Ecl biosensor for detecting microcystin mc-lr

Abstract

The application discloses an ECL biosensor for detecting microcystin. Under the excitation of a photomultiplier tube, AuNC and a co-reactant, potassium persulfate (K2S2O8), directly react to generate AuNC •+ and SO4 •‑ , SO4 •‑ is reduced to SO4 •+ by AuNC 2‑ , and AuNC * is generated simultaneously, wherein AuNC * is an excited state of AuNC, and the excited state is transitioned to a ground state to release light intensity, which is captured by an ECL instrument to generate an ECL signal. With the increase of the content of MC-LR, the ECL signal is stronger, so that quantitative detection of the content of MC-LR is realized. The biosensor platform has a wide detection range from 0.1 pM to 1 nM, and the detection limit is as low as 62.3 fM. The application can realize rapid detection of low-concentration target microcystin MC-LR, and can be applied to detection in various samples, such as food, medicine, milk, beverage, water and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological analysis detection, and particularly relates to an ECL biosensor and application thereof in detection of microcystin MC-LR. BACKGROUND

[0002] Microcystin (MCs) is a monocyclic heptapeptide mainly produced by Microcystis aeruginosa, and is the most widely distributed hepatotoxin at present, which poses a serious threat to drinking water quality. Among the various isomers of MCs, the most common and high content ones are MC-LR, MC-RR and MC-YR (L, R and Y represent leucine, arginine and tyrosine, respectively). Studies have shown that MC-LR is the most toxic, MC-YR is the second, and RR is the weakest. MCs can inhibit the activity of protein phosphatase, leading to rapid destruction of liver structure, which usually causes hypovolemic shock or liver dysfunction and death. More and more studies have shown that long-term exposure of humans to low concentrations of MCs environment is prone to liver cancer.

[0003] With climate warming and water eutrophication of aquatic ecosystems, the phenomenon of cyanobacterial blooms is increasing, which has attracted worldwide attention. MC-LR, which can cause diseases and death after being absorbed by the human body, is mainly derived from consumption of seafood, agricultural plants and drinking water. After being consumed by humans, it can inhibit the activity of protein phosphatase (PP1 and PP2A) serine / threonine residues, leading to imbalance of intracellular protein phosphorylation and dephosphorylation levels, cytoskeleton changes, and causing DNA damage and cell apoptosis. In addition, MC-LR also specifically targets liver and kidney cells to induce embryonic and neurotoxicity. In 2010, it was listed as a 2B carcinogen by the International Cancer Research Agency. The World Health Organization also stipulates that the microcystin MC-LR in drinking water should not exceed 1 μg / L. Water quality safety is related to human life and health, therefore, it is urgent to develop a high-sensitivity and specific MC-LR sensor for water monitoring and epidemiological toxicology research.

[0004] Electrochemiluminescence (ECL) is distinguished from other detection methods due to its low cost, simple operation and high sensitivity. ECL is usually generated by the electron transfer reaction of free radicals generated near the electrode, which releases the excited state by photons. There are usually two ways of electrochemiluminescence. One is the co-reactant way, in which an intermediate free radical is generated from the redox process of the reactant and the co-reactant, which can interact with the electrochemiluminescent group free radical to produce an excited state. The other way is the annihilation way, in which the oxidation and reduction reaction of the electrochemiluminescent group on the electrode produces free radical anions and free radical cations, which are annihilated to produce an excited state and emit light. Compared with the annihilation way, the intermediate produced by the co-reactant way has stronger redox ability, and the ECL produced is usually stronger. In recent years, ECL has gradually become a new optical analysis tool that has attracted great interest, especially in the fields of biological and environmental analysis. SUMMARY

[0005] The purpose of the present application is to construct an ECL biosensor for detecting microcystin, which is based on the detection strategy of in-situ reduced DGB@AuNC, and simultaneously uses the T7 EXO circulating enzyme cutting cycle means, so that a small amount of microcystin can realize strong signal output, which is beneficial to the rapid detection of early infection samples. Specifically, the technical scheme of the present application is as follows:

