Adeno-associated virus as well as preparation method and application thereof

Abstract

The invention relates to the field of biological medicine, in particular to an adeno-associated virus as well as a preparation method and application thereof. The capsid protein of the adeno-associated virus AAV-ACM205 provided by the invention comprises a wild type AAV2 capsid protein or a variant of the wild type AAV2 capsid protein, the wild type AAV2 capsid protein or the variant of the wild type AAV2 capsid protein comprises peptide fragments with amino acid sequences as shown in SEQ ID NO.6 and SEQ ID NO.7, and a random peptide fragment is inserted between the SEQ ID NO.6 and the SEQ ID NO.7. The adeno-associated virus vector AAV-ACM205 provided by the invention can mediate a target gene to be specifically and efficiently expressed in hair cells in cochlea of an adult mouse under the condition of semicircular canal injection; the adeno-associated virus vector AAV-ACM205 mediated target gene expression is more flexible and efficient than that of a traditional transgenic method, is convenient to apply and low in cost, and has a wide prospect in ear disease gene therapy.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to an adeno-associated virus and a preparation method and use thereof. Background Art

[0002] Hearing loss is a common public health problem that affects many school-age children and the elderly. The most common type is sensorineural hearing loss, which is caused by defects in cells in the inner ear. Inner hair cells are one of the most important cell types in the inner ear, so damage to inner hair cells is also a major factor in causing sensorineural hearing loss. The function of inner hair cells is closely related to hearing and is also related to vestibular dysfunction (such as vertigo, dizziness, and imbalance). Factors such as genetic mutations, diseases, infections, ototoxic drugs, head trauma, and aging may disrupt the development, survival, or integrity of inner hair cells, causing loss of hearing and balance functions. To treat inner hair cell-related hearing loss and vestibular dysfunction, current treatments are mainly based on hearing aids and artificial implants. However, these methods are not suitable for all patients and may have limitations or complications in some cases. Therefore, gene therapy is considered a new treatment method that can provide a new way to treat inner hair cell-related diseases. Recently, highly efficient AAV viral vectors have been found to effectively infect inner hair cells in the inner ear, providing a new solution for gene therapy of inner hair cell-related diseases. Due to the high specificity and safety of this viral vector, targeted gene therapy of inner hair cells can be achieved by direct injection of the virus into the cochlea.

[0003] At present, the technology of ear gene therapy is still in its early stages and there are some shortcomings and challenges. For example, delivering gene therapy vectors to specific ear tissues is a technical challenge. Ear tissues are usually located deep in the skull, and the internal structure of the ear is complex, making effective gene delivery difficult. Current delivery methods may result in low delivery efficiency and inability to effectively deliver therapeutic genes to target cells; gene therapy technology is still a relatively expensive treatment method and may not be easily accessible in some regions and medical systems. Cost and accessibility limit the opportunity for a large number of patients to obtain ear gene therapy; some delivery vectors may be toxic to cells. This may cause adverse effects such as cell damage and cell death.

[0004] Therefore, developing new therapeutic methods targeting inner hair cells, such as gene therapy using efficient viral vectors, is an important way to treat inner hair cell-related diseases and can provide patients with more effective and safe treatment methods. Summary of the invention

[0005] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide an adeno-associated virus and a preparation method and use thereof, so as to solve the problems in the prior art that gene therapy vectors are difficult to deliver and the delivery vectors may be toxic to cells.

[0006] To achieve the above-mentioned and other related purposes, the present invention provides a capsid protein of an adeno-associated virus AAV-ACM205, wherein the capsid protein comprises a wild-type AAV2 capsid protein or a variant thereof, wherein the wild-type AAV2 capsid protein or a variant thereof comprises a peptide segment having an amino acid sequence as shown in SEQ ID NO.6 and SEQ ID NO.7, and a random peptide segment is inserted between SEQ ID NO.6 and SEQ ID NO.7.

[0007] Preferably, the amino acid sequence of the wild-type AAV2 capsid protein peptide segment is as shown in SEQ ID NO.1.

[0008] The present invention also provides a polynucleotide encoding the aforementioned capsid protein.

[0009] The present invention also provides a nucleic acid construct, which comprises the polynucleotide as described above.

