-LA means D-lactic acid, L-LA means L-lactic acid, CITR means citric acid, HMA means mandelic acid, PYR means pyruvic acid, L-MA means L-malic acid, D-MA means D-malic acid, OAA means oxaloacetic acid, UA means uric acid, and PROG means progesterone.

[0164] Figure 5A It is demonstrated that the method provided by the present invention (including the sensor involved) has the ability to be applied to the simultaneous mixed detection of multiple samples and can be applied to the simultaneous detection of multiple samples. Figure 5B The results of using the method provided by the present invention for the simultaneous detection of UA, D-2HG and L-2HG are further demonstrated. Figure 5B The horizontal axis is the predicted value, and the vertical axis is the added sample; the darker the color, the higher the possibility of detecting the sample. By encoding different and unique identification codes for different small molecule compounds and introducing internal references, the present invention finds that the method of detecting the presence and / or content of the corresponding small molecule compound by the ratio of the first circular nucleic acid to the internal reference has strong anti-interference ability and is suitable for the detection of mixed samples.

[0165] Fig. 6A It is demonstrated that the method provided by the present invention (including the sensor involved) can be applied to detect a variety of complex clinical samples (serum, pleural effusion, urine, cerebrospinal fluid, puncture fluid, alveolar lavage fluid, puncture fluid, pericardial fluid) without pre-processing the biological samples, and all have good detection ability and anti-interference ability. Figure 6B The results of analyzing samples of acute myeloid leukemia patients with wild-type IDH (low D-2HG concentration), IDH gene mutation (high D-2HG concentration) and IDH mutation patients after treatment (low D-2HG concentration) using the method provided by the present invention are shown, which are consistent with the actual situation.

[0166] Figure 7 The data in Table 3 show that the blind test results of the method provided by the present invention have a high accuracy rate (higher than 83%).

[0167] Table 3 sample A B C D E F Concentration μM 0.8 10 0 20 5 15 Actual yin and yang Negative Positive Negative Positive Positive Positive Detection of positive and negative Negative Positive Negative Positive Negative Positive

[0168] Embodiment 3

[0169] The protein concentration was determined by the BCA method, and the binding of microcrystalline cellulose MCC to aTF protein was verified. The specific steps included: incubating and fixing MCC with aTF protein connected with a CBD sequence for 30 minutes, aspirating the supernatant ①, and reacting with Bradford reagent; washing MCC to obtain eluent ① / eluent ②, and reacting with Bradford reagent; finally, taking MCC connected with aTF and reacting with Bradford reagent.

[0170] like Fig. 9As shown, the supernatant and the eluate contained only a small amount of protein, and aTF-CBD-MCC was tested to contain a higher concentration of protein, thus proving that it is feasible to connect aTF protein to microcrystalline cellulose through the CBD sequence, and microcrystalline cellulose can successfully solidify aTF protein.

[0171] Embodiment 4:

[0172] In this example, nanopore sequencing technology was used to detect different concentrations of the first circular nucleic acid (i.e., no internal reference nucleic acid was added). The results are as follows: Fig. 10A As shown, this embodiment found that the number of reads of the first circular nucleic acid has no dependence on the concentration of the first circular nucleic acid (that is, the number of reads and the concentration of the first circular nucleic acid are disordered), that is, conventional nanopore sequencing technology can only perform quantitative analysis on the target DNA, but cannot achieve quantitative detection.

[0173] The results are as follows Fig. 10B As shown, after the introduction of 100 pM internal reference nucleic acid (C1, the concentration remains unchanged), as the concentration of the first circular nucleic acid (T1) increases, the proportion of the first circular nucleic acid in the total number of reads increases. Fig. 10C for Fig. 10B The result of the data standardization processing shows the concentration dependence curve of the first circular nucleic acid. The above experimental results further show that the method provided by the present invention can achieve quantitative detection of the detection object.

[0174] In addition, the above results also show that based on the plotted concentration dependence curve, the quantitative detection of the detection object can be achieved by analyzing the number of reads of the first circular nucleic acid and the internal reference nucleic acid (distinguished by the marker region B). Therefore, as long as the concentration dependence curve of the specific circular nucleic acid and the internal reference nucleic acid is obtained, and the PCR product of the first circular nucleic acid and the internal reference nucleic acid are simultaneously sequenced by nanopore, even if the internal reference nucleic acid is not subjected to rolling circle amplification and PCR amplification, the quantitative detection of the detection object can be achieved.

