Molecular marker of wheat stem rot disease-resistant site Qfcr.cau-1B and application thereof

Abstract

The invention discloses a molecular marker of a wheat stem rot disease-resistant site Qfcr.cau-1B and application of the molecular marker, and belongs to the technical field of molecular markers and plant genetic breeding. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, and T / A mutation exists at the 201st basic group of the sequence as shown in SEQ ID NO.1. A pair of STARP primer groups is designed for the molecular marker, and the primer groups can accurately detect the molecular marker. The molecular marker can be used for identifying the resistance of wheat to stem rot or screening varieties or strains which are resistant to and susceptible to wheat stem rot. The molecular marker provided by the invention can rapidly and accurately identify the resistance of wheat to FCR, and provides a very valuable molecular tool for screening wheat anti-FCR germplasm resources.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers and plant genetic breeding, in particular to a molecular marker of wheat base stem rot resistance site Qfcr.cau-1B and an application thereof. Background Art

[0002] Wheat crown rot (Fusarium crown rot, FCR) is a worldwide soil-borne wheat disease caused by Fusarium fungi. The disease can occur throughout the growth period of wheat. After infection, the leaf sheaths and stems at the base of the wheat stem turn brown, and part or all of the tissues necrotize, causing seedling death in the seedling stage or white ears in the adult stage, seriously reducing wheat yields.

[0003] Domestic and foreign research on wheat stem rot mainly focuses on the identification of resistance of different wheat varieties and the preliminary positioning of disease resistance genes. However, so far, no materials with high resistance to the disease have been found internationally, and only some CSCR6, 2-49, Sunco and other medium-resistant materials have been identified. These medium-resistant materials were used to construct populations such as recombinant inbred lines, and multiple QTLs controlling wheat stem rot resistance were found through QTL positioning analysis. For example, Ma et al. located the stem rot resistance QTL on chromosome 3BL using the "CSCR6 / Lang" population, which can explain up to 49% of the phenotypic variation. Martin et al. identified 13 different QTL loci in different sources of Sunco, 2-49, IRN497 and CPI1338144, among which the QTLs on 1AS, 1BS, 1DL and 4BS contributed by 2-49 and the QTL on 2BS contributed by Sunco were detected in multiple experiments.

[0004] Given that wheat base rot resistance is a quantitative trait controlled by multiple genes, the development of molecular markers is of great significance for screening base rot-resistant germplasm resources and promoting the improvement of base rot resistance. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker of wheat stem rot resistance locus Qfcr.cau-1B and its application to solve the problems existing in the above-mentioned prior art. The molecular marker provided by the present invention can quickly and accurately identify wheat resistance to FCR, providing a very valuable molecular tool for screening wheat FCR resistance germplasm resources.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides a molecular marker of wheat stem rot resistance site Qfcr.cau-1B, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a T / A mutation exists at the 201st base of the sequence shown in SEQ ID NO.1.

[0008] The present invention also provides a STARP primer set for detecting the molecular marker, the STARP primer set comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0009] The present invention also provides application of the STARP primer set in preparing a kit for detecting wheat base stem rot resistance.

[0010] The present invention also provides a kit for detecting wheat stem base rot resistance, comprising the STARP primer set.

[0011] The present invention also provides an application of the STARP primer set or the kit, which is used in any of the following applications:

[0012] (1) Identify wheat resistance to stem rot;

[0013] (2) Screening varieties or strains that are resistant or susceptible to wheat stem rot.

[0014] The present invention also provides a method for identifying wheat resistance to stem base rot, comprising the following steps:

[0015] Using the genomic DNA of the wheat sample to be tested as a template, using the STARP primer set or the kit to perform PCR amplification on the template, and using the amplification result to determine the resistance of the wheat to stem base rot;

[0016] If a band of 144 bp is detected in the amplification result, it is determined that the wheat to be tested is resistant to stem base rot;

[0017] If a band of 154 bp is detected in the amplification result, it is determined that the wheat to be tested is susceptible to stem base rot.

[0018] Optionally, the reaction system for the PCR amplification is: 1.0 μL 100 ng / μL DNA, 5 μL 2×Taq PCR StarMix, 1 μL mixed primers and 3 μL ddH2O.

[0019] Optionally, in the mixed primer, the volume ratio of the upstream primer F1, the upstream primer F2 and the downstream primer R is 1:1:2.

[0020] Optionally, the reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 5 min; stage one: denaturation at 94°C for 30 s; annealing at 65°C for 30 s, decreasing by 1°C in each cycle, and extension at 72°C for 30 s; a total of 10 cycles; stage two: denaturation at 94°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 30 s; a total of 25 cycles.