[0010] The present invention also provides an adeno-associated virus, wherein the adeno-associated virus comprises the aforementioned capsid protein.

[0011] The present invention also provides a host cell, which contains the aforementioned nucleic acid construct, or has the nucleotide sequence shown in SEQ ID No. 2 integrated into its genome, or contains the aforementioned adeno-associated virus.

[0012] The present invention also provides an adeno-associated virus vector system, which comprises a packaging plasmid, and the packaging plasmid comprises the aforementioned polynucleotide.

[0013] The present invention also provides a pharmaceutical composition, which comprises the aforementioned adeno-associated virus or the aforementioned adeno-associated virus vector system and a pharmaceutically acceptable excipient.

[0014] The present invention also provides use of the aforementioned capsid protein, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus, the aforementioned host cell, the aforementioned adeno-associated virus vector system or the aforementioned pharmaceutical composition in preparing a product for treating ear diseases.

[0015] As described above, the adeno-associated virus and the preparation method and use thereof of the present invention have the following beneficial effects:

[0016] a. Provides an adeno-associated virus vector AAV-ACM205, which can mediate the efficient expression of target genes specifically in the inner hair cells of the cochlea of ​​adult mice under the condition of semicircular canal injection;

[0017] b. Adeno-associated virus vector AAV-ACM205 is more flexible and efficient than traditional transgenic methods in mediating target gene expression. It is also easy to use and low-cost, and has broad prospects in gene therapy for ear diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Shown is a schematic diagram of the plasmid map of pAAV-ACM205 of the present invention.

[0019] Figure 2 Shown is the computer-simulated AAV-ACM205 structure diagram of the present invention; a. AAV-ACM205 sequence schematic diagram; b. AAV-ACM205 structure simulation diagram.

[0020] Figure 3 The figure shows the infection of inner hair cells by different serotypes of the present invention at the same titer; wherein green shows the fluorescent protein expressed by virus infection, and magenta shows hair cell staining.

[0021] Figure 4 Shown is a statistical graph of the infection efficiency of different serotypes of the present invention on inner hair cells at the same titer.

[0022] Figure 5 Shown is a statistical graph of the expression efficiency of different serotypes of the present invention on inner hair cells at the same titer.

[0023] Figure 6 The figure shows the infection of the adeno-associated virus AAV-ACM205-CMV-EGFP of the present invention on hair cells in different regions of the inner ear; wherein green shows the fluorescent protein expressed by the virus infection, and red shows the hair cell staining.

[0024] Figure 7 Shown are the comparison results of different random peptide-inserted AAVs of the present invention. DETAILED DESCRIPTION

[0025] The present invention provides a capsid protein of an adeno-associated virus AAV-ACM205, wherein the capsid protein comprises a wild-type AAV2 capsid protein or a variant thereof, wherein the wild-type AAV2 capsid protein or a variant thereof comprises a peptide segment having an amino acid sequence as shown in SEQ ID NO.6 and SEQ ID NO.7, and a random peptide segment is inserted between SEQ ID NO.6 and SEQ ID NO.7.

[0026] In some specific embodiments, the capsid protein comprises a random peptide inserted into positions 587 and 588 of the amino acid sequence of a wild-type AAV2 capsid protein peptide or its variant; the amino acid sequence of the wild-type AAV2 capsid protein peptide is shown in SEQ ID NO.1.

[0027] In some embodiments, the random peptide segment consists of 7-11 amino acids. More specifically, the random peptide segment consists of 7, 8, 9, 10 or 11 amino acids. Preferably, the random peptide segment consists of 9 amino acids.

[0028] Furthermore, the random peptide segment comprises a peptide segment having an amino acid sequence as shown in SEQ ID NO.4: GKGTIRSEA.

[0029] In some specific embodiments, the nucleotide sequence of the polynucleotide encoding the random peptide segment is shown as SEQ ID NO.5: GGTAAGGGGACGATTCGGTCGGAGGCG.

[0030] In some embodiments, the capsid protein of the adeno-associated virus AAV-ACM205 comprises one or more of the following features:

[0031] a) the amino acid sequence of the capsid protein is shown in SEQ ID NO.3;

[0032] In the present application, the amino acid sequence defined in a) encodes an AAV capsid protein. More specifically, the AAV capsid protein encoded by the amino acid sequence defined in a) can effectively infect inner hair cells in the inner ear.