[0006] The ECL biosensor for detecting microcystin MC-LR of the present application is prepared by the following method:

[0007] (1) DNA gel balls DGB are prepared by using Padlock chain and Primer chain under the action of T4 ligase, Phi29 enzyme and dNTP;

[0008] (2) Gold nanoclusters are synthesized in-situ on the gel balls by using HAuCl4 and trisodium citrate, to obtain blooming nanogel balls DGB@AuNCs;

[0009] (3) Microcystin MC-LR is used to open the hairpin H1, so that a sequence of the hairpin H1 is exposed to the hairpin H2 to form MC-LR-H1-H2;

[0010] (4) MC-LR-H1-H2 is cut by T7 EXO to obtain enzyme cutting product F1 chain;

[0011] (5) Silver nanofilm is electroplated on the pretreated electrode, and then hairpin H3 is modified on the surface of the electrode and MCH is added to prevent specific binding;

[0012] (6) F1 chain obtained in step (4) is added to the electrode to open the hairpin H3;

[0013] (7) adding the nanogel ball DGB@AuNCs bloomed in step (2) to the electrode for electrochemiluminescence detection.

[0014] For the ECL biosensor described above, preferably, in step (1), the Padlock chain and the Primer chain are simultaneously annealed and combined at 85-95 DEG C and then cooled to room temperature, and then T4 ligase is added for reaction, and then phi29 enzyme and dNTP are added for reaction.

[0015] For the ECL biosensor described above, preferably, in step (2), 0.8-1.2 mM of chloroauric acid HAuCl4 solution and the gel ball DGB are fully mixed, and then 100 mM trisodium citrate buffer (pH = 6) is added, and the mixture is stirred and cooled at 80-95 DEG C.

[0016] For the ECL biosensor described above, preferably, in step (3), microcystin (MC-LR) is incubated with the annealed H1 and H2 at 35-38 DEG C for 2-4 h to form MC-LR-H1-H2.

[0017] For the ECL biosensor described above, preferably, in step (4), MC-LR-H1-H2 and T7 EXO are added to the ep tube, and the T7 EXO enzyme is used to cut the flat end from the 5' end to obtain the cut product F1.

[0018] For the ECL biosensor described above, preferably, in step (5), the silver nanofilm electroplating is performed by placing the electrode in an electrolyte and depositing at a constant potential of 0.1-0.5 V to obtain a three-dimensional layered silver nanofilm; the electrolyte includes 4-6 mM AgNO3, 0.15-0.25 M KNO3, 0.6-1.5 mM sodium citrate dihydrate, and 2-3 g / L polyvinylpyrrolidone. The hairpin H3 is modified on the electrode surface by incubating the hairpin H3 on the electrode. The electrode is first deposited with silver nano, and then the hairpin is modified, which is a common practice for hairpin modification, and the principle is generally based on the combination of silver-sulfur bond, so that the hairpin H3 containing mercapto is modified on the silver-plated electrode.

[0019] For the ECL biosensor described above, preferably, in step (7), the electrochemiluminescence detection is performed by placing the electrode in 0.03-0.08 mM K2S2O8 and measuring ECL at -2 V-0 V with a photomultiplier tube at 700-800 V.

[0020] As a more preferred technical solution, the ECL biosensor of the present application is prepared by the following method:

[0021] (1) Mix 10 μL, 10 μM of Padlock chain and 10 μL, 10 μM of primer chain in 10 mM Mg 2+ solution, anneal at 95 °C for 5 min, cool to room temperature; add 0.2 U of T4 ligase, incubate at 16 °C overnight, inactivate T4 ligase at 65 °C, then add 5 μL, 10 U / μL of phi29 DNA polymerase and 10 mL, 10 mM of dNTP, incubate at 30 °C for 24 h, finally inactivate the enzymes used in the reaction at 65 °C, centrifuge the obtained product at 10,000 rpm for 10 min, wash with ultrapure water for 3 times, then disperse in 500 μL of ultrapure water, store at 4 °C for standby. In this step, padlock and primer are annealed together under the action of 8-12 mM Mg 2+ .