[0175] Example 5: Detection of RNA based on nanopore sequencing technology

[0176] The present invention has demonstrated the feasibility of using the constructed first circular nucleic acid and the second circular nucleic acid as an internal reference to quantitatively detect small molecule compounds in the above examples. The above examples of the present invention show that the short-chain nucleic acid in the first circular nucleic acid can play a role in binding the detection object, while the long-chain nucleic acid plays a role in binding and sensing the short-chain nucleic acid, and only the long-chain nucleic acid participates in the rolling circle amplification and PCR amplification reactions. Based on the above experimental results, this example replaces the short-chain nucleic acid in the first circular nucleic acid with RNA and performs quantitative detection on it ( Fig. 11B ). The specific method is as follows:

[0177] 5.1 Add 20 μL of 200 pM synthetic long-chain nucleic acid probe (also referred to as "long-chain nucleic acid"; the design method of the long-chain nucleic acid probe is the same as that of Example 1 and Example 2) to the sample, and anneal to allow the miRNA to bind to the long-chain nucleic acid probe to form a first circular nucleic acid with a gap;

[0178] 5.2 Add 1U of splintR Ligase enzyme to the first circular nucleic acid with a gap, and incubate at 25 degrees for 1 hour to repair the gap of the first circular nucleic acid with a gap;

[0179] 5.3 Add 20 μL of 200 pM of the second circular nucleic acid (internal reference nucleic acid) to the first circular nucleic acid obtained in 5.2, and perform rolling circle amplification (RCA) reaction together to obtain the first long-chain nucleic acid and the second long-chain nucleic acid;

[0180] 5.4 performing a PCR amplification reaction using the first long-chain nucleic acid and the second long-chain nucleic acid as templates;

[0181] 5.5 The PCR nucleic acid product samples are purified, end-repaired, connected to adapters, and other steps to prepare DNA libraries;

[0182] 5.6 After the library passes the quality inspection, the samples will be sequenced;

[0183] 5.7 By comparing the first circular nucleic acid with the internal reference nucleic acid, the miRNA in the biological sample is qualitatively and quantitatively determined.

[0184] This example detects miRNA155, miR10a-5p, miRNA93-5p, miRNA129-5p, and miRNA181b-5p. The specific sequences are shown in Table 4 below.

[0185] Table 4 Note: In the long-chain nucleic acid probe, CATACCTAGAGTAAGT is the first structural region N1 and TGCAGACATTAGTGATCATATTA is the second structural region N2, CTGTCTCTTATACACATCTGACGCTGCC is the P' region, and GCTCGGAGATTAGTTGCATAACC is the F' region; the upstream of the P' region is the X' region; the downstream of the F' region is the Y' region, and the identification region B is between the first structural region N1 and the second structural region N2.

[0186] Fig. 11CThe left column of the bar graph represents no addition of miRNA, and the right column represents the addition of 1 nM miRNA. The results show that the method provided by the present invention can achieve quantitative detection of 5 miRNAs.

[0187] This example further tested different concentrations of miRNA10a. Fig.11D and Fig.11E It was shown that the concentration of miRNA10a was dependent on the sequencing results, and the detection limit was less than or equal to 100fM.

[0188] Example 6: Detection of proteins based on nanopore sequencing technology

[0189] This example is based on the experimental results of Example 5 to verify the feasibility of quantitative detection of proteins using the above ideas ( Fig. 12A ).

[0190] 6.1 annealing the nucleic acid aptamer 1 and the complementary short chain 1 to form a double chain 1;

[0191] 6.2 Add 5 μL of 20 μM synthesized double-stranded protein 1 to the object to be detected and incubate for 30 min to allow the nucleic acid aptamer 1 to bind to the protein and release the complementary short chain 1;

[0192] 6.3 The complementary short chain 1 combines with the long-chain nucleic acid probe to form a first circular nucleic acid with a gap;

[0193] 6.4 Add 1U T4 ligase to the first circular nucleic acid with a gap to repair the gap.