[0033] b) a polypeptide fragment having a sequence identity of 90% or more to SEQ ID No. 3 and having the function of the amino acid sequence defined in a).

[0034] Furthermore, the polypeptide fragment in b) specifically refers to: a polypeptide fragment obtained by replacing, deleting or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5 or 1-3) amino acids of the amino acid sequence as shown in SEQ ID No.3, or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5 or 1-3) amino acids at the N-terminus and / or C-terminus, and having the function of the polypeptide fragment as shown in SEQ ID No.3, and the amino acid sequence in b) may have a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more with SEQ ID No.3.

[0035] The polynucleotide corresponding to the amino acid sequence of SEQ ID No.3, i.e., the polynucleotide encoding the capsid protein shown in the amino acid sequence of SEQ ID No.3, includes one or more. In a specific embodiment, the nucleotide sequence of the polynucleotide is shown in SEQ ID No.2.

[0036] The present invention also provides a polynucleotide encoding the aforementioned capsid protein.

[0037] In some specific embodiments, the nucleotide sequence of the polynucleotide is shown as SEQ ID No.2.

[0038] The present invention also provides a nucleic acid construct, which comprises a polynucleotide encoding the aforementioned capsid protein. Specifically, the nucleic acid construct comprises a polynucleotide as shown in the nucleotide sequence SEQ ID No.2.

[0039] In some specific embodiments, the nucleic acid construct further comprises an expression vector. More specifically, the expression vector is selected from any one of pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP, pAAV-Lgr5, pAAV-Sox2, pAAV-Syn or pAAV-CMV expression vectors.

[0040] The present invention also provides an adeno-associated virus AAV-ACM205, wherein the adeno-associated virus contains the aforementioned capsid protein.

[0041] Furthermore, the adeno-associated virus AAV-ACM205 also includes a heterologous polynucleotide encoding a target product, and the heterologous polynucleotide encoding the target product can be wrapped and carried by various capsid proteins. The above-mentioned heterologous polynucleotide encoding the target product is a nucleic acid construct, and the nucleic acid construct is a nucleic acid containing the encoding target product. The nucleic acid construct is constructed by inserting the nucleic acid encoding the target product into a suitable expression vector. A person skilled in the art can select a suitable expression vector. For example, the above-mentioned expression vector is selected from any one of pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP, pAAV-Lgr5, pAAV-Sox2, pAAV-Syn or pAAV-CMV expression vectors.

[0042] Further, the encoded target product is a nucleic acid or a protein, and the nucleic acid is selected from a small guide RNA (sgRNA) and an interfering RNA (RNAi). In some embodiments, the target gene targeted by the nucleic acid includes the Pres gene, also known as the Slc26a5 gene, or the Atoh1 gene, also known as the Hath1 gene / MATH-1 gene / Math1 gene / bHLHa14 gene.

[0043] The present invention also provides a host cell, which contains the aforementioned nucleic acid construct, or has the nucleotide sequence shown in SEQ ID No. 2 integrated into its genome, or contains the aforementioned adeno-associated virus AAV-ACM205.

[0044] Further, the host cell is selected from any one of animal cells (such as CHO, COS, N2A, human cervical cancer cells such as HELA or human embryonic kidney cells such as HEK293T), plant cells, bacterial cells (such as Escherichia coli, Streptomyces, Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9). Preferably, the host cell is an animal cell, and more preferably a human cell. The host cell is a passage cell or a primary cell, i.e., a cell directly isolated from an organism (such as a human). The host cell is an adherent cell or a suspended cell, i.e., a cell growing in the form of a suspension.

[0045] The present invention also provides an engineered cell transformed by the aforementioned adeno-associated virus AAV-ACM205. The engineered cell comprises the adeno-associated virus AAV-ACM205. The cell is a eukaryotic cell and / or a prokaryotic cell.

[0046] In some specific embodiments, the eukaryotic cells are selected from animal cells, plant cells, fungal cells or insect cells; the prokaryotic cells are selected from bacterial cells; more specifically, the animal cells are selected from CHO, COS, N2A, HELA or HEK293T; the bacterial cells are selected from Escherichia coli, Streptomyces or Salmonella typhimurium.

