Hexagonal fluorescence detection composition for detecting hand-foot-and-mouth disease pathogens

Abstract

The invention discloses a six-joint fluorescence detection composition for detecting hand-foot-and-mouth disease pathogens, and belongs to the technical field of microbiological detection. The technical problem to be solved by the invention is how to quickly identify the typing of the pathogenic virus of the hand-foot-and-mouth disease. Therefore, the invention provides the composition for detecting or assisting in detecting the pathogenic viruses of the hand-foot-and-mouth disease. The composition comprises primer probes for respectively amplifying and recognizing enterovirus 71, enterovirus EV, coxsackie virus A group 16, coxsackie virus A group 6, coxsackie virus A group 10 and coxsackie virus A group 4. The composition provided by the invention is suitable for nucleic acid detection of enteroviruses extracted from samples such as throat swabs, anus swabs, intravesicular exudate, excrement, cerebrospinal fluid, virus isolate and the like, and has relatively high sensitivity and specificity.

Description

Technical Field

[0001] The present application belongs to the technical field of microbial detection, and specifically relates to a composition for six-linked fluorescence detection for detecting pathogens of hand, foot and mouth disease. Background Art

[0002] Hand-foot-mouth disease (HFMD) is a common childhood infectious disease caused by a variety of human enteroviruses (EVs). It is characterized by fever, oral mucosal herpes or ulcers, and skin rashes on the hands, feet, buttocks, etc. Most children have a good prognosis and generally recover within 1 week without sequelae. A small number of children quickly develop the nervous system after the onset of the disease, manifested as brainstem encephalitis, encephalomyelitis, cerebrospinal meningitis, etc. The mortality rate of children who develop circulatory failure and neurogenic pulmonary edema is high. It is a legally reportable Class C infectious disease, and has ranked first in the incidence of legal infectious diseases in the country in the past five years. Current monitoring has found that 10 types of group A and 28 types of group B enterovirus can cause HFMD, among which EV-A71 and CVA16 are recognized as the main pathogens. In recent years, hand-foot-mouth disease caused by CVA6 has been on a large scale and has become the primary pathogen causing HFMD in most provinces and cities.

[0003] The incubation period of hand, foot and mouth disease is generally 3-7 days, and there are no obvious prodromal symptoms. Early diagnosis and early treatment are crucial. Traditional enterovirus testing includes virus isolation culture and serological diagnosis, but the operation is cumbersome and time-consuming, and the operation is cumbersome and has low sensitivity. With the rapid development of molecular biology technology, especially in recent years, fluorescent quantitative PCR technology has been widely used in the detection of pathogens. In addition to accurate quantification and rapid detection, the biggest advantage of this method is that it uses a completely closed tube test to avoid cross contamination, and is widely accepted in scientific research and clinical practice.

[0004] With the update of fluorescent quantitative PCR detection instruments and the development of dye science, different enterovirus genera can be detected with different fluorescently labeled specific probes. Using multiple reverse transcription fluorescent quantitative PCR (RT-qPCR) technology, the current hand, foot and mouth disease pathogens EV-A71, CVA16 and CVA6, EV, CVA10, and CVA4 can be detected simultaneously. According to the target region structural protein VP1 of the current enterovirus molecular typing, amplification detection is designed and performed, thereby realizing the simultaneous detection of the six most common pathogens of hand, foot and mouth disease. Summary of the invention

[0005] The technical problem to be solved by this application is: how to quickly identify the typing of the pathogenic virus of hand, foot and mouth disease.

[0006] In order to solve the above technical problems, the present application provides a composition for detecting or assisting in the detection of pathogenic viruses of hand, foot and mouth disease, the composition comprising primer probes for respectively amplifying and identifying enterovirus 71 (EV-A71), enterovirus EV, coxsackievirus A group 16 (CVA16), coxsackievirus A group 6 (CVA6), coxsackievirus A group 10 (CVA10), and coxsackievirus A group 4 (CVA4),

[0007] The primer probe for amplifying and identifying enterovirus 71 is composed of a primer for specifically amplifying an enterovirus 71 nucleic acid fragment containing a nucleotide sequence of positions 634-832 of SEQ ID No. 1 and a probe for specifically binding to the nucleic acid fragment containing a nucleotide sequence of positions 634-832 of SEQ ID No. 1.

[0008] The primer probe for amplifying and identifying enterovirus EV consists of a primer for specifically amplifying an enterovirus EV nucleic acid fragment containing a nucleotide sequence of positions 456-599 of SEQ ID No. 2 and a probe for specifically binding to a nucleic acid fragment containing a nucleotide sequence of positions 456-599 of SEQ ID No. 2.

[0009] The primer probe for amplifying and identifying Coxsackievirus A group 16 consists of a primer for specifically amplifying a nucleic acid fragment containing a nucleotide sequence of positions 573-779 of SEQ ID No. 3 and a probe for specifically binding to a nucleic acid fragment containing a nucleotide sequence of positions 573-779 of SEQ ID No. 3.

[0010] The primer probe for amplifying and identifying Coxsackievirus A group 6 consists of a primer for specifically amplifying a Coxsackievirus A group 6 nucleic acid fragment containing a nucleotide sequence of positions 524-746 of SEQ ID No. 4 and a probe for specifically binding to a nucleic acid fragment containing a nucleotide sequence of positions 524-746 of SEQ ID No. 4.

[0011] The primer probe for amplifying and identifying Coxsackievirus A group 10 is composed of a primer for specifically amplifying a Coxsackievirus A group 10 nucleic acid fragment containing a nucleotide sequence of positions 118-199 of SEQ ID No. 5 and a probe for specifically binding to a nucleic acid fragment containing a nucleotide sequence of positions 118-199 of SEQ ID No. 5.

[0012] The primer probe for amplifying and identifying Coxsackievirus A group 4 type consists of a primer for specifically amplifying a Coxsackievirus A group 4 type nucleic acid fragment containing a nucleotide sequence of positions 428-590 of SEQ ID No.6 and a probe for specifically binding to a nucleic acid fragment containing a nucleotide sequence of positions 428-590 of SEQ ID No.6.

[0013] Enterovirus EV (Enterovirus) includes poliovirus, Coxsackievirus, enterocytopathic human orphan virus (ECHO, also known as echovirus) and new enterovirus, totaling 71 serotypes.

[0014] In the present application, the primer probe for amplifying and identifying enterovirus EV can identify any one of the following enterovirus subtypes, including but not limited to: enterovirus 71 (EV-A71), coxsackievirus A group 16 (CVA16), coxsackievirus A group 6 (CVA6), coxsackievirus A group 10 (CVA10), coxsackievirus A group 4 (CVA4), coxsackievirus A group 5 (CVA5), coxsackievirus A group 7 (CVA7), coxsackievirus A group 12 (CVA12), Coxsackievirus A type 14 (CVA14), Coxsackievirus B type 3 (CVB3), Coxsackievirus B type 4 (CVB4), Coxsackievirus B type 5 (CVB5), Echovirus type 6 (E6), Echovirus type 11 (E11), Echovirus type 30 (E30), Enterovirus C type 96 (EV-C96), Enterovirus C type 99 (EV-C99), Poliovirus vaccine strain type 1 (Sabin1), and Poliovirus vaccine strain type III (Sabin3).