[0022] (2) Add 50 μL of 1 mM chloroauric acid (HAuCl4) solution and 50 μL of prepared gel balls (DGB) to 0.85 mL of ultrapure water and mix well, then add 50 μL of freshly prepared 100 mM trisodium citrate buffer (pH = 6). Mix the mixture at 90 °C for 30 min (800 rpm), cool to room temperature, store at 4 °C for standby, synthesize DGB@AuNCs, and store in a 4 °C refrigerator for standby.

[0023] (3) Incubate microcystin (MC-LR) with annealed H1 and H2 at 37 °C for 3 h to form MC-LR-H1-H2, and store at 4 °C.

[0024] (4) Add MC-LR-H1-H2 and 0.21 U of T7 EXO to an ep tube, and use T7 EXO to cut the 5' end of the blunt end to obtain the cut product F1. The enzyme digestion in this step is preferably performed at a temperature of 20-30 °C.

[0025] (5) Perform silver nanoflower electroplating on the polished electrode. The time for silver nanoflower electrodeposition in this step is preferably 10-20 min.

[0026] (6) Incubate the hairpin H3 on it again, and add MCH to prevent non-specific adsorption.

[0027] (7) Add the cut product F1 to the electrode and incubate at 37 °C for 3 h, and finally add the in-situ reduced gel balls to the electrode and incubate for 3 h.

[0028] The ECL biosensor can be applied to detect microcystin, can realize rapid detection of low concentration target, and can be applied to various real samples. When applied, the electrode can be placed in 0.05mM K2S2O8, and ECL measurement can be performed at-2V-0V and 750V of the photomultiplier tube.

[0029] The above-mentioned hairpin H1 sequence is designed by itself, is SEQ ID No. 1 in the sequence list, and the sequence is as follows:

[0030] 5'-GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCGCC GGGC ATAATGAGGTGGT -3'

[0031] The microcystin MC-LR opens the hairpin H1, so that H1 exposes an underlined sequence connected to H2 to form MC-LR-H1-H2.

[0032] The above-mentioned hairpin H2 is designed by itself, is SEQ ID No. 2 in the sequence list, and the sequence is as follows:

[0033] 5'-ACCACCTCATTATGCCCTTGCTAGCTAAGGTCATCTAGCTAGCAAGGG-3'

[0034] The above-mentioned hairpin H3 is designed by itself, is SEQ ID No. 3 in the sequence list, and the sequence is as follows:

[0035] H3: 5'-TTTTTATCCCTTGCTAGCTAGATGACCGTAGCTAGCAAGGGAT-3'

[0036] The above-mentioned F1 chain is designed by itself, is SEQ ID No. 4 in the sequence list, and the sequence is as follows:

[0037] F1: 5'-AGGTCATCTAGCTAGCAAGGG-3'

[0038] The above-mentioned Padlock chain and Primer chain are designed by themselves, and the sequences are SEQ ID No. 5 and SEQ ID No. 6 in the sequence list, respectively, and the specific sequences are as follows:

[0039] Padlock chain: 5'-CAAGGGATTTTTTTTTTTCCTGCTTTTTTTTTTGTAGCTAG-3'

[0040] Primer chain: 5'-AAAATCCCTTGCTAGCTACAAA-3'

[0041] In another aspect, the ECL biosensor can be prepared by the following method:

[0042] (1) polishing the electrode with alumina slurry, then rinsing thoroughly with ultrapure water, and ultrasonicating in ethanol and water, and drying at room temperature;

[0043] (2) placing the electrode in an electrolyte (5 mM AgNO3, 0.2 M KNO3, 1 mM sodium citrate dihydrate, 2.5 g / L polyvinylpyrrolidone), depositing for 15 min at a constant potential of 0.25 V to obtain a three-dimensional layered silver nanofilm, and then adding 10 μL of 3 μM mercapto DNA H3 to the electrode and incubating for 6 h;