[0047] The present invention also provides an adeno-associated virus vector system, which comprises a packaging plasmid, an expression plasmid and a helper plasmid. The packaging plasmid comprises a polynucleotide or a nucleic acid fragment such as the nucleotide sequence shown in SEQ ID NO. 2. The expression plasmid comprises a heterologous polynucleotide encoding a target product.

[0048] Furthermore, the packaging plasmid also contains a rep gene fragment of an adeno-associated virus, wherein the rep gene fragment contains an intron, and the intron contains a transcription termination sequence.

[0049] The packaging plasmid, expression plasmid, and helper virus plasmid are transferred into a host cell, and the nucleotide sequences therein are all integrated into the host cell to produce the adeno-associated virus. In some embodiments, the nucleotide sequences are all integrated together at a single locus in the host cell genome. In some embodiments, the nucleic acid sequences encoding various genes are present as separate expression cassettes, which prevent any risk of recombination to form a virus capable of replication; the polynucleotides encoding the rep and cap genes are present in the same expression cassette.

[0050] The present invention also provides an adeno-associated virus, which is obtained by virus packaging of the adeno-associated virus vector system as described above.

[0051] The present invention also provides a pharmaceutical composition, comprising the adeno-associated virus as described above and a pharmaceutically acceptable excipient. The pharmaceutical composition or conjugate is administered by a systemic route or a local route, selected from inner ear administration, ophthalmic administration, intravenous administration, intramuscular administration, subcutaneous administration, oral administration, local contact, intraperitoneal administration and intralesional administration. The pharmaceutical composition or conjugate dosage form is one or more of an injection, tablet, capsule, aerosol, eye drops or nasal drops.

[0052] The adjuvant includes various excipients and diluents, which are not necessary active ingredients and have no excessive toxicity after application. The adjuvant includes sterile water or saline, stabilizers, excipients, antioxidants (ascorbic acid, etc.), buffers (phosphoric acid, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.) or adhesives. The adjuvant also includes other low molecular weight polypeptides, serum albumin, glycine, glutamine, asparagine, arginine, polysaccharides, monosaccharides, mannitol or sorbitol. The adjuvant is selected from saline, glucose isotonic solution, D-sorbitol isotonic solution, D-mannose isotonic solution, D-mannoses or sugar alcohol isotonic solution when used for the aqueous solution of injection. The aqueous solution of injection includes a solubilizing agent. The solubilizing agent is selected from alcohol (ethanol), polyol (propylene glycol or PEG) and / or nonionic surfactant (Tween 80 or HCO-50). In the pharmaceutical composition provided by the present invention, the adeno-associated virus AAV-ACM205 is a single active ingredient, and can also be combined with one or more other active ingredients useful for treating ear diseases to form a combined preparation. The active ingredient is other various drugs for treating ear diseases. The content of the active ingredient in the pharmaceutical composition is a safe and effective amount, which should be adjustable by those skilled in the art. For example, the dosage of the adeno-associated virus AAV-ACM205 and the active ingredient of the pharmaceutical composition depends on the patient's weight, the type of application, the condition and severity of the disease. For example, the dosage of the bifunctional compound as an active ingredient is 1-1000 mg / kg / day, 1-3 mg / kg / day, 3-5 mg / kg / day, 5-10 mg / kg / day, 10-20 mg / kg / day, 20-30 mg / kg / day, 30-40 mg / kg / day, 40-60 mg / kg / day, 60-80 mg / kg / day, 80-100 mg / kg / day, 100-200 mg / kg / day, 200-500 mg / kg / day, or greater than 500 mg / kg / day. The present invention also provides a conjugate, which includes the adeno-associated virus AAV-ACM205 as described above or a linked biologically active polypeptide.

[0053] The present invention also provides use of the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system or the aforementioned pharmaceutical composition in preparing an ear treatment product.