[0015] Further, in the composition, the primer probe for amplifying and identifying enterovirus 71 includes primers EV-A71-S and EV-A71-A, and probe EV-A71-Probe; the primer probe for amplifying and identifying enterovirus EV includes primers EV-S and EV-A, and probe EV-Probe; the primer probe for amplifying and identifying coxsackievirus A group 16 includes primers CVA16-S and CVA16-A, and probe CVA16-Probe; the primer probe for amplifying and identifying coxsackievirus A group 6 includes primers CVA6-S and CVA6-A, and probe CVA6-Probe; the primer probe for amplifying and identifying coxsackievirus A group 10 includes primers CVA10-S and CVA10-A, and probe CVA10-Probe; the primer probe for amplifying and identifying coxsackievirus A group 4 includes primers CVA4-S and CVA4-A, and probe CVA4-Probe;

[0016] The EV-A71-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 7;

[0017] The EV-A71-A is a single-stranded DNA with a nucleotide sequence of SEQ ID No. 8;

[0018] The nucleotide sequence of the EV-A71-Probe is SEQ ID No. 9;

[0019] The EV-S is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 10;

[0020] The EV-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 11;

[0021] The nucleotide sequence of the EV-Probe is SEQ ID No. 12;

[0022] The CVA16-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 13;

[0023] The CVA16-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 14;

[0024] The nucleotide sequence of the CVA16-Probe is SEQ ID No. 15;

[0025] The CVA6-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 16;

[0026] The CVA6-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 17;

[0027] The nucleotide sequence of the CVA6-Probe is SEQ ID No. 18;

[0028] The CVA10-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 19;

[0029] The CVA10-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 20;

[0030] The nucleotide sequence of the CVA10-Probe is SEQ ID No. 21;

[0031] The CVA4-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 22;

[0032] The CVA4-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 23;

[0033] The nucleotide sequence of the CVA4-Probe is SEQ ID No.24.

[0034] The composition provided in the present application, on the one hand, provides universal primer probes for enterovirus EV (primers EV-S and EV-A, probe EV-Probe), and also provides primer probes for the five most common enterovirus subtypes: enterovirus 71 (EV-A71), enterovirus EV, coxsackievirus group A type 16 (CVA16), coxsackievirus group A type 6 (CVA6), coxsackievirus group A type 10 (CVA10), and coxsackievirus group A type 4 (CVA4).

[0035] The detection results of primers EV-S and EV-A and probe EV-Probe can be used to determine whether the sample to be tested contains enterovirus and / or whether the microorganism to be tested is or contains enterovirus.

[0036] Furthermore, primer probes for enterovirus 71 (EV-A71), enterovirus EV, coxsackievirus group A type 16 (CVA16), coxsackievirus group A type 6 (CVA6), coxsackievirus group A type 10 (CVA10), and coxsackievirus group A type 4 (CVA4) can clarify whether the sample to be tested contains enterovirus and whether it belongs to the above five enterovirus subtypes or whether the microorganism to be tested is or contains enterovirus serotypes belonging to the above five types.

[0037] Furthermore, the composition also includes a primer pair and a probe for amplifying an internal reference gene, wherein the primer probe for amplifying and identifying the internal reference gene includes primers globin-S and globin-A, and a probe globin-Probe.

[0038] The globin-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 25;

[0039] The globin-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 26;

[0040] The nucleotide sequence of the globin-Probe is SEQ ID No.27.

[0041] Furthermore, in the composition, the molar ratio of the EV-A71-S, EV-A71-A and EV-A71-Probe is 2:2:1, the molar ratio of the EV-S, EV-A and EV-Probe is 2:2:1, the molar ratio of the CVA16-S, CVA16-A and CVA16-Probe is 2:2:1, the molar ratio of the CVA6-S, CVA6-A and CVA6-Probe is 2:2:1, the molar ratio of the CVA10-S, CVA10-A and CVA10-Probe is 2:2:1, the molar ratio of the CVA4-S, CVA4-A and CVA4-Probe is 2:2:1, and the molar ratio of the globin-S, globin-A and globin-Probe is 2:2:1.

[0042] Furthermore, the composition also includes a positive plasmid.

[0043] Furthermore, the composition also includes a reagent for reverse transcribing viral genomic RNA into DNA.

[0044] Furthermore, the reagent may be a mixed enzyme solution, which includes a thermostable Taq DNA polymerase, an RNase inhibitor and a reverse transcriptase.

[0045] In some embodiments of the present application, the reagent for reverse transcribing the viral genomic RNA into DNA is Takara One Step PrimeScript RT-PCR Kit (Cat. No. RR064A).

[0046] Probe EV-A71-Probe, probe CVA16-Probe, probe CVA6-Probe, probe EV-Probe, probe CVA10-Probe, probe CVA4-Probe or probe globin-Probe has a fluorescent group added to the 5' end of the above nucleotide sequence and a quenching group at the 3' end. The fluorescent group can be selected from but not limited to FAM (5 / 6-carboxyfluorescein), VIC, TET (tetrachloro-6-carboxyfluorescein), JOE (2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein), HEX (hexachloro-6-methylfluorescein), CY3, TAMRA (6-carboxytetramethylrhodamine), ROX (carboxy-X-rhodamine), Texas Red, LC RED640, CY5 (cyanine fuel), LC RED705, FITC (fluorescein isothiocyanate) and other common fluorescent groups. The quenching group can be selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, MGB, and Dabcy1.

[0047] The present application also provides the use of the composition in any of the following:

[0048] A1), detecting or assisting in detecting a microorganism, wherein the microorganism is or contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4;

[0049] A2), detecting or assisting in detecting whether the sample to be tested contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4;

[0050] A3), preparing a product for detecting or assisting in detecting a microorganism, wherein the microorganism is or contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4;

[0051] A4), prepare products for detecting or assisting in detecting whether a sample to be tested contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4.

[0052] The present application also provides a kit, which contains any of the above-mentioned compositions.

[0053] Furthermore, the kit also includes a reagent for reverse transcribing viral genomic RNA into DNA.

[0054] Furthermore, the kit is used to detect or assist in the detection of enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4.

[0055] The present application also provides the use of the kit in any of the following:

[0056] A1), detecting or assisting in detecting a microorganism, wherein the microorganism is or contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4;

[0057] A2), detecting or assisting in detecting whether the sample to be tested contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4.

[0058] The present application also provides a method, which includes any of the following:

[0059] B1), the method comprises using any of the above-mentioned compositions or the above-mentioned kits to perform RT-PCR detection on the microorganism to be detected, and judging or assisting in judging whether the microorganism to be detected is or contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4 according to the RT-PCR detection results;

[0060] B2), the method comprises using any of the above-mentioned compositions or the above-mentioned kits to perform RT-PCR detection on the sample to be tested, and judging or assisting in judging whether the sample to be tested contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4 according to the RT-PCR detection results.

[0061] The sample to be tested may be a pharyngeal swab, anal swab, blister exudate, feces, cerebrospinal fluid, microorganism, environmental sample (such as air) and / or food (such as frozen food or fresh food). The sample to be tested may also be a nucleic acid extracted from the following substances: a pharyngeal swab, anal swab, blister exudate, feces, cerebrospinal fluid, microorganism, environmental sample (such as air) and / or food (such as frozen food or fresh food).

[0062] The above application or method may be a non-disease diagnosis application or method. The above application or method may not be directly intended to obtain disease diagnosis results or health conditions of living human or animal bodies.

[0063] The microorganisms described in A1) and B1) may be microorganisms from non-living human or animal bodies, such as microorganisms from the environment (such as air), or microorganisms from food (such as frozen food or fresh food).

[0064] The sample to be tested in A2) and B2) may be a sample from a non-living human or animal body, such as an environmental sample (such as air) or a food (such as frozen food or fresh food). The sample to be tested in A2) and B2) may also be a nucleic acid extracted from a sample from a non-living human or animal body.

[0065] In some embodiments of the present application, the sample to be tested is a stool sample.

[0066] Compared with the prior art, the beneficial technical effects of this application are as follows:

[0067] The present application provides an efficient and convenient primer-probe combination for detecting and / or typing pathogenic enteroviruses, wherein the primer-probe combination includes primers EV-S and EV-A and probe EV-Probe that can identify all enterovirus subtypes, and primer probes that can respectively identify enterovirus type 71, coxsackievirus group A type 16, coxsackievirus group A type 6, coxsackievirus group A type 10 and / or coxsackievirus group A type 4.