[0044] (3) adding 1 mM MCH and incubating for half an hour;

[0045] (4) placing the enzyme digestion product F1 (10 μL) after incubation with different concentrations of MC-LR on the electrode and incubating for 3 h;

[0046] (5) dropping 10 μL of the previously synthesized DGB@AuNC and 10 mM Mg 2+ together on the electrode surface and incubating for 2 h;

[0047] (6) placing the electrode in 0.05 mM K2S2O8, and performing ECL measurement at -2 V-0 V with a photomultiplier tube of 750 V

[0048] In the present application, the T7 EXO cycle enzyme digestion cycle method is used, and a small amount of microcystin can achieve strong signal output, which is conducive to the rapid detection of early infection samples.

[0049] Water quality has more components and is more complex, and the development of ECL has great advantages for expanding the detection method of MC-LR. The content of MC-LR in food is relatively low, and often needs to rely on nucleic acid amplification means. DNA nanotechnology provides a multifunctional platform for the rational design of multifunctional self-assembled nanostructures. Using the isothermal amplification strategy of RCA, a large number of long-chain DNA with repeated sequences are generated through the continuous rolling synthesis of the carefully designed loop template on the hairpin, and according to the Watson-Crick base pairing principle, DNA gel balls (DGB) are self-assembled. DNA is considered an ideal template for synthesizing metal nanoclusters due to its non-toxicity and programmable molecular recognition ability. Adenine (A)-rich DNA is considered a template for synthesizing gold nanoclusters (AuNC). The loop template is carefully designed to include a thymine (T)-rich and a recognition hairpin. After the hairpin is released by the cycle enzyme, the loop template generates ultra-long polymerase amplicons under the action of polymerase by continuously adding nucleotides, and spontaneously forms DGB. In the process of in-situ synthesis of AuNC, DGB completes the transformation from spore to flower, and its morphology changes from 3D structure to 2D structure, and under the action of co-reactant, electron transfer occurs to emit ECL signal.

[0050] Specifically, the principle of the present application is analyzed as follows:

[0051] 1. T7 EXO cleavage cycle principle.

[0052] Firstly, according to the sequence of the MC-LR aptamer designed by Andy Ng et al. in the literature Environ. Sci. Technol. 2012, 46, 10697-10703, a hairpin H1 is designed. The hairpin can not only be opened by MC-LR, but also the DNA fragment exposed after being opened can be connected to the lower end of another hairpin H2 to form a double-stranded blunt end. T7 EXO can catalyze the removal of single nucleotides from the 5' end of the blunt end of double-stranded DNA, and the 5' end double-stranded part of H2 is removed, and two sequences are dropped, one is a 21 nt single-stranded F1 used to start the RCA reaction, and the other is H1 carrying MC-LR participating in the cycle.

[0053] 2. Design basis of blooming DGB

[0054] Through the T-rich sequence on the padlock, under the catalysis of phi29 enzyme, dNTP, Mg 2+ , etc., according to the principle of base complementary pairing, the nanoflower structure with A-rich sequence is formed on the rolling circle amplification chain. DNA templated gold nanoclusters formation usually includes three steps. First, adenine (A) base binds with Au 3+ to form polyadenine-Au 3+ complex. Second, sodium citrate will polyadenine-Au 3+The complex is reduced to Au 0 Finally, Au 0 AuNC is assembled along the contour of the polyadenine template, eventually forming a blooming hydrogel.