[0054] In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system or the aforementioned pharmaceutical composition of the present invention is suitable for treating and / or preventing diseases or conditions associated with the external ear, the middle ear and / or the inner ear. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system or the aforementioned pharmaceutical composition of the present invention is suitable for treating and / or preventing diseases or conditions associated with the external ear. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system or the aforementioned pharmaceutical composition of the present invention is suitable for treating and / or preventing diseases or conditions associated with the middle ear. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system or the aforementioned pharmaceutical composition of the present invention is suitable for treating and / or preventing diseases or conditions associated with the inner ear. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system or the aforementioned pharmaceutical composition of the present invention reduces, reverses and / or improves symptoms of ear diseases or conditions, such as any of those disclosed in the present invention. These disorders or conditions have many causes, including infection, injury, inflammation, tumors, and adverse responses to drugs or other chemical agents.

[0055] In some embodiments, the adeno-associated virus, the polynucleotide, the nucleic acid construct, the adeno-associated virus vector system or the pharmaceutical composition of the present invention can be used to treat ear itching, otitis externa, ear pain, tinnitus, vertigo, ear fullness, hearing loss or a combination thereof. In some embodiments, the adeno-associated virus, the polynucleotide, the nucleic acid construct, the adeno-associated virus vector system or the pharmaceutical composition of the present invention is used to treat and / or prevent Meniere's disease, sensorineural hearing loss, noise-induced hearing loss, presbycusis (age-related hearing loss), autoimmune ear disease, tinnitus, ototoxicity, excitotoxicity, endolymphatic hydrops, labyrinthitis, Ramsay Hunt syndrome, vestibular neuronitis, microvascular compression syndrome, hyperacusis, presbystasis, central auditory processing disorder or auditory neuropathy.

[0056] In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for treating Meniere's disease. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for treating sensorineural hearing loss. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for treating noise-induced hearing loss. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for treating presbycusis (age-related hearing loss). In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for treating autoimmune ear diseases. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for treating tinnitus. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated viral vector system, or the aforementioned pharmaceutical composition is used to prepare an ototoxicity treatment product. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated viral vector system, or the aforementioned pharmaceutical composition is used to treat excitotoxicity treatment products. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated viral vector system, or the aforementioned pharmaceutical composition is used to prepare an endolymphatic hydrops treatment product. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated viral vector system, or the aforementioned pharmaceutical composition is used to prepare a labyrinthitis treatment product. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated viral vector system, or the aforementioned pharmaceutical composition is used to prepare a Ramsay Hunt syndrome treatment product. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated viral vector system, or the aforementioned pharmaceutical composition is used to prepare a vestibular neuronitis treatment product. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system or the aforementioned pharmaceutical composition is used to prepare a product for treating microvascular compression syndrome. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system or the aforementioned pharmaceutical composition is used to prepare a product for treating hyperacusis.In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for treating senile balance disorders. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for treating central auditory processing disorders. In some embodiments, the aforementioned adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for treating auditory neuropathy. In some embodiments, the aforementioned adeno-associated virus, the aforementioned adeno-associated virus vector system, or the aforementioned pharmaceutical composition is used to prepare a product for improving the performance of cochlear implants.

[0057] The present invention also provides a method for treating ear diseases, the method comprising administering an effective amount of the adeno-associated virus, the aforementioned polynucleotide, the aforementioned nucleic acid construct, the adeno-associated virus vector system, the pharmaceutical composition or the conjugate of the present invention to a subject in need thereof. A physician can determine the actual dosage that is most suitable for a single patient and it will vary according to the age, weight and response of a specific individual.

[0058] In the present invention, the adeno-associated virus, the adeno-associated virus vector system or the pharmaceutical composition of the present invention can be administered to a patient. A person skilled in the art can determine the appropriate administration method and dosage.

[0059] The delivery of one or more therapeutic genes via the adeno-associated virus of the present invention can be used alone or in combination with other therapeutic methods or therapeutic components.

[0060] The adeno-associated virus of the present invention is used to infect cells, thereby delivering genes and / or linked (e.g., but not limited to, covalently linked) biologically active polypeptides to cells. Therefore, the present invention provides a method for delivering heterologous genes to cells, the method infecting cells by allowing one or more adeno-associated viruses or conjugates of the present invention to the cells, wherein the fusion adeno-associated virus or conjugate comprises one or more heterologous genes.