[0068] The primer-probe combination provided in the present application can be used to detect and / or identify five enterovirus subtypes in one operation, providing a more convenient and efficient detection reagent and detection method for the detection, identification and / or auxiliary identification of viruses.

[0069] The detection sensitivity of the kit of the primer-probe group designed by the present invention can reach 0.5 copies / μL, and it has the advantages of high sensitivity and strong specificity, and is not interfered by other microorganisms. Pathogenic microorganisms in cross-interference experiments such as influenza A virus, parainfluenza virus, influenza B virus, adenovirus, human coronavirus and respiratory syncytial virus have not been detected to bind to the primers and probes, indicating that the primers and probes have good specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 Schematic diagram of the sensitivity test results of the kit for simultaneous detection of EV-A71, CVA16 and CVA6.

[0071] Figure 2 Schematic diagram of the sensitivity test results of the kit for simultaneous detection of EV, CVA10 and CVA4. DETAILED DESCRIPTION

[0072] At present, the detection of enterovirus-related hand, foot and mouth disease is mainly a single-channel (such as enterovirus universal or EV-A71 single channel) or a three-channel (enterovirus universal, EV-A71 and CVA16) detection test kit in other forms. However, in recent years, with the listing and use of EV-A71 inactivated vaccine and the monitoring data of the pathogen spectrum of hand, foot and mouth disease, it is shown that in my country, CVA16 and CVA6 have become the main pathogens of hand, foot and mouth disease in many provinces and surpass EV-A71. Therefore, in order to adapt to the monitoring of the pathogen spectrum of hand, foot and mouth disease under the new situation, the purpose of this application is to provide an enterovirus six-link real-time fluorescence quantitative RT-PCR detection kit (including internal reference genes). The primer probe combination provided by this application can be used to detect and / or identify 5 enterovirus subtypes in one operation, providing a more convenient and efficient detection reagent and detection method for the detection, identification and / or auxiliary identification of viruses.

[0073] The present application is further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present application, not for limiting the scope of the present application. The examples provided below can be used as a guide for further improvements by ordinary technicians in the technical field, and do not constitute a limitation of the present application in any way.

[0074] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0075] The strains used in this application are all owned by the applicant. The public can obtain the biological materials from the applicant in accordance with the relevant national biosafety regulations. The biological materials obtained are only used to repeat the experiments of the present invention and cannot be used for other purposes. The specific strains and information are as follows:

[0076] (1) In the present application, the enterovirus 71 (EV-A71) is the enterovirus 71 isolate SD / WF305, which is disclosed in the document “Genomic Epidemiology and Phylodynamic Analysis of Enterovirus A71 Reveal Its Transmission Dynamics in Asia. Microbiol Spectr. 2022 Oct 26; 10(5): e0195822.doi:10.1128 / spectrum.01958-22.” For the sake of simplicity, EV-A71 is used in the present application;

[0077] (2) In the present application, the coxsackievirus A16 (CVA16) is the coxsackievirus A16 isolate SD16-101 / SD / East / CHN / 2016-07-22, which is disclosed in the document “.Virus Evol. 2020Nov 9; 6(2):veaa084.Genomic epidemiology of coxsackievirus A16 in mainland of China, 2000-18”. For the sake of simplicity, CVA16 is used in the present application;

[0078] (3) In the present application, the coxsackievirus group A type 6 (CVA6) is the coxsackievirus group A type 6 isolate J / 31 / LN / CHN / 2016, which is disclosed in the document “Virus Evol. 2020 Jul 8; 6(2): veaa048. Genetic recombination in fast-spreading coxsackievirus A6 variants: a potential role in evolution and pathogenicity.” For the sake of simplicity, CVA6 is used in the present application;

[0079] (4) In the present application, the Coxsackievirus A10 (CVA10) is the Coxsackievirus A10 isolate AH16-26 / AH / CHN / 2016, which is disclosed in GenBank: MG838781.1 (VRL 18-SEP-2018) and the document "SciRep. 2018Sep 6; 8(1): 13357.doi: 10.1038 / s41598-018-31616-x. The emerging sub-genotype C2 of Coxsackievirus A10 Associated with Hand, Foot and Mouth Disease extensively circulating in mainland of China." For the sake of simplicity, CVA10 is used in the present application;

[0080] (5) In the present application, the Coxsackievirus Group A 4 (CVA4) is the Coxsackievirus Group A 4 isolate 16-5-HuN-CHN-2016, which is disclosed in GenBank: MK391073.1 (VRL 31-DEC-2021) and the document “Sci Rep. 2019 Sep 20; 9 (1): 13668. Emerging recombination of the C2 sub-genotype of HFMD-associated CV-A4 is persistently and extensively circulating in China.” For the sake of simplicity, CVA4 is used in the present application;

[0081] (6) In the present application, the Coxsackievirus A group 5 (CVA5) is the Coxsackievirus A group 5 isolate C68-YN-CHN-2018, which is publicly recorded in GenBank: LC481443 (VRL 21-MAY-2019). For the sake of simplicity, CVA5 is used in the present application;

[0082] (7) In the present application, the Coxsackievirus A8 (CVA8) is the Coxsackievirus A8 isolate JX-17-97, which is disclosed in GenBank: MT648788 and the document “Viruses. 2020 Sep 23; 12 (10): 1061. Genetic Diversity Analysis of Coxsackievirus A8 Circulating in China and Worldwide Reveals a Highly Divergent Genotype.” For the sake of simplicity, CVA8 is used in the present application;

[0083] (8) In the present application, the Coxsackievirus A group 12 (CVA12) is the Coxsackievirus A group 12 isolate CHN_HN_2019_214, which is disclosed in GenBank: ON755036 and the document “Front Microbiol. 2022Dec 21:13:988538.Genetic characterization and molecular epidemiology of CoxsackievirusA12 from mainland China during 2010-2019.” For the sake of simplicity, CVA12 is used in the present application;

[0084] (9) In the present application, the Coxsackievirus A14 (CVA14) is the Coxsackievirus A14 isolate CHN_2013_LN_05 (data center number of the National Center for Microbiological Sciences of China: NMDCN0002PH0), which is disclosed in the document “Viruses. 2023Nov26; 15(12):2323.Molecular Epidemiology and Evolution of Coxsackievirus A14.” For the sake of simplicity, CVA14 is used in the present application;

[0085] (10) In the present application, the coxsackievirus group B type 3 (CVB3) is the coxsackievirus group B type 3 isolate SJZK12-0052F / HeB / CHN / 2012, which is disclosed in GenBank: KF246658 (VRL 13-JAN-2014) and the document "PLoS One.2014Jan2;9(1):e84233.doi:10.1371 / journal.pone.0084233.eCollection2014.Prevalence of multiple enteroviruses associated with hand, foot, and mouthdisease in Shijiazhuang City,Hebei province,China:outbreaks ofcoxsackieviruses a10 and b3." For the sake of simplicity, CVB3 is used in the present application;

[0086] (11) In the present application, the Coxsackievirus B group 4 (CVB4) is Coxsackievirus B group 4 isolate 0316 / TJ / CHN / 2019, which is disclosed in GenBank: MZ161144 (VRL 17-SEP-2022). For the sake of simplicity, CVB4 is used in the present application;

[0087] (12) In the present application, the Coxsackievirus B group 5 (CVB5) is Coxsackievirus B group 5 isolate 10081 / HuN / CHN / 2010, which is disclosed in GenBank: OP672300 (25-JAN-2023) and the document "Viruses. 2022 Nov 30; 14(12): 2693. Molecular Epidemiology Reveals the Co-Circulation of Two Genotypes of Coxsackievirus B5 in China." For the sake of simplicity, CVB5 is used in the present application;

[0088] (13) In the present application, the echovirus type 6 (E6) is the echovirus type 6 isolate GX18-350, which is disclosed in GenBank: MT108421 (VRL 22-DEC-2020) and the document "Arch Virol. 2021May; 166(5): 1305-1312. Molecular epidemiological characteristics of echovirus 6 in mainland China: extensive circulation of genotype F from 2007 to 2018". For the sake of simplicity, E6 is used in this application.