[0055] 3. ECL Detection Principle

[0056] Through T-rich sequences on the padlock chain, phi29 enzyme, dNTP, and Mg... 2+ Under catalytic action, according to the base pairing principle, A-rich nanoflower structures are formed on the rolling ring amplification chain. After HAuCl4 is reduced in situ on adenine, AuNC reacts directly with the co-reactant potassium persulfate (K2S2O8) in the ECL reaction system to produce AuNC. •+ and SO4 •- SO4 •- AuNC •+ Reducible SO4 2- Simultaneously generate AuNC * AuNC * It is the excited state of AuNC. When the excited state transitions to the ground state, it releases light intensity, which is captured by the ECL instrument to generate an ECL signal. The entire ECL process is described as follows:

[0057] AuNC + e → AuNC •- (1)

[0058] S2O8 2- + e → SO4 •- (2)

[0059] AuNC •- + SO4 •- → AuNC * + SO4 2- (3)

[0060] AuNC * → AuNC + hν (4)

[0061] This invention designs and synthesizes self-assembled programmable DNA gel spheres for in-situ synthesis of gold nanoclusters for sensitive detection of microcystin toxins. With increasing MC-LR content, the content of enzyme digestion products gradually increases, triggering more hairpin opening and exposing more sequences at the junction ends. Adenine (A) bases and Au... 3+ Combine to form polyadenine-Au 3+ The complex was then reduced with sodium citrate to form AuNC along the contour of the polyadenine template, ultimately forming a blooming hydrogel. Under photomultiplier tube excitation, AuNC reacted directly with the co-reactant potassium persulfate (K₂S₂O₈) to produce AuNC.•+ and SO4 •- SO4 •- AuNC •+ Reducible SO4 2- Simultaneously generate AuNC * AuNC * It is the excited state of AuNC. When the excited state transitions to the ground state, it releases light intensity, which is captured by the ECL instrument to generate an ECL signal. As the MC-LR content increases, the ECL signal becomes stronger, thus enabling quantitative detection of the MC-LR content.

[0062] This invention first expands the contact area of ​​the biosensing platform by using an electrochemically deposited thin layer of silver as a substrate, thereby enhancing the ECL signal of AuNC. Secondly, hydrogel is chosen as the material source, leveraging the non-toxic and harmless nature of biomaterials to avoid the environmentally unfriendly characteristics of organic or inorganic reagents. Finally, by using thymine as a template for the in-situ reduction of AuNC, a highly stable and sensitive ECL biosensor was successfully constructed for the detection of microcystin MC-LR, with a wide detection range of 0.1 pM-1 nM and a detection limit as low as 62.3 fM. Therefore, this invention enables rapid detection of low concentrations of the target analyte microcystin MC-LR and can be applied to the detection of various samples such as food, pharmaceuticals, milk, beverages, and water. Attached Figure Description

[0063] Figure 1 A schematic diagram illustrating the principle of using self-assembled programmable DNA gel spheres for in-situ synthesis of gold nanoclusters for sensitive detection of microcystin toxins.

[0064] Figure 2 The feasibility of the nucleic acid reaction design was verified by gel electrophoresis experiment;

[0065] Figure 3 TEM images of the gel spheres before and after in-situ reduction;

[0066] Figure 4 To optimize the incubation and concentration plot of T7 EXO;

[0067] Figure 5 The graph shows the relationship and linearity between the concentration of microcystin MC-LR and the intensity of ECL.

[0068] Figure 6 The stability and specificity of this ECL biosensor were evaluated. Detailed Implementation

[0069] The following examples are further illustrations of the present application and are not intended to limit the present application in any way. The spirit of the present application should be limited only by the appended claims.

[0070] The literature Environ. Sci. Technol. 2012, 46, 10697−10703 was investigated to screen aptamers related to MC-LR as the analysis object, and the hairpin H1 was designed and synthesized by Shanghai Bioengineering Co., Ltd. The sequence is as follows:

[0071] H1: 5'-GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCGCCGGGCATAATGAGGTGGT-3'. Example

[0072] Design and synthesis of DNA gel balls (DGB).