[0061] The present invention also provides a method for producing a stable adeno-associated virus vector production cell line, comprising:

[0062] (I) introducing an adeno-associated virus vector as defined herein into a culture of animal host cells; and / or,

[0063] (II) selecting within the culture mammalian host cells that have the nucleic acid sequence encoded on the vector integrated into an endogenous chromosome of the animal host cell.

[0064] The AAV vector production cell is an animal cell. In some embodiments, the animal cell is selected from HEK293 cells, CHO cells, Jurkat cells, K562 cells, PerC6 cells, HeLa cells or derivatives thereof. In some embodiments, the animal host cell is a HEK293 cell, or is derived from a HEK293 cell. In some embodiments, the HEK293 cell is a HEK293T cell.

[0065] The genomic sequences of various serotypes of AAV, as well as the sequences of native ITRs, Rep proteins, and capsid proteins are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. The disclosures thereof are incorporated herein by reference for AAV nucleic acid and amino acid sequences.

[0066] In the compounds of the present invention and their use, when the adeno-associated virus is used in combination with other therapeutic agents, the active compound is co-administered with the other therapeutic agents. "Co-administered" means administered simultaneously in the same formulation or in two different formulations via the same or different routes, or administered sequentially via the same or different routes. "Sequential" administration means that there is a time difference of seconds, minutes, hours or days between the administration of two or more different compounds.

[0067] In certain embodiments, the adeno-associated viruses and methods of the invention can be used to prevent lung disease and can be administered as a prophylactic treatment prior to lung injury or after a period of time after exposure to an environment that predisposes to lung injury.

[0068] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one skilled in the art.

[0069] The term "nucleic acid construct" refers to a polynucleotide formed by polymerization of deoxyribonucleotides or ribonucleotides. In this application, "nucleic acid" also refers to a "nucleic acid construct".

[0070] The term "vector" refers to a macromolecule or combination of macromolecules that contains or is associated with a polypeptide and can be used to mediate the delivery of the polypeptide to a cell. Illustrative vectors include, for example, plasmids, viral vectors, liposomes or other gene delivery vectors.

[0071] The term "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or its derivatives.

[0072] The term "recombinant AAV vector" refers to an AAV vector containing a heterologous polynucleotide sequence, usually a sequence of interest for genetic transformation of cells. Generally, the heterologous polynucleotide is flanked by at least one, usually two, AAV inverted terminal repeats (ITRs).

[0073] The term "AAV virus" or "AAV viral particle" or "AAV vector particle" refers to a viral particle of an AAV vector comprising at least one AAV capsid protein and an encapsidated polynucleotide.

[0074] The term "packaging" refers to the series of intracellular processes that lead to the assembly and encapsulation of AAV particles.

[0075] The terms AAV "rep" and "cap" genes refer to polynucleotide sequences encoding replication and packaging proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes".

[0076] The term "helper virus" of AAV refers to a virus that enables AAV to be replicated and packaged by mammalian cells. Various such AAV helper viruses are known in the art, including adenovirus, herpes virus, and pox virus (eg, vaccinia).

[0077] The term "infectious" virus or viral particle is one that contains a polynucleotide component capable of delivering the virus to cells tropistic for that virus species. The term does not necessarily imply that the virus has any ability to replicate.

[0078] The term "producer cell" refers to a cell line that has the AAV packaging genes (rep and cap genes), required helper viral genes, and the DNA genome of the recombinant AAV vector (e.g., the transgene of interest flanked by two AAV inverted terminal repeats (ITRs)) stably integrated into the host cell genome.

[0079] The terms "include", "including", etc. should be understood as having an inclusive meaning rather than an exclusive or exhaustive meaning; that is, the meaning is "including but not limited to".

[0080] The term "subject" generally includes humans, non-human primates, such as mammals, dogs, cats, horses, sheep, pigs, cows, etc., who can benefit from treatment using the formulation, kit or combination formulation.

[0081] The term "therapeutically effective amount" generally refers to an amount that can achieve the effect of treating the diseases listed above after an appropriate administration period.