[0089] (14) In the present application, the echovirus type 11 (E11) is the echovirus type 11 isolate Gansu2016-277_CHN, which is disclosed in the National Data Center for Microbiological Sciences of China No. NMDCN0002PLR and the document "Emerg Microbes Infect. 2024Dec; 13(1): 2361814. Genetic variation and evolutionary characteristics of Echovirus 11: new variant within genotype D5 associated with neonatal death found in China." For the sake of simplicity, it is represented by E11 in the present application;

[0090] (15) In the present application, the echovirus 30 (E30) is the echovirus 30 isolate TL10C / NM / CHN / 2016, which is owned by the applicant and disclosed in GenBank No.: MW080371 (20-JAN-2021) and the document "Virol J. 2021Jun 6; 18(1): 118. Temporal phylogeny and molecular characterization of echovirus30associated with aseptic meningitis outbreaks in China." For the sake of simplicity, it is represented by E30 in the present application;

[0091] (16) In the present application, the enterovirus C group 96 (EV-C96) is the enterovirus C group 96 isolate XZ94-XZ-CHN-2012, which is owned by the applicant and disclosed in GenBank: KP984754 (VRL 08-SEP-2015) and the document "J Med Virol. 2023 Dec; 95 (12): e29289. Characterizing enterovirus C96 genome and phylodynamics analysis." For the sake of simplicity, it is represented by EV-C96 in the present application;

[0092] (17) In the present application, the enterovirus C group 99 (EV-C99) is the enterovirus C group 99 isolate HT-XEBGH09F_XJ_CHN_2011, which is owned by the applicant and disclosed in the document "J Med Virol. 2024Feb; 96(2):e29449. Genetic characterization and molecular epidemiological analysis of enterovirus C99 in China." For the sake of simplicity, it is represented by EV-C99 in the present application;

[0093] (18) In the present application, the poliovirus sabin1 (sabin1) is owned by the applicant and is disclosed in GenBank: AY082688 (VRL 24-JUL-2016). For the sake of simplicity, it is represented by sabin1 in the present application;

[0094] (19) In the present application, the poliovirus sabin3 (sabin3) is owned by the applicant and is disclosed in GeneBank No. AY184221 (VRL 16-DEC-2002). For the sake of simplicity, it is represented by sabin1 in the present application.

[0095] Enterovirus 71 EV-A71, Coxsackievirus A group 16 type CVA16, Coxsackievirus A group 6 type CVA6, Coxsackievirus A group 10 type CVA10, Coxsackievirus A group 4 type CVA4, Coxsackievirus A group 5 type CVA5, Coxsackievirus A group 8 type CVA8, Coxsackievirus A group 12 type CVA12, Coxsackievirus A group 14 type CVA14, Coxsackievirus B group 3 type CVB3, Coxsackievirus B group 4 type CVB4, Coxsackievirus B group 5 type CVB5, Echovirus 6 type E6, Echovirus 11 type E11, Echovirus 30 type E30, Enterovirus C EV-C96 of type 96, EV-C99 of type 99 of enterovirus group C, poliovirus sabin1, poliovirus sabin3, influenza A(H1N1), influenza A(H3N2), influenza B, human coronavirus 229E, human coronavirus OC43, human coronavirus NL63, human coronavirus HKU1, respiratory syncytial virus RSV, human parainfluenza virus HPIV1, human parainfluenza virus HPIV2, human parainfluenza virus HPIV3, and human adenovirus HadV were derived from the 2023 enterovirus etiology surveillance project for healthy children with poliomyelitis in Tibet Autonomous Region;

[0096] Influenza A(H1N1) virus, influenza A(H3N2) virus, influenza B virus, human coronavirus 229E, human coronavirus OC43, human coronavirus NL63, human coronavirus HKU1, respiratory syncytial virus RSV, human parainfluenza virus HPIV1, human parainfluenza virus HPIV2, human parainfluenza virus HPIV3, human adenovirus HAdV are from the respiratory virus monitoring project of non-statutory infectious diseases; disclosed in the document "Etiological and epidemiological features of acute respiratory infections in China. Nature Communications (2021) 12: 5026 https: / / doi.org / 10.1038 / s41467-021-25120-6 www.nature.com / naturecommunications".

[0097] pGEM-T Easy Vector is a product of Promega, and the product number is A1360.

[0098] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0099] In the following examples and sequence listings, the meanings of the characters in the nucleotide sequences are as shown in Table 1

[0100] Table 1 Symbols and their definitions in nucleic acid sequences

[0101]

[0102]

[0103] Example 1: Development of a composition for detecting common pathogenic viruses of hand, foot and mouth disease

[0104] 1. Target sequence selection

[0105] The sequences of the structural protein VP1 region of enterovirus 71 (EV-A71), coxsackievirus A group 16 (CVA16), coxsackievirus A group 6 (CVA6), coxsackievirus A group 10 (CVA10), and coxsackievirus A group 4 (CVA4), and the 5'UTR region of enterovirus EV were obtained from the Genbank database. After analysis, the specific recognition fragments of enterovirus 71, CVA16 and CVA6, CVA10, CVA4, and enterovirus EV were screened and obtained as target sequences.

[0106] The names and sequences of each target sequence are as follows: The specific recognition fragment screened out by enterovirus 71 (EV-A71) is an RNA fragment whose nucleotide sequence is shown in SEQ ID NO.1. The specific recognition fragment screened out by coxsackievirus A group 16 (CVA16) is an RNA fragment whose nucleotide sequence is shown in SEQ ID NO.2. The specific recognition fragment screened out by coxsackievirus A group 6 (CVA6) is an RNA fragment whose nucleotide sequence is shown in SEQ ID NO.3. The specific recognition fragment screened out by coxsackievirus A group 10 (CVA10) is an RNA fragment whose nucleotide sequence is shown in SEQ ID NO.4. The specific recognition fragment screened out by coxsackievirus A group 4 (CVA4) is an RNA fragment whose nucleotide sequence is shown in SEQ ID NO.5. The specific recognition fragment screened out by enterovirus EV is an RNA fragment whose nucleotide sequence is shown in SEQ ID NO.6.

[0107] Table 2 Specific target sequences

[0108]

[0109]

[0110]

[0111] 2. Construction of positive plasmid

[0112] The DNA molecules corresponding to the above target sequences were synthesized and constructed into the EcoR I restriction site of the backbone vector pGEM-T Easy Vector, and the other nucleotides of the backbone vector were kept unchanged to obtain the recombinant positive plasmids. The 6 plasmids cloned the 5-terminal non-coding region of EV or the VP1 region sequence of EV-A71, CVA16, CVA6, CVA10 and CVA4 respectively. The names and structures of the obtained recombinant positive plasmids are as follows:

[0113] pGEM-T-EV-A71-VP1, whose structure is to insert the DNA molecule with the nucleotide sequence of SEQ ID NO.1 between the EcoR I restriction sites of the backbone vector pGEM-TEasy Vector, and keep the other nucleotides of the backbone vector unchanged to obtain a recombinant positive plasmid;

[0114] pGEM-T-CVA16-VP1, whose structure is to insert the DNA molecule with the nucleotide sequence of SEQ ID NO.2 between the EcoR I restriction sites of the backbone vector pGEM-TEasy Vector, and keep the other nucleotides of the backbone vector unchanged to obtain a recombinant positive plasmid;

[0115] pGEM-T-CVA6-VP1, whose structure is to insert the DNA molecule with the nucleotide sequence of SEQ ID NO.3 between the EcoR I restriction sites of the backbone vector pGEM-TEasy Vector, and keep the other nucleotides of the backbone vector unchanged to obtain a recombinant positive plasmid;

[0116] pGEM-T-CVA10-VP1, whose structure is to insert the DNA molecule with the nucleotide sequence of SEQ ID NO.4 between the EcoR I restriction sites of the backbone vector pGEM-TEasy Vector, and keep the other nucleotides of the backbone vector unchanged to obtain a recombinant positive plasmid;

[0117] pGEM-T-CVA4-VP1, whose structure is to insert the DNA molecule with the nucleotide sequence of SEQ ID NO.5 between the EcoR I restriction sites of the backbone vector pGEM-TEasy Vector, and keep the other nucleotides of the backbone vector unchanged to obtain the recombinant positive plasmid;

[0118] pGEM-T-EV-5UTR has a structure in which a DNA molecule having a nucleotide sequence of SEQ ID NO.6 is inserted between the EcoR I restriction sites of the backbone vector pGEM-T Easy Vector, and other nucleotides of the backbone vector are kept unchanged to obtain a recombinant positive plasmid.

