Primer, kit and detection method for simultaneously detecting duck and donkey meat-derived components and application

Abstract

The invention belongs to the field of animal species source identification, and particularly relates to primers, a kit and a detection method for simultaneously detecting duck or donkey meat-derived components and application. According to the invention, a universal primer pair suitable for isothermal amplification and a CRISPR-Cas12a duck-origin or donkey-origin specific crRNA primer group are designed, and the two meat-origin components can be rapidly identified by combining an RPA / CRISPR-Cas12a detection system with a nucleic acid detection test strip. The embodiment of the invention shows that the product designed by the invention is simple in use method, does not need professionals, is low in cost, is readable in reaction result by naked eyes, and is very suitable for field detection.

Description

Technical Field

[0001] The invention belongs to the field of animal species origin identification, and specifically relates to a primer, a kit, a detection method and an application for simultaneously detecting duck and donkey meat-derived components. Background Art

[0002] High-quality animal DNA testing plays an increasingly important role in animal forensic identification.

[0003] Meat source identification technology has evolved from morphological and protein-based detection methods to nucleic acid detection. my country has successively issued a series of national standards for nucleic acid detection of animal-derived ingredients, including PCR, real-time fluorescence PCR, Sanger sequencing, etc., which provide a basis for the identification of animal-derived ingredients. However, these methods have high professional requirements, high instrumentation requirements, high prices, and long time consumption. They require professional technicians, which is not suitable for on-site immediate analysis.

[0004] Therefore, the combination of RPA and CRISPR-Cas12a technology gradually shows its advantages of high efficiency, rapidity and specificity, providing a new method for on-site meat-derived component identification. At present, the most widely used isothermal amplification technology includes loop-mediated isothermal amplification detection technology (LAMP). There have been some reports on the use of LAMP technology for animal meat source detection, such as the use of a constant temperature amplification primer set and its kit that can simultaneously detect pork and duck meat-derived components (patent application number: 201610880177.4), a rapid detection method and kit for donkey-derived components in food (patent application number: 201910290775.X), but the design of LAMP primer pairs is complex and contains six gene primers, which is not suitable for efficient multi-species identification.

[0005] Therefore, there is an urgent need in the market for a meat origin identification method that is low-cost and can efficiently detect multiple species. Summary of the invention

[0006] The purpose of the present invention is to provide a primer, a kit, a detection method and a reference for detecting duck or donkey meat-derived components. The method provided by the present invention can not only efficiently and rapidly specifically detect duck or donkey meat-derived components, but also has low detection cost and high sensitivity.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides a Cas12a-crRNA primer for detecting duck or donkey meat-derived components, wherein the Cas12a-crRNA primer for detecting duck meat-derived components is shown in the sequence table SEQ ID NO.1; the Cas12a-crRNA primer for detecting donkey meat-derived components is shown in the sequence table SEQ ID NO.2.

[0009] Preferably, the Cas12a-crRNA primer can specifically recognize the DNA sequences of duck and donkey; the DNA of the duck is shown in the sequence list SEQ ID NO.5; the DNA of the donkey is shown in the sequence list SEQ ID NO.6.

[0010] The present invention also provides an isothermal RPA nucleic acid amplification primer set for amplifying common poultry and livestock, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.4.

[0011] The present invention also provides an RPA-CRISPR / Cas12a kit for detecting duck or donkey meat-derived components, the kit comprising the Cas12a-crRNA primer according to claim 1 and the primer set according to claim 3.

[0012] The present invention also provides the use of the above-mentioned Cas12a-crRNA primer or the above-mentioned primer or the above-mentioned kit in detecting duck or donkey meat-derived components.

[0013] The present invention also provides a method for detecting duck or donkey meat-derived components, which specifically comprises the following steps:

[0014] S1, extracting DNA of the sample to be tested;

[0015] S2, using the DNA obtained in step S1 as a template, and performing RPA nucleic acid isothermal amplification reaction using the RPA primers described in claim 3;

[0016] S3, adding the amplified product to the CRISPR-Cas12a reaction system; the CRISPR-Cas12a detection system comprises the Cas12a-crRNA primer and reporter according to claim 1;

[0017] S4. Determine whether the sample contains duck or donkey meat-derived ingredients by detecting the reporter.

[0018] Preferably, the CRISPR-Cas12a detection system in step S3 further includes the RPA reaction product of step S1 and the CRISPR / Cas12a protein, and the reporter sequence is TTATTT, the 5' end of the sequence is labeled with modified fluorescein FAM, and the 3' end is labeled with biotin Biotin.