[0021] The present invention discloses the following technical effects:

[0022] The present invention uses a recombinant inbred line population derived from 20828 and SY95-71, and combines 55K chip data to study the genetic loci associated with FCR resistance in 20828, and finds a stable stem base rot resistance QTL on the short arm of wheat chromosome 1B. Further, a STARP molecular marker that can be used for large-scale material screening was developed for this locus, and the close correlation between the developed molecular marker and disease resistance was verified in a RIL population constructed from 20828 and BLS2 as parents. The STARP molecular marker can quickly and accurately identify wheat resistance to FCR, providing a very valuable molecular tool for screening wheat FCR-resistant germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 The severity of stem rot in wheat materials, the resistant parent is 20828, and the susceptible parent is SY95-71;

[0025] Figure 2 To map the FCR resistance distribution of populations for 20828 and SY95-71;

[0026] Figure 3 QTLs conferring FCR resistance in the 20828 / SY95-71 population, where: a: QTLs associated with FCR were located using genetic maps, LOD values ​​from each cM (x-axis) were plotted relative to chromosomes (y-axis), and the threshold LOD value used to indicate the presence of QTLs was indicated by a dotted line; b: Genetic map of chromosome 1B with SNP markers, the red area represents the genetic position of the QTL;

[0027] Figure 4 The typing results of STARP markers in 20828 and BLS2 recombinant inbred line populations;

[0028] Figure 5 Box plot showing the effect of QTL on FCR resistance in the recombinant populations of 20828 and BLS2, ** indicates a significant level of P < 0.01. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] The wheat lines 20828, SY95-71 and BLS2 used in the examples of the present invention were all provided by the Wheat Institute of Sichuan Agricultural University. Unless otherwise specified, other materials involved in the examples of the present application can be purchased through conventional commercial channels, and the experimental methods involved are all conventional experimental methods in the art.

[0035] Example

[0036] The inventors used two recombinant inbred line (RIL) populations constructed from wheat lines 20828, SY95-71 and BLS2 to study and verify the genetic loci associated with wheat stem base rot (FCR) resistance in 20828. The details are as follows:

[0037] 1. Phenotypic analysis of wheat stem rot

[0038] The wild-type strain of F. graminearum WZ2-8A was activated by PDA into a bacterial cake and inoculated into CMC liquid medium. The spore suspension was shaken at 25°C and 180 r / min for 4 days and filtered through 4 layers of gauze. The concentration of the spore suspension was adjusted to 1×10 6 / mL, and obtain a spore suspension. When the seed buds of the RIL population are about 0.5-1cm long, soak the seeds in a spore suspension (containing 0.1% Tween 20 by volume) for 1min. Transplant the seeds into 5×10 plug trays, 2 seeds per hole, and water from the bottom. The first soaking watering is then used, and watering is performed when it is dry (about 6-7 days) or severely dehydrated. The greenhouse temperature is 25℃ / 15℃, day / night. At the same time, inoculate the disease-resistant control material Sunco and the susceptible control Xinmai 26. When the control disease level is level 5 (about 42 days after transplanting), conduct a disease level survey on the base of the wheat stem according to Table 1. The disease index is calculated according to the formula disease index (%) = ∑ (disease level × number of plants at this level) / (total number of plants surveyed × highest disease level) × 100.

[0039] Table 1 Grading and evaluation criteria for wheat stem rot resistance

[0040]

[0041] The disease resistance levels of the F8 recombinant inbred lines of 20828 and SY95-71 were investigated. Figure 1 As shown in the figure, the susceptible parent SY95-71 had obvious brown lesions at the base of the stems. In contrast, the resistant parent 20828 had fewer brown lesions on the stems and the plants grew normally ( Figure 1 ), using Excel2013 for statistical analysis, the results showed that the group disease index was continuously distributed, conforming to the normal distribution, and was a typical quantitative trait ( Figure 2 ), the disease index ranged from 17.08 to 77.86. The broad heritability was 0.84, indicating that the population contained sufficient genetic variation (Table 2).

[0042] Table 2 Severity of Fusarium crown rot in 20828 and SY95-71 populations

[0043]

[0044] 2. QTL analysis and verification

[0045] The software QTL IciMapping was used to combine phenotypic data and molecular markers for QTL analysis, and a total of 5 QTLs were found to be significantly associated with FCR resistance, located on chromosomes 1B, 2B, 3A, 5A and 7D. Among them, the QTL located on chromosome 1B (Qfcr.cau-1B, within the 7.6Mb segment between 7.1-14.7Mb, located on the short arm of chromosome 1B, gene version IWGSC 1.1) was detected in all three experiments, explaining 28.33% of the phenotypic variation ( Figure 3 ).

[0046] Based on the molecular marker STARP-0405 (SEQ ID NO. 1) located on the short arm of chromosome 1B and significantly associated with stem base rot resistance, STARP-0405 primers were designed as follows:

[0047] Upstream primer F1: 5'-TAGCTCATGTGATTATTGTATTAAT-3' (SEQ ID NO. 2);

[0048] Upstream primer F2: 5'-ACGACTCAATTAGCTCATGTGATTATTGTATCGAA-3' (SEQ ID NO. 3);

[0049] Downstream primer R: 5'-ATCATGTCCATGTGTAATAGTGCTC-3' (SEQ ID NO. 4).

[0050] The bases in bold in the upstream primer are artificially designed SNP mutations, and the bases T (for SEQ ID NO. 2) and A (for SEQ ID NO. 3) at the 3' end are typing sites.