[0194] 6.5 Add 20 μL of 200 pM of the second circular nucleic acid (internal reference) to the first circular nucleic acid obtained in 6.4, and perform rolling circle amplification (RCA) reaction together to obtain the first long-chain nucleic acid and the second long-chain nucleic acid;

[0195] 6.6 performing a PCR amplification reaction using the first long-chain nucleic acid and the second long-chain nucleic acid as templates;

[0196] 6.7 The obtained PCR nucleic acid product samples are purified, end-repaired, connected to adapters, and other steps to prepare a DNA library;

[0197] 6.8 After the library quality inspection is qualified, the samples will be sequenced;

[0198] 6.9 By comparing the first circular nucleic acid with the internal reference nucleic acid, the protein in the biological sample is qualitatively and quantitatively determined. The specific sequence is shown in Table 5 below.

[0199] Table 5 Note: In the long-chain nucleic acid probe, CATACCTAGAGTAAGT is the first structural region N1 and TGCAGACATTAGTGATCATATTA is the second structural region N2, CTGTCTCTTATACACATCTGACGCTGCC is the P' region, and GCTCGGAGATTAGTTGCATAACC is the F' region; the upstream of the P' region is the X' region; the downstream of the F' region is the Y' region, and the identification region B is between the first structural region N1 and the second structural region N2.

[0200] The results are as follows Fig. 12B As shown, no protein was added to the left column, and 10 μM protein was added to the right column. The results show that the method provided by the present invention can perform quantitative detection of protein.

[0201] Embodiment 7

[0202] In this example, 7 designed first circular nucleic acids were detected. Fig.13 The left heat map shows that the method provided by the present invention has very good specificity and can detect seven test objects at the same time. Fig.13 The right panel shows the concentration dependence curves of different nucleic acids. Note: In the long-chain nucleic acid probe, CATACCTAGAGTAAGT is the first structural region N1 and TGCAGACATTAGTGATCATATTA is the second structural region N2, CTGTCTCTTATACACATCTGACGCTGCC is the P' region, and GCTCGGAGATTAGTTGCATAACC is the F' region; the upstream of the P' region is the X' region; the downstream of the F' region is the Y' region, and the identification region B is between the first structural region N1 and the second structural region N2.

[0203] Embodiment 8

[0204] This embodiment further provides a method for analyzing the presence and / or content of a detection object in a sample (or specimen) based on nanopore sequencing technology, the method comprising:

[0205] S101: mixing the sample with the detection system to form a first circular nucleic acid with a gap, wherein the detection system includes a long-chain nucleic acid probe; the detection object includes RNA or protein; when the detection object is RNA, the RNA and the long-chain nucleic acid probe form the first circular nucleic acid with a gap; when the detection object is a protein, the detection system also includes a double-stranded structure, wherein the double-stranded structure includes a first strand that specifically binds to the protein and a second strand that is complementary to the first strand, after the first strand binds to the protein, the second strand is released and forms the first circular nucleic acid with a gap with the long-chain nucleic acid probe; the RNA or the second strand is a short-chain nucleic acid ( Fig.11A );

[0206] Wherein, the long-chain nucleic acid probe includes an X' region, a P' region, a first structural region N1, an identification region B, a second structural region N2, an F' region, and a Y' region; the X' region and the Y' region are complementary to the short-chain nucleic acid; the P' region and the F' region are respectively combined with the upstream primer and the downstream primer of the PCR amplification reaction; the first structural region N1 and the second structural region N2 are used to maintain the circular structure of the long-chain nucleic acid probe; the identification region B is specific to the first circular nucleic acid.

[0207] When the detection object is RNA, the length of the long-chain nucleic acid probe can be adjusted according to the length and sequence of the RNA, as long as the X' region and Y' region of the long-chain nucleic acid probe are completely complementary to the RNA and the total length of the X' region and the Y' region is ≥ the length of the RNA.

[0208] When the object to be detected is a protein, the length of the long-chain nucleic acid probe can be adjusted according to the length and sequence of the second chain, as long as the X' region and the Y' region of the long-chain nucleic acid probe can be completely complementary to the second chain, and the total length of the X' region and the Y' region is ≥ the length of the second chain. The design of the second chain depends on the aptamer (that is, the first chain of the double-stranded structure is an aptamer that specifically binds to the protein), that is, the method provided by the present invention is applicable to proteins that the aptamer can bind to.

[0209] In some embodiments, the length of the short nucleic acid is ≥ 10 bases.

[0210] In some embodiments, the RNA is miRNA.

[0211] In some embodiments, the miRNA includes one or more of miRNA155, miR10a-5p, miRNA93-5p, miRNA129-5p, and miRNA181b-5p.