[0073] First, 10 μL of 10 μM phosphonate-modified Padlock chain, 10 μL of 10 μM Primer chain and 10 mM Mg 2+ were placed in an ep tube and annealed at 95°C for 5 min, and then slowly cooled to room temperature. Then 0.2 U of T4 DNA ligase was added, and the reaction was carried out at 16°C overnight. Under the action of T4 ligase, the phosphate group at the 5' end of the padlock chain forms a phosphodiester bond with the hydroxyl group at the 3' end, and the circularization is carried out. Then the ep tube was placed at 65°C for 15 min to inactivate the T4 ligase. Finally, 10 U / μL of phi29 DNA polymerase and dNTP (10 mM, 10 μL) were added to the ep tube, and the mixture was incubated at 30°C for 24 h. Finally, the enzymes used in the reaction were inactivated at 65°C for 15 min. The obtained product was centrifuged at 10000 rpm for 10 min and washed with ultrapure water for 3 times, then dispersed in 500 μL of ultrapure water, and stored at 4°C for standby.

[0074] Synthesis of blooming nanogel balls DGB@AuNCs.

[0075] 50 μL of 1 mM chloroauric acid (HAuCl4) solution and 50 μL of prepared gel balls (DGB) were added to 0.85 mL of ultrapure water and mixed well, then 50 μL of freshly prepared 100 mM trisodium citrate buffer (pH=6) was added. The mixture was stirred at 90°C for 30 min (800 rpm), cooled to room temperature, and stored at 4°C for standby. DGB@AuNCs were synthesized and stored in a 4°C refrigerator for standby.

[0076] Design, synthesis of T7 exonuclease cleavage

[0077] Different concentrations of microcystin (MC-LR) were incubated with annealed H1, H2 at 37°C for 3h to form MC-LR-H1-H2, which was stored at 4°C. MC-LR-H1-H2 and 0.21 U of T7 EXO were added into ep tubes for cleavage to generate F1.

[0078] Construction of ECL sensor.

[0079] First, the GCE electrode was polished with alumina slurry, then the GCE was thoroughly rinsed with ultrapure water and sonicated in ethanol and water, followed by drying clean at room temperature. The GCE electrode was placed in electrolyte (5 mM AgNO3, 0.2M KNO3, 1 mM sodium citrate dihydrate, 2.5 g / L polyvinylpyrrolidone) at a constant potential of 0.25 V for 15 min to obtain a three-dimensional layered silver nanofilm, and it was allowed to dry. Then 10 μL of 3 μM thiol DNA H3 was added to the electrode and incubated for 4-6 h; the solution on the electrode was shaken off, and 1 mM purchased MCH was added and incubated for half an hour to prevent non-specific binding. After shaking off the solution on the electrode, 10 μL of the cleaved product F1 with different concentrations of MC-LR was added and incubated at 37°C for 3h. After shaking off the solution on the electrode, 10 μL of DGB@AuNC and 10 mM Mg 2+ 10 μL were added to the electrode and incubated at 37°C for 2h. Finally, the electrode was placed in 0.05 mM K2S2O8, and ECL measurement was performed at -2V-0V with a photomultiplier tube at 750V.

[0080] As Figure 2 shown is the analysis of DNA structures using polyacrylamide gel electrophoresis (PAGE).

[0081] Figure 2 A: 6% PAGE analysis of cleavage. Lane 1, MC-LR instead of strand (sequence complementary to the part of the MC-LR aptamer); Lane 2, H1; Lane 3, H2; Lane 4, F1; Lane 5, MC-LR+H1; Lane 6, MC-LR+H1+H2; Lane 7, MC-LR+H1+H2+T7 EXO; Lane 8, H1+H2+T7 EXO.

[0082] Figure 2B: DNA reaction on the electrode was 6% PAGE. Lane 1, F1; Lane 2, H3; Lane 3, padlock; Lane 4, primer; Lane 5, primer + padlock + T4; Lane 6, F1 + H3; Lane 7, F1 + H3 + primer; Lane 8, H3 + primer; Lane 9, F1 + H3 + RCA.