[0051] The sequence of molecular marker STARP-0405 is as follows:

[0052] ATGGCTAGTGCAACATTAATAGATCAGAGAGTATATATGTATATAAATTATGCAACAA

[0053] AGAACTCTTATGAATCCAAGAATAAAACATGTACAAATCTGACCATAAAAGTGAAAATTCT

[0054] TCACATTGCAACAAACACATCAAAAAAATTACATCGGATGAAGCCTAAGCATGTAGGGT

[0055] AGCTCATGTGATTATTGTATTGATGAAAATGTAGACATTGCCACCTAGCTGCACCTATGG

[0056] AACCATATATGTGGTAGCTCCAAAGGATGAAGCCTAAGCATGTAGGGTAGCTCCAAAGG

[0057] AGCACTATTACACATGGACATGATTGCAGCAAGGTTGATGTAGATGGTCGTAATGAAGGA

[0058] TCTCCCCTCTTAAAGAGTATCGAGGAAAATCATCCAGACTGGATC (SEQ ID NO.1). The bold mark is the SNP site, that is, the 201st base of the sequence shown in SEQ ID NO.1 is the SNP site, and its base is T or A.

[0059] The base of the disease-resistant parent 20828 at the above SNP site is T, and a 144bp band can be amplified; the base of the disease-susceptible parent BLS2 at the above SNP site is A, and a 154bp band can be amplified.

[0060] The molecular marker STARP-0405 was used to detect the distribution of wheat stem rot resistance in the F5 generation RIL population of 20828 and BLS2. The competitive primers F1, F2 and reverse primer R were prepared in a 1:1:2 (V / V / V) ratio. The PCR reaction system was 10 μL: template DNA (100 ng·μL -1 )1.0μL, 2×Taq PCR Star Mix (Genstar, Beijing)5μL, primer mixture1μL, ddH2O3μL. The reaction program of PCR amplification is: PCR amplification reaction program uses Touch down. Pre-denaturation 94℃5min. Stage 1: denaturation at 94℃ for 30s; annealing at 65℃ for 30s, 1℃ lowering for each cycle, extension at 72℃ for 30s; a total of 10 cycles. Stage 2: denaturation at 94℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 30s; a total of 25 cycles. The PCR products were further detected by polyacrylamide gel electrophoresis (PAGE).

[0061] STARP tagging is to artificially add fragments of different lengths to two competing primers. Due to different genotypes, the competing primers that can bind are different, so the lengths of the amplified fragments will be different. Genotyping can be completed based on the length difference. Figure 4As shown in the figure, if a 144bp band is detected, the wheat to be tested is judged to be resistant to stem base rot; if a 154bp band is detected, the wheat to be tested is judged to be susceptible to stem base rot. Therefore, the size of the band can be used to determine whether it is a disease-resistant genotype. In the F5 population of 20828 and BLS2, 38 of the above SNPs are homozygous for the 20828 allele (the mean disease index is 38.09), and 45 are homozygous for the BLS2 allele (the mean disease index is 44). The difference between the two groups is 13.42% ( Figure 5 ).

[0062] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker for wheat stem rot resistance locus Qfcr.cau-1B, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a T / A mutation at the 201st base of the sequence shown in SEQ ID NO.

1.

2. A STARP primer set for detecting the molecular marker according to claim 1, characterized in that: The STARP primer set includes an upstream primer F1 having a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 having a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R having a nucleotide sequence as shown in SEQ ID NO.

4.

3. Use of the STARP primer set as claimed in claim 2 in preparing a kit for detecting resistance to wheat stem rot.

4. A kit for detecting wheat stem rot resistance, characterized in that: Comprising the STARP primer set according to claim 2.

5. Use of the STARP primer set according to claim 2 or the kit according to claim 4, characterized in that: Used in any of the following applications: (1) Identify wheat resistance to stem rot; (2) Screening varieties or strains that are resistant or susceptible to wheat stem rot.

6. A method for identifying wheat resistance to stem rot, characterized in that: The steps include: Using the genomic DNA of the wheat sample to be tested as a template, using the STARP primer set described in claim 2 or the kit described in claim 4 to perform PCR amplification on the template, and using the amplification result to determine the resistance of the wheat to stem base rot; If a band of 144 bp is detected in the amplification result, it is determined that the wheat to be tested is resistant to stem base rot; If a band of 154 bp is detected in the amplification result, it is determined that the wheat to be tested is susceptible to stem base rot.

7. The method according to claim 6, characterized in that The reaction system for the PCR amplification was: 1.0 μL 100 ng / μL DNA, 5 μL 2×Taq PCR Star Mix, 1 μL mixed primers and 3 μL ddH2O.

8. The method according to claim 7, characterized in that In the mixed primer, the volume ratio of the upstream primer F1, the upstream primer F2 and the downstream primer R is 1:1:

2.

9. The method according to claim 6, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 5 min; stage one: denaturation at 94°C for 30 s; annealing at 65°C for 30 s, decreasing by 1°C in each cycle, and extension at 72°C for 30 s; a total of 10 cycles; stage two: denaturation at 94°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 30 s; a total of 25 cycles.

Images