[0212] In some embodiments, for miRNA155, the sequence of the long-chain nucleic acid probe may be SEQ ID NO: 27. In some embodiments, for miR10a-5p, the sequence of the long-chain nucleic acid probe may be SEQ ID NO: 35. In some embodiments, for miRNA93-5p, the sequence of the long-chain nucleic acid probe may be SEQ ID NO: 37. In some embodiments, for miRNA129-5p, the sequence of the long-chain nucleic acid probe may be SEQ ID NO: 39. In some embodiments, for miRNA181b-5p, the sequence of the long-chain nucleic acid probe may be SEQ ID NO: 41.

[0213] In some embodiments, the protein comprises CD117.

[0214] In some embodiments, the sequence of the first strand of the double-stranded structure may be SEQ ID NO:42, the sequence of the second strand may be SEQ ID NO:43, and the sequence of the long-chain nucleic acid probe may be SEQ ID NO:44.

[0215] S102: adding ligase to the first circular nucleic acid with a gap and incubating to obtain a first circular nucleic acid without a gap; the 5' end of the long-chain nucleic acid is phosphorylated, the short-chain nucleic acid and the long-chain nucleic acid are annealed and complemented to form a circular nucleic acid with a gap, and the ligase catalyzes the generation of a phosphodiester bond to form a complete ring.

[0216] In some embodiments, the ligase comprises splintR ligase or T4 ligase.

[0217] S103 performing nanopore sequencing on the first circular nucleic acid product and the internal reference nucleic acid product, wherein the first circular nucleic acid product is a PCR amplification product of a first long-chain nucleic acid obtained by rolling circle amplification of the first circular nucleic acid without a gap, and the internal reference nucleic acid is a linear nucleic acid or a circular nucleic acid;

[0218] S104: Read and compare the first circular nucleic acid product and the internal reference nucleic acid product, and determine the presence and / or content of the detection object in the sample based on a predetermined reference standard.

[0219] In some embodiments, the reference standard includes a concentration dependence curve of the test substance. In some embodiments, the method for drawing the concentration dependence curve of the test substance includes using nanopore sequencing technology to detect samples containing known different concentrations of the test substance, obtaining the ratio of the number of reads of the first circular nucleic acid product (corresponding to the first circular nucleic acid) and the internal reference nucleic acid product (corresponding to the internal reference nucleic acid) under different concentrations of the test substance, and then obtaining the concentration dependence curve (for example Fig.11DIn some specific embodiments, the concentration of the detection substance includes 0, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 50, 100, 1000 μM.

[0220] The present invention finds that the addition of the internal reference nucleic acid makes the disordered concentration relationship between the number of reads of the first circular nucleic acid and the concentration of the first circular nucleic acid orderly, so it is sufficient to ensure that there is a difference between the identification region B of the internal reference nucleic acid and the identification region B of the first circular nucleic acid (for example, at least one base difference), and it is not limited to the circular structure. Furthermore, when the concentration dependence curve of the detection object is determined, the internal reference nucleic acid can be rolled circle amplified and PCR amplified together with the first circular nucleic acid, or it can be directly added to the first circular nucleic acid product for nanopore sequencing.

[0221] In some embodiments, the internal reference nucleic acid includes at least a marker region B, and the marker region B of the long-chain nucleic acid of the first circular nucleic acid differs from the marker region B of the internal reference nucleic acid by at least one base. In some embodiments, the length of the marker region B is ≥5 bases.

[0222] In some embodiments, the internal reference nucleic acid is a circular nucleic acid. In some embodiments, the structure of the internal reference nucleic acid is substantially the same as that of the first circular nucleic acid (i.e., the long-chain nucleic acid includes an X' region, a P' region, a first structural region N1, an identification region B and a second structural region N2, an F' region and a Y' region from the 5' end to the 3' end), except that the identification region B is different. In some embodiments, the P' region and the F' region of the long-chain nucleic acid of the internal reference nucleic acid are the same as those of the long-chain nucleic acid of the first circular nucleic acid. In some embodiments, the short-chain nucleic acid of the internal reference nucleic acid may be the same as the short-chain nucleic acid of the first circular nucleic acid. In some embodiments, the short-chain nucleic acid of the internal reference nucleic acid may be different from the short-chain nucleic acid of the first circular nucleic acid.