[0083] As Figure 2 As shown in Fig. 2A, a new band can be observed in lane 5 when H1 and MC-LR were introduced into lane 5, which proved that H1 can bind with MC-LR. Similarly, the new band in lane 6 also indicated that MC-LR combined with H1 and H2 to form a larger molecular weight conjugate. A new band appeared below lane 7, which was the enzyme digestion product F1, compared with lane 6. The enzyme digestion reaction occurred when compared with lane 4. No enzyme digestion reaction occurred when H1 and H2 did not bind in the absence of MC-LR in lane 8. The above results showed that the designed enzyme digestion reaction was successful.

[0084] As Figure 2 As shown in Fig. 2A, a new band can be observed in lane 5 when H1 and MC-LR were introduced into lane 5, which proved that H1 can bind with MC-LR. Similarly, the new band in lane 6 also indicated that MC-LR combined with H1 and H2 to form a larger molecular weight conjugate. A new band appeared below lane 7, which was the enzyme digestion product F1, compared with lane 6. The enzyme digestion reaction occurred when compared with lane 4. No enzyme digestion reaction occurred when H1 and H2 did not bind in the absence of MC-LR in lane 8. The above results showed that the designed enzyme digestion reaction was successful.

[0085] As Figure 3 Fig. 3A shows the transmission images of the gel beads before and after in situ reduction. TEM images show that T-rich DNA can be used as a template for in situ reduction of gold nanoclusters. Wherein (A) is the transmission image of gel beads DGB, (B) is DGB@AuNC, and (C) is AuNC.

[0086] As Figure 4 Fig. 4A shows the incubation and concentration of T7 EXO. In order to study the moment when the ECL signal is the highest, the effects of different concentrations of T7 EXO and different incubation times on the ECL signal were detected. Figure 4 A, we selected 100 min as the best incubation time; and Figure 4 B, 0.21 U was selected as the best concentration of T7 EXO.

[0087] Figure 5For the concentration of microcystin MC-LR and ECL intensity graph and linear relationship, the addition of a series of concentration range from 0.1 pM to 1 nM MC-LR can significantly increase the ECL intensity, which makes the ECL intensity and the logarithm of MC-LR concentration between linear relationship;

[0088] Figure 6 The stability and specificity of the ECL biosensor are evaluated. The concentration of 10 pM MC-LR is selected for stability test, and the relative standard deviation of the sensing platform is 2.46%. 1 nM of MC-LR and 10 nM of Ba 2+ , Ca 2+ , Cu 2+ , Fe 2+ , Fe 3+ , K + , Mg 2+ , Na + , Zn 2+ are compared for specificity evaluation, and it is found that even if there are interferents, the ECL nucleic acid sensor is still sensitive to the detection of MC-LR.

[0089] It should be noted that the above technical content of the present application is only an explanation and clarification for those skilled in the art to understand the essence of the present application, so the technical content is not used to limit the essential protection scope of the present application. The essential protection scope of the present application should be subject to the description in the claims. Those skilled in the art should know that any modification, equivalent replacement and improvement based on the essential spirit of the present application should be within the essential protection scope of the present application.

Claims

1. An ECL biosensor for detecting microcystin MC-LR, prepared by the following method: (1) DNA gel balls DGB are prepared by using Padlock chains and Primer chains under the action of T4 ligase, Phi29 enzyme and dNTP; (2) Gold nanoclusters are in-situ reduced and synthesized on the DNA gel balls DGB by using HAuCl4 and trisodium citrate to obtain blooming nanogel balls DGB@AuNCs; (3) Microcystin MC-LR is used to open hairpin H1, so that hairpin H1 is connected to hairpin H2 to form MC-LR-H1-H2; (4) MC-LR-H1-H2 is cut by T7 EXO to obtain enzyme digestion product F1 strand; (5) Silver nanofilm is electroplated on the pretreated electrode, then hairpin H3 is modified on the surface of the electrode and MCH is added to prevent non-specific binding; (6) F1 strand obtained in step (4) is added to the electrode to open hairpin H3; (7) Blooming nanogel balls DGB@AuNCs in step (2) are added to the electrode. The sequences of the hairpin H1, H2, H3, F1 strand, Padlock chain and Primer chain are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6 respectively.