[0119] 3. Primer Pairs and Probe Combinations

[0120] The primer pairs and probe compositions provided according to the obtained target sequences include the following 6 types (1) to (6):

[0121] (1) Primer pairs and probes for specific amplification and identification of human enterovirus 71

[0122] The primer pair for specific amplification of human enterovirus 71 is EV-A71-S and EV-A71-A, and the probe for specific recognition of the amplified products of EV-A71-S and EV-A71-A is EV-A71-Probe. The nucleotide sequences of the primer pair EV-A71-S and EV-A71-A and the probe EV-A71-Probe are as follows (5' to 3'):

[0123] EV-A71-S: GGAGAACACAAACAGGAGAA (SEQ ID No. 7);

[0124] EV-A71-A: TTGGGTTGGCTTTGAATAGG (SEQ ID No. 8);

[0125] EV-A71-Probe: (FAM)CTAATAACATGATGGGCACG(BHQ1)(SEQ ID No. 9).

[0126] “(FAM)” indicates that the fluorescent group FAM is connected to the first nucleotide C of SEQ ID No.9, and “(BHQ1)” indicates that the quenching group BHQ1 is connected to the last nucleotide G of SEQ ID No.9.

[0127] (2) Primer pairs and probes for specific amplification and identification of Coxsackievirus A group 16

[0128] The primer pair for specific amplification of Coxsackievirus group A type 16 is CVA16-S and CVA16-A, and the probe for specific recognition of the amplified products of CVA16-S and CVA16-A is CVA16-Probe. The nucleotide sequences of the primer pair CVA16-S and CVA16-A and the probe CVA16-Probe are as follows (5' to 3'):

[0129] CVA16-S: AGTCCCCTTCATGTCACCAG (SEQ ID No. 10);

[0130] CVA16-A: GCCCTGACTGTTTGATTCT (SEQ ID No. 11);

[0131] CVA16-Probe: (VIC)CACCTCCAAGCAAATGACCT(BHQ1)(SEQ ID No. 12).

[0132] “(VIC)” indicates that the fluorescent group VIC is connected to the first nucleotide C of SEQ ID No.12, and “(BHQ1)” indicates that the quenching group BHQ1 is connected to the last nucleotide T of SEQ ID No.12.

[0133] (3) Primer pairs and probes for specific amplification and identification of Coxsackievirus group A type 6

[0134] The primer pair for specific amplification of Coxsackievirus group A type 6 is CVA6-S and CVA6-A, and the probe for specific recognition of the amplified products of CVA6-S and CVA6-A is CVA6-Probe. The nucleotide sequences of the primer pair CVA6-S and CVA6-A and the probe CVA6-Probe are as follows (5' to 3'):

[0135] CVA6-S: TCGCAAAATTGAGCGATCCA (SEQ ID No. 13);

[0136] CVA6-A: CTCATGTACACCCGAACGTG (SEQ ID No. 14);

[0137] CVA6-Probe: (CY5)ATTTTGCCATCCGAACAGTC(BHQ3)(SEQ ID No. 15).

[0138] “(CY5)” indicates that the fluorescent group CY5 (cyanine dye) is connected to the first nucleotide A of SEQ ID No.15, and “(BHQ3)” indicates that the quenching group BHQ3 is connected to the last nucleotide C of SEQ ID No.15.

[0139] (4) Primer pairs and probes for specific amplification and identification of human enterovirus EV

[0140] The primer pair for specific amplification of human enterovirus EV is EV-S and EV-A, and the probe for specific recognition of EV-S and EV-A amplification products is EV-Probe. The nucleotide sequences of the primer pair EV-S and EV-A and the probe EV-Probe are as follows (5' to 3'):

[0141] EV-S: CCTGAATGCGGCTAATCC (SEQ ID No. 16);

[0142] EV-A: TTGTCACCATWAGCAGYCA (SEQ ID No. 17);

[0143] EV-Probe: (FAM)CCGACTACTTTGGGWGTCCGTGT(BHQ1)(SEQ ID No. 18).

[0144] “(FAM)” indicates that the fluorescent group FAM is connected to the first nucleotide C of SEQ ID No.18, and “(BHQ1)” indicates that the quenching group BHQ1 is connected to the last nucleotide T of SEQ ID No.18.

[0145] Enterovirus EV (Enterovirus) includes poliovirus, Coxsackievirus, enterocytopathic human orphan virus (ECHO, also known as echovirus) and new enterovirus, totaling 71 serotypes.

[0146] The primer probe for amplifying and identifying enterovirus EV can identify any of the following enterovirus subtypes, including but not limited to: enterovirus 71 (EV-A71), coxsackievirus A group 16 (CVA16), coxsackievirus A group 6 (CVA6), coxsackievirus A group 10 (CVA10), coxsackievirus A group 4 (CVA4), coxsackievirus A group 5 (CVA5), coxsackievirus A group 7

[0147] (CVA7), Coxsackievirus A type 12 (CVA12), Coxsackievirus A type 14 (CVA14), Coxsackievirus B type 3 (CVB3), Coxsackievirus B type 4 (CVB4), Coxsackievirus B type 5 (CVB5), Echovirus type 6 (E6), Echovirus type 11 (E11), Echovirus type 30 (E30), Enterovirus C type 96 (EV-C96), Enterovirus C type 99 (EV-C99), Poliovirus vaccine strain type I (Sabin1), and Poliovirus vaccine strain type III (Sabin3).

[0148] (5) Primer pairs and probes for specific amplification and identification of Coxsackievirus A group 10

[0149] The primer pair for specific amplification of Coxsackievirus A group 10 is CVA10-S and CVA10-A, and the probe for specific recognition of the amplified products of CVA10-S and CVA10-A is CVA10-Probe. The nucleotide sequences of the primer pair CVA10-S and CVA10-A and the probe CVA10-Probe are as follows (5' to 3'):

[0150] CVA10-S: GAGACTGGACGYGTRCCA (SEQ ID No. 19);

[0151] CVA10-A: GGGTCTCAATCATGTTCTCATCTG (SEQ ID No. 20);

[0152] CVA10-Probe: (VIC)CAGAGACRGGTGCCACTTCTAATGCC(BHQ1) (SEQ ID No. 21).

[0153] “(VIC)” indicates that the fluorescent group VIC is connected to the first nucleotide C of SEQ ID No.21, and “(BHQ1)” indicates that the quenching group BHQ1 is connected to the last nucleotide C of SEQ ID No.21.

[0154] (6) Primer pairs and probes for specific amplification and identification of Coxsackievirus group A type 4

[0155] The primer pair for specific amplification of Coxsackievirus A group 4 is CVA4-S and CVA4-A, and the probe for specific recognition of the amplified products of CVA4-S and CVA4-A is CVA4-Probe. The nucleotide sequences of the primer pair CVA4-S and CVA4-A and the probe CVA4-Probe are as follows (5' to 3'):

[0156] CVA4-S: ATGGACTCACGAACAACAGTGT (SEQ ID No. 22);

[0157] CVA4-A: GGTGACATAAAGGGCACTGA (SEQ ID No. 23);

[0158] CVA4-Probe: (CY5)TGGCAAACCGCGACCAATCCGTC(BHQ3) (SEQ ID No. 24).