[0223] In some embodiments, the step S103 also includes the following steps: (a) adding an internal reference nucleic acid to the first circular nucleic acid without a gap and performing a rolling circle amplification reaction to obtain a first long-chain nucleic acid and a second long-chain nucleic acid; (b) using the first long-chain nucleic acid and the second long-chain nucleic acid as templates, performing a PCR amplification reaction to obtain a PCR amplification product.

[0224] In some embodiments, the PCR amplification products are processed before sequencing.

[0225] In some embodiments, the sample comprises one or more of serum, pleural effusion, peritoneal effusion, urine, cerebrospinal fluid, puncture fluid, bronchoalveolar lavage fluid, puncture fluid, pericardial fluid and bile.

[0226] In some embodiments, the sample is derived from a human.

[0227] In some embodiments, the volume of the sample comprises 10-100 μL.

[0228] In some embodiments, the volume of the sample comprises 50 μL.

[0229] In some embodiments, the sample is not pre-processed.

[0230] In some embodiments, the sample is a mixed sample.

[0231] In some embodiments, the concentration of the first circular nucleic acid is 0.1 nM-20 μM

[0232] In some embodiments, the concentration of the internal reference nucleic acid comprises 100-1000 pmol.

[0233] In some embodiments, the short-stranded nucleic acid is a linear-stranded nucleic acid.

[0234] In some embodiments, the first circular nucleic acid is a padlock probe circularization.

[0235] In some embodiments, the internal reference nucleic acid is a padlock probe circularized.

[0236] The embodiments of the present invention are described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementation modes, which are merely illustrative rather than restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms without departing from the scope of protection of the present invention and the claims, all of which are within the protection of the present invention.

Claims

1. A method for analyzing the presence and / or content of a test substance in a sample based on nanopore sequencing technology, characterized in that: The method comprises: S101: mixing the sample with the detection system to form a first circular nucleic acid with a gap, wherein the detection system includes a long-chain nucleic acid probe; the detection object includes RNA or protein; when the detection object is RNA, the RNA and the long-chain nucleic acid probe form the first circular nucleic acid with a gap; when the detection object is a protein, the detection system also includes a double-stranded structure, wherein the double-stranded structure includes a first strand that specifically binds to the protein and a second strand that is complementary to the first strand, and after the first strand binds to the protein, the second strand is released and forms the first circular nucleic acid with a gap with the long-chain nucleic acid probe; the RNA or the second strand is a short-chain nucleic acid; S102 adding a ligase to the first circular nucleic acid with a gap and incubating the nucleic acid to obtain a first circular nucleic acid without a gap; S103 performing nanopore sequencing on the first circular nucleic acid product and the internal reference nucleic acid product, wherein the first circular nucleic acid product is a PCR amplification product of a first long-chain nucleic acid obtained by rolling circle amplification of the first circular nucleic acid without a gap, and the internal reference nucleic acid is a linear nucleic acid or a circular nucleic acid; S104: reading and comparing the first circular nucleic acid product and the internal reference nucleic acid product, and determining the presence and / or content of the detection object in the sample based on a predetermined concentration dependence curve of the detection object; Wherein, the long-chain nucleic acid probe includes an X' region, a P' region, a first structural region N1, an identification region B, a second structural region N2, an F' region, and a Y' region; the X' region and the Y' region are complementary to the short-chain nucleic acid; the P' region and the F' region are respectively combined with the upstream primer and the downstream primer of the PCR amplification reaction; the first structural region N1 and the second structural region N2 are used to maintain the circular structure of the long-chain nucleic acid probe; the identification region B is specific to the first circular nucleic acid.

2. The method according to claim 1, characterized in that The RNA is miRNA.

3. The method according to claim 1, characterized in that The proteins include CD117.

4. The method according to claim 1, characterized in that The sample includes one or more of serum, pleural effusion, peritoneal effusion, urine, cerebrospinal fluid, puncture fluid, bronchoalveolar lavage fluid, puncture fluid, pericardial fluid and bile.

5. The method according to claim 1, characterized in that The samples were not pre-treated.

6. The method according to claim 1, characterized in that The sample is a mixed sample.

7. The method according to claim 1, characterized in that The concentration of the internal reference nucleic acid ranges from 100 to 1000 pmol.

8. The method according to claim 1, characterized in that The short-chain nucleic acid is a straight-chain nucleic acid.

9. The method according to claim 1, characterized in that The first circular nucleic acid and the internal reference nucleic acid are padlock probe circularized.

10. The method according to claim 1, characterized in that The ligase includes splintR ligase or T4 ligase.

Images