2. The ECL biosensor of claim 1, wherein, In step (1), the two Padlock chains and Primer chains are first annealed and combined at 85-95℃ and then cooled to room temperature, and then T4 ligase is added for reaction, and then phi29 enzyme and dNTP are added for reaction.

3. The ECL biosensor of claim 1, wherein, In step (2), 0.8-1.2 mM of chloroauric acid HAuCl4 solution and gel balls DGB are mixed thoroughly, then 100 mM trisodium citrate buffer solution with pH=6 is added, and the mixture is stirred and cooled at 80-95℃.

4. The ECL biosensor of claim 1, wherein, In step (3), microcystin MC-LR is incubated with annealed hairpin H1 and hairpin H2 at 35-38℃ for 2-4 h to form MC-LR-H1-H2.

5. The ECL biosensor of claim 1, wherein, In step (4), MC-LR-H1-H2 and T7 EXO are added to an ep tube, and the 5' end is cut by T7 EXO to obtain the cut product F1.

6. The ECL biosensor of claim 1, wherein, In step (5), silver nanofilm is electroplated by placing the electrode in an electrolyte and depositing at a constant potential of 0.1-0.5 V to obtain a three-dimensional layered silver nanofilm; the electrolyte contains 4-6 mM AgNO3, 0.15-0.25 M KNO3, 0.6-1.5 mM sodium citrate dihydrate, and 2-3 g / L polyvinylpyrrolidone.

7. The ECL biosensor of any one of claims 1-6, wherein, The following method is used to prepare: (1) Mix 10 μL, 10 μM of Padlock strand and 10 μL, 10 μM of primer strand in 10 mM Mg 2+ solution, heat to 95°C for 5 min, cool to room temperature; add 0.2 U of T4 ligase, incubate at 16°C overnight, inactivate T4 ligase at 65°C, then add 5 μL, 10 U / μL of phi29 DNA polymerase and 10 mM of dNTP, incubate at 30°C for 24 h, finally inactivate the enzymes used in the reaction at 65°C, collect the product obtained by centrifugation at 10000 rpm for 10 min and wash 2-4 times with ultrapure water, then disperse in 500 μL of ultrapure water, store at 4°C for standby use; (2) 50 µL of 1 mM chloroauric acid solution and 50 µL of prepared DNA gel balls DGB are added to ultrapure water and mixed thoroughly, then 50 µL of 100 mM trisodium citrate buffer solution with pH=6 is added, the mixture is stirred at 90℃ for 30 min, cooled to room temperature, and stored at 4℃ for standby, DGB@AuNCs are synthesized and stored in a 4℃ refrigerator for standby; (3) incubate microcystin MC-LR with annealed hairpin H1 and hairpin H2 at 37℃ for 3h to form MC-LR-H1-H2, and store at 4℃; (4) add MC-LR-H1-H2 and T7 EXO into ep tube, and use T7 EXO to cut the flat end from 5' end to obtain the cut product F1; (5) place the electrode in an electrolyte containing 5 mM AgNO3, 0.2 M KNO3, 1 mM sodium citrate dihydrate, and 2.5 g / L polyvinylpyrrolidone, and deposit for 15 min at a constant potential of 0.25 V to obtain a three-dimensional layered silver nanomembrane, then add 10 μL of 3 μM thiol hairpin H3 to the electrode and incubate for 4-6 h, and then add MCH to prevent non-specific adsorption; (6) add 10 μL of product F1 of step (4) to the electrode and incubate at 37℃ for 1-3h; (7) finally, add 10 μL of DGB@AuNCs obtained in step (2) to the electrode and incubate at 37℃ for 1-3h.

8. Use of the ECL biosensor of any one of claims 1-7 in detecting microcystin.

9. Use according to claim 8, wherein the compound is ###0002### Place the electrode in 0.03-0.08 mM K2S2O8, and perform ECL measurement at -2V-0V with a photomultiplier tube at 700-800V.

Images