[0019] Preferably, the RPA nucleic acid isothermal amplification reaction conditions in step S2 are a constant temperature of 39° C. for 20 minutes, and then the reaction is terminated; the CRISPR-cas12a reaction conditions in step S3 are a constant temperature of 45° C. for 10 minutes, and then the reaction is terminated.

[0020] Preferably, the reporter detection method in step S4 may be fluorescence detection or test strip detection.

[0021] The colloidal gold nucleic acid test strip in the colloidal gold nucleic acid test strip detection method selected by the present invention comprises: a sample pad, a binding pad containing a complex of colloidal gold nanoparticles Au-NP-fluorescein FAM labeled antibody, a T line coated with streptavidin for capturing biotin, a C line coated with goat anti-mouse IgG for capturing colloidal gold nanoparticles, and an absorption pad for attracting liquid through the test strip.

[0022] More preferably, the test result of the colloidal gold nucleic acid test strip is determined as follows: if the quality control C line has a band, but the detection T line has no band, then the target gene is contained; if both the detection T line and the quality control C line have red bands, then the target gene is not contained.

[0023] Beneficial effects of the present invention:

[0024] 1. It is beneficial to construct universal primers with specific sequences in the middle of the conserved ends of the mitochondria of common poultry and livestock, which is convenient for rapid isothermal amplification of multiple species.

[0025] 2. The selected sequence fragments are short, about 230 bp, which are suitable for fresh, processed, and slightly degraded duck and donkey-derived ingredients, and are more suitable for real-world situations.

[0026] 3. The RPA isothermal amplification reaction speed is fast, the primer design is simple, the reaction temperature is low, and it is more suitable for field use.

[0027] 4. Construct the CRISPR-Cas12a system primer crRNA based on the mitochondrial intermediate-specific sequence to specifically identify duck and donkey meat-derived ingredients.

[0028] 5. The present invention combines the respective advantages of RPA isothermal amplification and CRISPR-Cas12a system to construct a method for on-site rapid detection of animal-derived components, exploring new approaches for the detection of other animal-derived components. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0030] Figure 1 This is the colloidal gold nucleic acid test strip test result for ducks;

[0031] Figure 2 This is the test result of donkey's colloidal gold nucleic acid test strip. DETAILED DESCRIPTION

[0032] The present invention mainly relies on three enzymes using RPA technology: a recombinase that can bind to single-stranded nucleic acids (oligonucleotide primers), a single-stranded DNA binding protein (SSB) and a strand displacement DNA polymerase. The mixture of these three enzymes is also active at room temperature. Generally, a detectable level of amplification products is obtained in about 20 minutes, with the advantages of simple primer design, naked eye reading results, and low reaction temperature. Combined with the specific recognition binding and nucleic acid cutting ability of the CRISPR-Cas12a system, the target nucleic acid sequence can be cut by the cis and trans cutting activity of the Cas12a protein, improving the detection specificity and avoiding interference from nonspecific amplification products; improving detection sensitivity and secondary amplification of detection signals.

[0033] The present invention provides an RPA / CRISPR-cas12a primer set for detecting duck or donkey meat-derived components.

[0034] The crRNA sequence of Cas12a is composed of two parts: the repeat sequence at the 5' end and the complementary sequence spacer of the target gene sequence at the 3' end. Its fixed stem-loop structure sequence (epeat) is 5'-UAAUUUCUACUAAGUGUAGAU-3'.

[0035] Using the benchling platform constructed by Zhang Feng's team, we designed specific crRNA on the 12s rDNA screening gene sequence on duck or donkey mitochondria, with a PAM sequence (TTTV) upstream.

[0036] crRNA primer for detecting duck meat-derived components (crRNA 1): UAAUUUCUAAGUGUAGAU-GGUGCAUCUUGUGCUUGCGACA (SEQ ID NO.1)

[0037] According to the sequence listing rules ST.26, U in the sequence listing file is represented by T.

[0038] crRNA primers for detecting donkey meat-derived ingredients (crRNA2):

[0039] UAAUUUCUACUAAGUGUAGAU-GUAUGGGUCUUUGACACGCU(SEQ ID NO.2)

[0040] According to the sequence listing rules ST.26, U in the sequence listing file is represented by T.