[0159] “(CY5)” indicates that the fluorescent group CY5 (cyanine dye) is connected to the first nucleotide T of SEQ ID No.24, and “(BHQ3)” indicates that the quenching group BHQ3 is connected to the last nucleotide C of SEQ ID No.24.

[0160] (7) Primer pairs and probes for specific amplification and recognition of the internal reference gene globin

[0161] The primer pair for specific amplification of human enterovirus globin is globin-S and globin-A, and the probe for specific recognition of the amplified products of globin-S and globin-A is globin-Probe. The nucleotide sequences of the primer pair globin-S and globin-A and the probe globin-Probe are as follows (5' to 3'):

[0162] globin-S: ATCAGAAAGTGGTGGCTGGT (SEQ ID No. 25);

[0163] globin-A: AGGCAGAATCCAGATGCTCA (SEQ ID No. 26);

[0164] globin-Probe: (ROX)TGGCTAATGCCCTGGCCCACA(BHQ2)(SEQ ID No. 27);

[0165] “(ROX)” indicates that the fluorescent group ROX (carboxy-X-rhodamine) is connected to the first nucleotide T of SEQ ID No.27, and “(BHQ2)” indicates that the quenching group BHQ2 is connected to the last nucleotide A of SEQ ID No.27.

[0166] Probe EV-A71-Probe, probe CVA16-Probe, probe CVA6-Probe, probe EV-Probe, probe CVA10-Probe, probe CVA4-Probe or probe globin-Probe has a fluorescent group added to the 5' end of the above nucleotide sequence and a quenching group at the 3' end.

[0167] Example 2: Method for using the composition for detecting common pathogenic viruses of hand, foot and mouth disease

[0168] The primer pairs and probes of (1) to (6) in Example 1 are randomly divided into two groups, and the primer pairs and probes of (7) are added to each group, that is, there are 4 primer pairs and probes in each group. The four primer pairs and probes can be any combination as long as the fluorescent groups on the probes emit different colors. For ease of understanding, one of the combinations is provided as an example:

[0169] The first group: B tubes, add the primer pairs and probes described in (1)-(3) and (7) above, respectively, wherein the four probes are added with fluorescent groups FAM, VIC, CY5 and ROX, respectively, and the 3' ends of the four probes are connected with quenching groups BHQ1, BHQ1, BHQ3 and BHQ2, respectively.

[0170] The second group: C tubes, add the primer pairs and probes described in (4)-(7) above, respectively, wherein the four probes are added with fluorescent groups FAM, VIC, CY5 and ROX, respectively, and the 3' ends of the four probes are connected with quenching groups BHQ1, BHQ1, BHQ3 and BHQ2, respectively.

[0171] Exemplary experimental steps are provided as follows:

[0172] 1. Sample preparation

[0173] 1.1 Extraction of viral nucleic acid RNA from samples

[0174] Strictly follow the instructions of the commercial nucleic acid extraction kit to extract viral RNA from clinical specimens or virus isolation cultures; then take 5 μL of the extracted RNA as a RT-PCR template.

[0175] 1.2. Preparation of positive plasmid samples

[0176] 2. Add sample

[0177] Tube A is a mixture of component 1: 2×One Step RT-PCR Buffer III, component 2: TaKaRa Ex Taq HS (5U / μL), and component 3: PrimeScript RT Enzyme Mix II in the Takara One Step RT-PCR Kit (RR064A). The corresponding volumes are 12.5μL for component 1, 0.5μL for component 2, and 0.5μL for component 3, for a total of 13.5μL.

[0178] Tube B is a mixture of EV-A71, CVA16, CVA6, internal reference gene globin primer probe and DEPC water, where the concentrations of EV-A71, CVA16, CVA6 and internal reference gene globin primer probe are all 20 μM / μL. Take 0.6 μL of each of the four upstream and downstream primers and 0.3 μL of each probe, and dilute to a total volume of 6.5 μL with about 0.5 μL of DEPC water;

[0179] Tube C is a mixture of EV, CVA10, CVA4, internal reference gene globin primer probe (all with a concentration of 20 μM / μL) and DEPC water, wherein the concentrations of EV, CVA10, CVA4 and internal reference gene globin primer probe are all 20 μM / μL. Take 0.6 μL of each of the four upstream and downstream primers and 0.3 μL of each probe, and dilute to a total volume of 6.5 μL with about 0.5 μL of DEPC water.

[0180] Mix tube A and tube B to obtain PCR reaction tube 1, and mix tube A and tube C to obtain PCR reaction tube 2.

[0181] Positive and negative controls should be set up for each test. The positive control tube contains positive plasmids with EV, EV-A71, CVA16, CVA6, CVA10, CVA4 and EV target sequences, and the concentration of each plasmid is 50ng / μL. The negative control tube is DEPC water.

[0182] Three treatment groups were set up in the prepared PCR reaction tubes (PCR reaction tube 1 and PCR reaction tube 2), and 5 μL of the treated sample nucleic acid, positive control, and negative control were added respectively, and the total volume of the system was 25 μL. Three replicates were set up for each treatment group.

[0183] 3. RT-PCR amplification detection

[0184] Place the reaction tube into a fluorescent PCR amplification instrument for amplification detection. The probe detection mode is set to FAM, VIC, CY5 and ROX for the fluorescence channels of EV-A71, CVA16, CVA6 and the internal reference gene globin, and FAM, VIC, CY5 and ROX for EV, CVA10, CVA4 and the internal reference gene globin. The real-time RT-PCR reaction conditions are: 42℃ 10min, 95℃ 30S, 1 cycle; 95℃ 5S, 60℃ 30S (collect fluorescence signals in this step), 45 cycles. After the settings are completed, save the file and run the program.

[0185] 4. Fluorescence quantitative results report

[0186] Through the study of reference values, it was determined that the Ct reference value of this kit for detecting the target gene is 38, and the Ct reference value of the internal standard is 38.

[0187] Result analysis and judgment:

[0188] Table 3 RT-PCR amplification detection of PCR reaction tube 1

[0189]

[0190] Table 4 RT-PCR amplification detection of PCR reaction tube 2

[0191]

[0192] Example 3: Specificity and sensitivity verification

[0193] 3.1 Specificity Experiment

[0194] Referring to the method of Example 2, other virus samples were tested respectively, and the test results are shown in the following table. From the results, it can be seen that only EV-A71, CVA16 and CVA6, EV, CVA10, and CVA4 virus samples showed normal amplification, and the negative control (ddH 2 O) and other samples did not show amplification. The above results show that the fluorescent PCR detection kit of the present application can specifically amplify the target sequences in EV-A71, CVA16 and CVA6, EV, CVA10, and CVA4 viruses without cross-reacting with other viral nucleic acids. This shows that the method and kit of the present application have good specificity and no false negatives occur.

[0195] Enterovirus 71 EV-A71, Coxsackievirus A group 16 type CVA16, Coxsackievirus A group 6 type CVA6, Coxsackievirus A group 10 type CVA10, Coxsackievirus A group 4 type CVA4, Coxsackievirus A group 5 type CVA5, Coxsackievirus A group 8 type CVA8, Coxsackievirus A group 12 type CVA12, Coxsackievirus A group 14 type CVA14, Coxsackievirus B group 3 type CVB3, Coxsackievirus B group 4 type CVB4, Coxsackievirus B group 5 type CVB5, Echovirus 6 type E6, Echovirus 11 type E11, Echovirus 30 type E30, Enterovirus C Type 96 EV-C96, enterovirus group C type 99 EV-C99, poliovirus sabin1, poliovirus sabin3, influenza A (H1N1) virus, influenza A (H3N2) virus, influenza B virus, human coronavirus 229E, human coronavirus OC43, human coronavirus NL63, human coronavirus HKU1, respiratory syncytial virus RSV, human parainfluenza virus HPIV1, human parainfluenza virus HPIV2, human parainfluenza virus HPIV3 and human adenovirus HAdV are derived from the 2023 Healthy Children's Poliomyelitis and Other Enterovirus Pathogenesis Surveillance Project in Tibet Autonomous Region.