[0041] Universal primer pairs for amplifying poultry and livestock sequences:

[0042] The upstream primer sequence (12s rDNA F) is: 5'-AGGGTTGGTAAATCTCGTGCCAGCCACCG-3'; (SEQ ID NO.3)

[0043] The downstream primer sequence (12s rDNA R) is: 5'-TTTAGGGCCAGGCATAGTGGGGTATCTAATC-3'; (SEQ ID NO.4)

[0044] The present invention extracts 12s rDNA from mitochondria of 11 animals (real-time mitochondrial screening is performed on sequences with species conservation at both ends and species specificity in the middle of 11 animals) through RPA reaction to obtain RPA products (targets), which are then combined with designed crRNA, Cas12aProtein and Reporter to form a CRISPR / Cas12a reaction system.

[0045] In the CRISPR / Cas12a detection system, the sequence of the Cas12a cleavage substrate (Reporter) is TTATTT, the 5' end is labeled with modified fluorescent FAM, and the 3' end is labeled with biotin.

[0046] The Cas12a protein first binds to crRNA to form a Cas12a-crRNA complex, which recognizes and binds to the target DNA through the PAM sequence (TTTV), and the spacer region of the crRNA performs base complementary pairing with the target DNA sequence. The crRNA-target DNA hybridization triggers a huge conformational change in Cas12a, resulting in the activation of single-stranded cleavage of the Cas12a protein, which can then cut single-stranded DNA. When the reporter is cut, FAM separates from biotin.

[0047] The reaction product was mixed with the test strip detection diluent at a ratio of 1:10 and dropped onto the sample pad. The reaction system contained a mixture of Au-NP-anti-FAM-FAM complex, Au-NP-anti-FAM, and biotin. At the T line, streptavidin could not capture the Au-NP-anti-FAM-FAM complex and Au-NP-anti-FAM, so no band appeared at the T line, while the C line could be captured by goat anti-mouse IgG to form a band.

[0048] In the negative sample, since there is no cleavage of the reporter DNA, the reaction system contains Au-NP-anti-FAM-FAM-biotin complex and Au-NP-anti-FAM. When the reaction system flows to the T line, the Au-NP-anti-FAM-FAM-biotin complex is captured by streptavidin to form a band, while at the C line, the Au-NP-anti-FAM is captured by goat anti-mouse IgG to form a band.

[0049] The specific DNA sequence for a duck or donkey is as follows:

[0050] Duck (DNA 1):

[0051] AGGGTCCGGTAAATCTTGTGCCAGCCACCGCGGTCATACAAGAGACCCA

[0052] AATCAACTGTCCTACAAGCGGCGTAAAGAGTGGTAAGATGCCTATCCT

[0053] ACCTAACTAAGATCAAAATGCAACTAAGCTGTCGCAAGCACAAGATGC

[0054] ACCTAAACACACCATCAAGATGATCTTAGAAACTAGCGATTAATTTGAA

[0055] CCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAA(SEQ IDNO.5)

[0056] Donkey (DNA2):

[0057] AGGGTTGGTAAAATTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAATTAATAAACCCTCCGGCGTAAAGCGTGTCAAAGACCCATACTAAAATAAAGTTAAAACCCAGTTAAGCTGTAAAAAGCTACAACCAAAGTAAAATAAACTACGAAAGTGACTTTAATATCTCTGACCACACGATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAA (SEQ ID NO. 6)

[0058] In the embodiment of the present invention, a colloidal gold nucleic acid test strip is used to detect duck or donkey meat-derived components in a sample. The test strip includes: a sample pad, a binding pad (containing a complex bound to a colloidal gold nanoparticle (Au-NP)-fluorescein FAM-labeled antibody), a T line (coated with streptavidin for capturing biotin-labeled DNA), a C line (coated with goat anti-mouse IgG for capturing colloidal gold nanoparticles), and an absorption pad (for attracting liquid through the test strip).

[0059] Positive reaction: Cas12a initiates single-strand cleavage activity upon detection of the target nucleotide amplified by RPA, cleaving the Reporter labeled with FAM and biotin. When the Reporter is cleaved, FAM is separated from biotin, so there is a mixture of Au-NP-anti-FAM-FAM complex, Au-NP-anti-FAM and biotin in the reaction system. At the T line, streptavidin cannot capture the Au-NP-anti-FAM-FAM complex and Au-NP-anti-FAM, so no band appears at the T line, while the C line can be captured by goat anti-mouse IgG to form a band. In the negative sample, since there is no cleavage of the reporter DNA, the reaction system contains the Au-NP-anti-FAM-FAM-biotin complex and Au-NP-anti-FAM. When the reaction system flows to the T line, the Au-NP-anti-FAM-FAM-biotin complex is captured by streptavidin to form a band, while at the C line, the Au-NP-anti-FAM is captured by goat anti-mouse IgG to form a band.

[0060] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0061] In the present invention, chicken (Gallus Gallus), duck (Anas platyrhynchos), goose (Anser cygnoides), cattle (Bos taurus), pig (Sus scrofa), sheep (Ovis aries), horse (Equus caballus), rabbit (Oryctolagus cuniculus), donkey (Equus asinus) were purchased from Guangzhou farmers' market. Cat (Felis catus) and dog (Canis lupus familiaris) were provided by Guangzhou Pet Hospital.

[0062] The production processes, experimental methods or detection methods involved in the embodiments of the present invention, unless otherwise specified, are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, and are very clear and unambiguous in the relevant application fields. Technical personnel in the field can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0063] The various instruments, equipment, raw materials or reagents used in the embodiments of the present invention are not particularly limited in terms of their sources, and are all conventional products that can be purchased through regular commercial channels, or can be prepared according to conventional methods well known to those skilled in the art.

[0064] Example 1 Design of universal primers

[0065] Search NCBI for mitochondrial gene information on donkeys and ducks, download and save the target genome in ".FASTA" format. Analyze the mitochondrial gene information, perform sequence alignment using MegAlign, and finally select the 12s rDNA gene as the target gene sequence for RPA / CRISPR-Cas12a detection of duck and donkey-derived components.

[0066] The 12srDNA genes of 11 species of chicken (Gallus Gallus), duck (Anas platyrhynchos), goose (Anser cygnoides), cattle (Bos taurus), pig (Sus scrofa), sheep (Ovis aries), horse (Equus caballus), rabbit (Oryctolaguscuniculus), donkey (Equus asinus), cat (Felis catus), and dog (Canis lupus familiaris) were introduced into MegAlign for multiple sequence alignment, and sequences with interspecies conservation at both ends and species specificity in the middle were selected.

[0067] PrimerPremier5 software was used to design primers for amplification of the conserved regions at both ends of the 12S rDNA gene screening sequence on the above-mentioned meat mitochondria.

[0068] The universal primer sequences used to amplify species sequences are:

[0069] The upstream primer sequence was: 5′-AGGGTTGGTAAATCTCGTGCCAGCCACCG-3′;

[0070] The downstream primer sequence was: 5′TTTAGGGCCAGGCATAGTGGGGTATCTAATC-3′;

[0071] Oligo7 software and NCBI-Blast were used to verify the designed primers for amplifying the conserved regions at both ends of mitochondrial 12S rDNA.

[0072] 1. Primer structure analysis: reduce the formation of dimers between primers, △G should not exceed 4.8kcal / mol, 3-dimer should be <2; the number of combined base pairs should not exceed 3;

[0073] 2. Prevent the formation of hairpin structure (Hairpin) △G does not exceed 4.5kcal / mol (preferably <2), and the number of combined base pairs should not exceed 3;

[0074] 3. The GC content is generally between 40% and 60%, and the GC content of upstream and downstream primers cannot differ too much;

[0075] 4.Tm is generally between 59 and 68°C, which is similar between upstream and downstream. Tm of product is <94.

[0076] Example 2 Design of crRNA sequence

[0077] The crRNA sequence of Cas12a is composed of two parts: the repeat sequence (stem-loop structure) at the 5' end and the complementary sequence spacer of the target gene sequence at the 3' end.

[0078] Using the benchling platform constructed by Zhang Feng's team, we designed specific crRNA on the 12s rDNA screening gene sequence on duck or donkey mitochondria, with a PAM sequence (TTTV) upstream.

[0079] A fixed stem-loop structure sequence was added upstream of the designed crRNA: 5'-UAAUUUCUACUAAGUGUAGAU-3'.

[0080] The crRNA primers used to detect duck meat-derived ingredients are:

[0081] UAAUUUCUACUAAGUGUAGAU-GGUGCAUCUUGUGCUUGCGACA

[0082] The crRNA primers used to detect donkey meat-derived ingredients are:

[0083] UAAUUUCUACUAAGUGUAGAU-GUAUGGGUCUUUGACACGCU

[0084] Verify the specificity of the sequence: Input the designed duck and donkey PAM+spacer into NCBI-Blast, first match the target species duck and donkey and then match the non-target species, mainly looking at the matched identity. If the match is less than 18nt, the non-target species can be excluded. (At least three base mismatches with the non-target region are better).