[0196] Influenza A (H1N1) virus, influenza A (H3N2) virus, influenza B virus, human coronavirus 229E, human coronavirus OC43, human coronavirus NL63, human coronavirus HKU1, respiratory syncytial virus RSV, human parainfluenza virus HPIV1, human parainfluenza virus HPIV2, human parainfluenza virus HPIV3, and human adenovirus HAdV are from the respiratory virus monitoring project for non-notifiable infectious diseases.

[0197] Table 5 Specificity detection results of primer probes in tube B in Example 2

[0198]

[0199]

[0200] Table 6 Specificity detection results of C tube primer probe in Example 2

[0201]

[0202]

[0203] 3.2 Sensitivity experiment

[0204] Plasmids containing EV-A71, CVA16, CVA6, EV, CVA10, and CVA4 virus VP1 gene fragments were diluted 10-fold to 5.0×10 7 copy / mL, 5.0×10 6 copy / mL, 5.0×10 5 copy / mL, 5.0×10 4 copy / mL, 5.0×10 3 copy / mL, 5.0×10 2 copy / mL and 5.0×10 1 copy / mL was used as a reference for the linear sensitivity of EV-A71, CVA16 and CVA6, EV, CVA10, and CVA4 viruses.

[0205] The test results are shown in Tables 8 and 9. The results show that the sensitivity of this kit is 5.0×102copy / mL.

[0206] Table 7 Sensitivity experiment

[0207] Copy number copy / mL EV Ct value CVA10 Ct value CVA4 Ct value <![CDATA[5.0×10 7 ]]> 15.64327 16.50545 14.92687 <![CDATA[5.0×10 6 ]]> 18.971 17.470 18.802 <![CDATA[5.0×10 5 ]]> 22.47172 21.20196 21.26694 <![CDATA[5.0×10 4 ]]> 25.56178 24.30709 24.62429 <![CDATA[5.0×10 3 ]]> 28.99614 28.71094 28.06201 <![CDATA[5.0×10 2 ]]> 31.95152 32.68478 31.13855 <![CDATA[5.0×10 1 ]]> - - -

[0208] Table 8 Sensitivity test table

[0209] Copy number copy / mL EV Ct value CVA10 Ct value CVA4 Ct value <![CDATA[5.0×10 7 ]]> 17.44687 14.258 13.627 <![CDATA[5.0×10 6 ]]> 19.989 18.363 17.291 <![CDATA[5.0×10 5 ]]> 23.62722 21.49497 21.54984 <![CDATA[5.0×10 4 ]]> 26.84763 26.17534 24.77054 <![CDATA[5.0×10 3 ]]> 30.2329 29.24737 28.13377 <![CDATA[5.0×10 2 ]]> 32.88889 32.95643 31.09084 <![CDATA[5.0×10 1 ]]> - - -

[0210] Example 4: Clinical sample testing

[0211] 1. Specimen collection, transportation and storage

[0212] (1) Stool specimens are collected and processed by disease prevention and control centers across the country and sent to the Chinese Center for Disease Control and Prevention.

[0213] (2) Domestic transport of virus strains or other potentially infectious biological materials is classified as Class A, with the corresponding United Nations number UN2814, and the packaging must comply with the PI620 classification and packaging requirements of the ICAO document Doc9284 "Technical Instructions for the Safe Transport of Dangerous Goods by Air". Environmental samples are classified as Class B, with the corresponding United Nations number UN3373, and the packaging must comply with the PI650 classification and packaging requirements of the ICAO document Doc9284 "Technical Instructions for the Safe Transport of Dangerous Goods by Air". For transportation by other means of transportation, the above standard packaging can be used as a reference. The transportation of virus strains or other potentially infectious materials must be handled in accordance with the "Regulations on the Transportation of Highly Pathogenic Microorganisms, Bacteria (Viruses) or Samples that Can Infect Humans" (Former Ministry of Health Order No. 45).

[0214] (3) Immediately store the samples at -80°C.

[0215] 2. Clinical sample testing:

[0216] Randomly select 15 samples from step 1, extract nucleic acid from the samples, and test them according to the following two methods.

[0217] (i) Detection was performed according to the assay method provided in Example 2.

[0218] (ii) One-Step RT-PCR was performed with reference to the primers in the literature “J Gen Virol. 2006 Jan; 87 (Pt 1): 119-128. Species-specific RT-PCR amplification of human enteroviruses: a tool for rapid species identification of uncharacterized enteroviruses” (human enteroviruses are divided into four groups from A to D, and primer pairs 486 / 488, 490 / 492 and 495 / 496 can amplify the VP1 sequences of groups A to C, respectively, and the VP1 region is the target sequence region for molecular typing of enteroviruses), and the amplified products were sequenced by first generation sequencing, and then the serotype / genotype of the enterovirus was determined by Blast on the NCBI website.

[0219] Table 9 Primer sequences

[0220] Primer name Primer sequences Target area Amplification location Specificity 486 TGGTAICARACIAAITWYGTIGTNCC VP3 2297–2322 EV-A 488 GTIGGRTAICCITCITARAACCAYTG VP1 3063–3038 EV-A 490 TGIGTIYTITGYRTICCITGGAT VP3 2226–2248 EV-B 492 GGRTTIGTIGWYTGCCA VP1 2953–2934 EV-B 495 ATGTAYRTICCICCIGGIGCNCC VP1 2951–2973 EV-C 496 CCRTCITARAARTGISIRTANGC VP1 3111–3089 EV-C

[0221] 3. Results Analysis

[0222] The results are shown in Table 10. The detection method provided in this application is consistent with the results of the authoritative detection method in the field provided in the references.

[0223] Clinical samples: from the National Center for Disease Control and Prevention, including feces, throat swabs, serum, cerebrospinal fluid, etc., specimen RNA extraction, PCR reaction and result analysis were carried out according to Example 2 and processed by the Chinese Center for Disease Control and Prevention.

[0224] Table 10 Sample test results

[0225] Sample No. Sample type and source Test results in Example 2 Gene sequencing results XZ2018-45 Stool specimen CVA16 CVA16 XZ2018-104 Stool specimen CVA4 CVA4 XZ2018-137 Stool specimen EV CVB5 XZ2019-3 Stool specimen CVA10 CVA10 XZ2019-20 Stool specimen CVA6 CVA6 XZ2019-35 Stool specimen EV CVB5 XZ2019-46 Stool specimen EV EV-C99 XZ2019-72 Stool specimen EV CVB4 XZ2019-90 Stool specimen CVA6 CVA6 XZ2019-93 Stool specimen CVA16 CVA16 XZ2019-112 Stool specimen EV E18 XZ2021-5 Stool specimen CVA6 CVA6 XZ2021-12 Stool specimen EV CVA9 XZ2021-84 Stool specimen CVA4 CVA4 XZ2021-216 Stool specimen EV CVA14

[0226] The beneficial technical effects obtained by this application are as follows:

[0227] The composition provided in the present application can be used for qualitative detection of pathogenic viral nucleic acids of hand, foot and mouth disease, and can distinguish enterovirus 71 (EV-A71), coxsackievirus group A type 16 (CVA16), coxsackievirus group A type 6 (CVA6), coxsackievirus group A type 10, and coxsackievirus group A type 4. This reagent adopts real-time fluorescence PCR technology and is suitable for nucleic acid detection of enterovirus extracted from samples such as throat swabs, anal swabs, blister exudate, feces, cerebrospinal fluid, and virus isolates.

[0228] This composition can be packaged separately according to the different types of viruses to be amplified and identified, and then stored at -20°C to minimize repeated freezing and thawing. Positive and negative controls should be set up for each test. The positive control tube is a positive plasmid with EV, EV-A71, CVA16, CVA6, CVA10, CVA4 and EV target sequences, and the negative control tube is DEPC water, marked as D and E tubes respectively.