[0085] Verify the stability of the sequence: input crRNA and its upstream stem-loop structure in the RNAWebSuite website to ensure that the stem-loop structure cannot be destroyed and the Spacer region is easy to open; detect the GC content of the crRNA sequence in the sg.idtdna website, preferably 40-60%, to ensure stability.

[0086] Example 3 Design of colloidal gold nucleic acid test strip

[0087] Sample pad

[0088] The conjugate pad contains a complex of colloidal gold nanoparticles (Au-NP) and fluorescein FAM-labeled antibody

[0089] T-wires coated with streptavidin for capturing biotinylated DNA

[0090] Line C is coated with goat anti-mouse IgG for capturing colloidal gold nanoparticles

[0091] The absorbent pad is used to draw fluid through the test strip.

[0092] Example 4 DNA extraction

[0093] Using the Kit Purification of Total DNA from Animal Tissues (Spin-Column Protocol) from Qiagen, add 180ul ATL and 20ul proteinase K to 0.025g tissue, mix well, lyse at 56°C, add 200ul AL and mix well, add 200ul ethanol and mix well.

[0094] Add all the mixed materials to the DNeasyMini spin column + 2ml collection tube, centrifuge at high speed for 1 minute, discard the liquid and collection tube, add a new 2ml collection tube, add 500ulAW1, centrifuge at high speed for 1 minute and then discard the liquid and collection tube, add a new 2ml collection tube, add 500ulAW2, centrifuge at high speed for 3 minutes and discard the liquid and collection tube. Add 200ulAE, incubate at room temperature for 1 minute, centrifuge at high speed for 1 minute, add a new 1.5ml centrifuge tube, add 200ulAE, incubate at room temperature for 1 minute, and obtain DNA extraction solution after high-speed centrifugation.

[0095] The OD260 / OD280 value of the DNA extract was measured by UV spectrophotometer and was 1.8-2.1.

[0096] Example 5 RPA reaction

[0097] For RPA reaction, operate the reagents on ice, mix and centrifuge before use. The amount of RPA system experimental reagents is as follows:

[0098] Table 1 RPA reaction system

[0099]

[0100] 10X Starter was added to the tube cap, and the above liquid was added to the recombinase, single-stranded DNA binding protein (SSB) and strand displacement DNA polymerase freeze-dried for the single-stranded nucleic acid (oligonucleotide primer) required for the RPA reaction. After rapid centrifugation, the tube was placed in a 39°C PCR instrument and reacted for 20 minutes. After 5 minutes, the 8-tube strip was taken out, completely inverted 8-10 times to mix, centrifuged briefly, and then placed back in the PCR instrument until the reaction was completed.

[0101] Example 6 CRISPR-Cas12a reaction

[0102] The RPA product (target) obtained in Example 1 was added to the CRISPR-Cas12a reaction system, and the amount of CRISPR-Cas12a reaction system experimental reagents was proportioned according to Table 2:

[0103] Table 2 CRISPR-Cas12a reaction system

[0104]

[0105]

[0106] The CRISPR-Cas12a system was thoroughly centrifuged and mixed. Placed on a PCR instrument, 45°C, and reacted for 10 minutes.

[0107] After the reaction, centrifuge thoroughly and combine with colloidal gold nucleic acid test strip detection: mix the detection diluent and the CRISPR-Cas12a system reaction product in a ratio of 10:1 and centrifuge, add more than 50 μL of the diluted reaction solution onto the sample pad and read the result within five minutes.

[0108] Example 7 Colloidal gold nucleic acid test paper result interpretation

[0109] Positive reaction: Cas12a will initiate transcriptional cleavage activity when detecting the target nucleotide amplified by RPA, and cleave the reporter labeled with FAM and biotin. As a CRISPR / Cas12a detection system, the sequence of the Cas12a cleavage substrate is TTATTT, with the 5' end labeled with modified fluorescent FAM and the 3' end labeled with biotin.

[0110] When Reporter is cleaved, FAM is separated from biotin, so there is a mixture of Au-NP-anti-FAM-FAM complex, Au-NP-anti-FAM and biotin in the reaction system. At the T line, streptavidin cannot capture the Au-NP-anti-FAM-FAM complex and Au-NP-anti-FAM, so no band appears at the T line, while the C line can be captured by goat anti-mouse IgG to form a band.

[0111] In the negative sample, since there is no cleavage of the reporter DNA, the reaction system contains Au-NP-anti-FAM-FAM-biotin complex and Au-NP-anti-FAM. When the reaction system flows to the T line, the Au-NP-anti-FAM-FAM-biotin complex is captured by streptavidin to form a band, while at the C line, the Au-NP-anti-FAM is captured by goat anti-mouse IgG to form a band.

[0112] (1) Interpretation of duck-derived results Figure 1-2 As shown:

[0113] The negative control (water) had C and T lines developed;

[0114] Negative control: Other samples (chicken, goose, cattle, pig, sheep, horse, rabbit, donkey, cat, dog) have C and T lines;

[0115] Positive result: duck-derived components only show color on the C line.

[0116] (2) Interpretation of donkey-derived results:

[0117] The negative control (water) had C and T lines developed;

[0118] Negative control: Other samples (chicken, duck, goose, cattle, pig, sheep, horse, rabbit, cat, dog) have C and T lines;

[0119] Positive result: Donkey-derived components only show color on the C line.

[0120] Therefore, it can be seen that duck-derived components and donkey-derived components can be specifically detected.

[0121] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A Cas12a-crRNA primer for detecting duck or donkey meat-derived components, characterized in that, The Cas12a-crRNA primer for detecting duck meat-derived components is shown in the sequence list SEQ ID NO.1; the Cas12a-crRNA primer for detecting donkey meat-derived components is shown in the sequence list SEQ ID NO.

2.

2. According to the Cas12a-crRNA primer described in claim 1, it is characterized in that, The Cas12a-crRNA primer can specifically recognize the DNA sequences of duck and donkey; the DNA of the duck is shown in the sequence list SEQ ID NO.5; the DNA of the donkey is shown in the sequence list SEQ ID NO.

6.

3. A primer set for isothermal RPA nucleic acid amplification of common poultry and livestock, characterized in that: It includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

4.

4. An RPA-CRISPR / Cas12a kit for detecting duck or donkey meat-derived ingredients, characterized in that: The kit comprises the Cas12a-crRNA primer according to claim 1 and the primer set according to claim 3.

5. the application of Cas12a-crRNA primer described in any one of claims 1-2 or primer described in claim 3 or kit described in claim 4 in detecting duck or donkey meat-derived components.

6. A method for detecting duck or donkey meat-derived ingredients, characterized in that: The specific steps include: S1, extracting DNA of the sample to be tested; S2, using the DNA obtained in step S1 as a template, and performing RPA nucleic acid isothermal amplification reaction using the RPA primers described in claim 3; S3, adding the amplified product to the CRISPR-Cas12a reaction system; the CRISPR-Cas12a detection system comprises the Cas12a-crRNA primer and reporter according to claim 1; S4. Determine whether the sample contains duck or donkey meat-derived ingredients by detecting the reporter.

7. The method according to claim 6, characterized in that: The CRISPR-Cas12a detection system in step S3 also includes the RPA reaction product of step S1 and the CRISPR / Cas12a protein, and the reporter sequence is TTATTT, the 5' end of the sequence is labeled with modified fluorescein FAM, and the 3' end is labeled with biotin Biotin.

8. The method according to claim 6, characterized in that: The RPA nucleic acid isothermal amplification reaction conditions in step S2 are constant temperature at 39° C. for 20 minutes, and then the reaction is terminated; the CRISPR-cas12a reaction conditions in step S3 are constant temperature at 45° C. for 10 minutes, and then the reaction is terminated.

9. The method according to claim 6, characterized in that: The method for detecting the reporter in step S4 can be colloidal gold nucleic acid test strip detection, and the colloidal gold nucleic acid test strip includes: a sample pad, a binding pad containing a complex of colloidal gold nanoparticles Au-NP-fluorescein FAM labeled antibody, a T line coated with streptavidin for capturing biotin, a C line coated with goat anti-mouse IgG for capturing colloidal gold nanoparticles, and an absorption pad for attracting liquid through the test strip.

10. The colloidal gold nucleic acid test strip according to claim 9, characterized in that: The test results are judged as follows: if the quality control C line has a band, but the test T line has no band, then the target gene is contained; if both the test T line and the quality control C line have red bands, then the target gene is not contained.

Images