[0229] Compared with the prior art, the nucleic acid detection kit of a novel enterovirus primer-probe combination provided by the present application has the following beneficial effects: the nucleic acid detection kit of a novel enterovirus primer-probe combination provided by the present application comprises tube A which is a mixture of reverse transcriptase, DNA polymerase and buffer, tube B which is a mixture of specific primers and probes for three serotypes of viruses, internal reference gene primer probes and DEPC water, as well as positive and negative controls. Tube C is a mixture of specific primers and probes for another three serotypes of viruses, internal reference gene primer probes and DEPC water, as well as positive and negative controls. Internal references can be used to monitor sample collection, storage and transportation, as well as nucleic acid extraction processes, to avoid misjudgment of false negative results. Improved sensitivity enhances detection efficiency, improved specificity, and avoids false positives.

[0230] The present application has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present application, and without the need to carry out unnecessary experimental conditions, the present application can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present application provides specific embodiments, it should be understood that further improvements can be made to the present application. In a word, according to the principles of the present application, the present application is intended to include any changes, uses or improvements to the present application, including departure from the disclosed scope in the present application and changes made with conventional techniques known in the art.

Claims

1. A composition for detecting or assisting in the detection of pathogenic viruses of hand, foot and mouth disease, the composition comprising primer probes for respectively amplifying and identifying enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10, and coxsackievirus A group 4, The primer probe for amplifying and identifying enterovirus 71 is composed of a primer for specifically amplifying an enterovirus 71 nucleic acid fragment containing a nucleotide sequence of positions 634-832 of SEQ ID No.1 and a probe for specifically binding to the nucleic acid fragment containing a nucleotide sequence of positions 634-832 of SEQ ID No.

1. The primer probe for amplifying and identifying enterovirus EV consists of a primer for specifically amplifying an enterovirus EV nucleic acid fragment containing a nucleotide sequence of positions 456-599 of SEQ ID No.2 and a probe for specifically binding to a nucleic acid fragment containing a nucleotide sequence of positions 456-599 of SEQ ID No.

2. The primer probe for amplifying and identifying Coxsackievirus A group 16 consists of a primer for specifically amplifying a nucleic acid fragment containing a nucleotide sequence of positions 573-779 of SEQ ID No. 3 and a probe for specifically binding to a nucleic acid fragment containing a nucleotide sequence of positions 573-779 of SEQ ID No.

3. The primer probe for amplifying and identifying Coxsackievirus A group 6 consists of a primer for specifically amplifying a nucleic acid fragment of Coxsackievirus A group 6 containing a nucleotide sequence of positions 524-746 of SEQ ID No. 4 and a probe for specifically binding to a nucleic acid fragment of positions 524-746 of SEQ ID No.

4. The primer probe for amplifying and identifying Coxsackievirus A group 10 is composed of a primer for specifically amplifying a Coxsackievirus A group 10 nucleic acid fragment containing a nucleotide sequence of positions 118-199 of SEQ ID No. 5 and a probe for specifically binding to a nucleic acid fragment containing a nucleotide sequence of positions 118-199 of SEQ ID No.

5. The primer probe for amplifying and identifying Coxsackievirus A group 4 type consists of a primer for specifically amplifying a Coxsackievirus A group 4 type nucleic acid fragment containing a nucleotide sequence of positions 428-590 of SEQ ID No.6 and a probe for specifically binding to a nucleic acid fragment containing a nucleotide sequence of positions 428-590 of SEQ ID No.

6.

2. The composition according to claim 1, characterized in that The primer probe for amplifying and identifying enterovirus 71 includes primers EV-A71-S and EV-A71-A, and probe EV-A71-Probe; the primer probe for amplifying and identifying enterovirus EV includes primers EV-S and EV-A, and probe EV-Probe; the primer probe for amplifying and identifying coxsackievirus A group 16 includes primers CVA16-S and CVA16-A, and probe CVA16-Probe; the primer probe for amplifying and identifying coxsackievirus A group 6 includes primers CVA6-S and CVA6-A, and probe CVA6-Probe; the primer probe for amplifying and identifying coxsackievirus A group 10 includes primers CVA10-S and CVA10-A, and probe CVA10-Probe; the primer probe for amplifying and identifying coxsackievirus A group 4 includes primers CVA4-S and CVA4-A, and probe CVA4-Probe; The EV-A71-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 7; The EV-A71-A is a single-stranded DNA with a nucleotide sequence of SEQ ID No. 8; The nucleotide sequence of the EV-A71-Probe is SEQ ID No. 9; The EV-S is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 10; The EV-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 11; The nucleotide sequence of the EV-Probe is SEQ ID No. 12; The CVA16-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 13; The CVA16-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 14; The nucleotide sequence of the CVA16-Probe is SEQ ID No. 15; The CVA6-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 16; The CVA6-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 17; The nucleotide sequence of the CVA6-Probe is SEQ ID No. 18; The CVA10-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 19; The CVA10-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 20; The nucleotide sequence of the CVA10-Probe is SEQ ID No. 21; The CVA4-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 22; The CVA4-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 23; The nucleotide sequence of the CVA4-Probe is SEQ ID No.

24.

3. The composition according to claim 1 or 2, characterized in that: The composition also includes a primer pair and a probe for amplifying an internal reference gene, wherein the primer probe for amplifying and identifying the internal reference gene includes primers globin-S and globin-A, and a probe globin-Probe. The globin-S is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 25; The globin-A is a single-stranded DNA having a nucleotide sequence of SEQ ID No. 26; The nucleotide sequence of the globin-Probe is SEQ ID No.

27.

4. The composition according to any one of claims 1 to 3, characterized in that: The molar ratio of the EV-A71-S, EV-A71-A and EV-A71-Probe is 2:2:1, the molar ratio of the EV-S, EV-A and EV-Probe is 2:2:1, the molar ratio of the CVA16-S, CVA16-A and CVA16-Probe is 2:2:1, the molar ratio of the CVA6-S, CVA6-A and CVA6-Probe is 2:2:1, the molar ratio of the CVA10-S, CVA10-A and CVA10-Probe is 2:2:1, the molar ratio of the CVA4-S, CVA4-A and CVA4-Probe is 2:2:1, and the molar ratio of the globin-S, globin-A and globin-Probe is 2:2:

1.

5. The composition according to claim 4, characterized in that: The composition also includes a positive plasmid.

6. Use of the composition according to any one of claims 1 to 5 in any of the following: A1), detecting or assisting in detecting a microorganism, wherein the microorganism is or contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4; A2), detecting or assisting in detecting whether the sample to be tested contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4; A3), preparing a product for detecting or assisting in detecting a microorganism, wherein the microorganism is or contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4; A4), prepare products for detecting or assisting in detecting whether a sample to be tested contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4.

7. A kit, characterized in that: The kit contains the composition according to any one of claims 1 to 5.

8. The kit according to claim 7, characterized in that: The kit is used to detect or assist in the detection of enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4.

9. Use of the kit according to claim 7 or 8 in any of the following: A1), detecting or assisting in detecting a microorganism, wherein the microorganism is or contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4; A2), detecting or assisting in detecting whether the sample to be tested contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4.

10. A method, characterized in that The method comprises any of the following: B1), the method comprises using the composition according to any one of claims 1 to 5 or the kit according to claim 7 or 8 to perform RT-PCR detection on the microorganism to be detected, and judging or assisting in judging whether the microorganism to be detected is or contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4 according to the RT-PCR detection result; B2), the method comprises using the composition described in any one of claims 1 to 5 or the kit described in claim 7 or 8 to perform RT-PCR detection on the sample to be tested, and judging or assisting in judging whether the sample to be tested contains enterovirus 71, enterovirus EV, coxsackievirus A group 16, coxsackievirus A group 6, coxsackievirus A group 10 and / or coxsackievirus A group 4 according to the RT-PCR detection result.

Images