[0082] The terms "therapeutic" and "prophylactic" are to be understood in their broadest sense. The term "therapeutic" does not necessarily imply that the mammal is treated until full recovery. Similarly, "prophylactic" does not necessarily mean that the subject will not eventually contract a disease condition. Thus, treatment and prevention include alleviating the symptoms of a particular condition or preventing or reducing the risk of a particular condition developing. The term "prevention" may be understood as reducing the severity of an attack of a particular condition. Treatment may also reduce the severity of an existing condition or the frequency of acute attacks.

[0083] In the present invention, the subject or individual for therapeutic or preventive treatment is preferably a mammal, such as, but not limited to, a human, a primate, livestock (such as sheep, cattle, horses, donkeys, pigs), a pet (such as dogs, cats), a laboratory test animal (such as mice, rabbits, rats, guinea pigs, hamsters), or a captured wild animal (such as foxes, deer). The subject is preferably a primate. The subject is most preferably a human.

[0084] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0085] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0086] When the embodiments give numerical ranges, it should be understood that unless otherwise specified in the present invention, the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the technical staff of the present art's grasp of the prior art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to implement the present invention. The sequence information used in this application is as follows:

[0087] SEQ ID No.1

[0088] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL*

[0089] SEQ ID No.2

[0090]

[0091] SEQ ID No.3

[0092] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNGKGTIRSEARQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL*

[0093] SEQ ID NO.4:GKGTIRSEA

[0094] SEQ ID NO.5:GGTAAGGGGACGATTCGGTCGGAGGCG

[0095] SEQ ID NO.6:SVSTNLQRGN

[0096] SEQ ID NO.7:RQAATADVNTQG

[0097] SEQ ID NO.8:RPSVGTSSP

[0098] SEQ ID NO.9:RSSESLAGE

[0099] SEQ ID No.10:

[0100]

[0101] SEQID No.11:

[0102]

[0103] Example 1 Obtaining adeno-associated virus AAV-ACM205

[0104] a. Construction of Rep-Cap plasmid of AAV-ACM205

[0105] The serotype of AAV is determined by the sequence of the Cap protein in the Rep-Cap plasmid required for AAV packaging. Therefore, AAVs produced by packaging with different Cap sequences have different infection tropisms. The existing natural serotype was modified by inserting a random peptide with a length of 9 amino acids between the 587 and 588 positions of the amino acid sequence Seq ID No.1 derived from AAV2. Figure 2 a) thereby producing a new AAV serotype, whose nucleotide sequence is Seq ID No. 2 and amino acid sequence is Seq ID No. 3. The computer simulated AAV-ACM205 structure is as follows Figure 2 As shown, the outer surface of the capsid shows the presence of capsid fragments from the inserted polypeptide, indicating that the three-fold symmetric axis projection of AAV-ACM205 is affected by the inserted sequence. The sequence of the plasmid encoding gene of pAAV-ACM205 was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and its nucleotide sequence is shown in SEQ ID No. 10, namely pAAV-ACM205 ( Figure 1 ).

[0106] b. Preparation and purification of rAAV-ACM205 virus

[0107] The obtained Rep-Cap plasmid pAAV-ACM205 and the genomic plasmid pAAV-CMV-EGFP expressing a green fluorescent protein EGFP, whose nucleotide sequence is shown in SEQ ID No. 11, and the pHelper plasmid were co-transfected into HEK-293T cells, and the AAV virus was purified by iodixanol gradient ultracentrifugation. The final product was adeno-associated virus rAAV-ACM205 that can express the reporter gene EGFP. The virus titer was measured at 2E+13GC / mL as the appropriate concentration, and it was placed at -80°C for use.

[0108] Example 2 In vivo verification of adeno-associated virus rAAV-ACM205 in the auditory system

[0109] The adeno-associated viruses used in the experiment were delivered into the cochlea of ​​adult mice by microinjection into the posterior semicircular canal using a glass electrode. The adeno-associated viruses selected in the experiment were AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, AAV2.7m8 commonly used for ear cell infection (see Isgrig K, McDougald DS, Zhu J, Wang HJ, Bennett J, Chien WW. AAV2.7m8 is a powerful viral vector for inner ear gene therapy. Nat Commun. 2019; 10(1): 427. Published 2019 Jan 25.) and AAV-ACM205.

[0110] The specific experimental method is as follows: a) Weigh the P30 mice, inject an appropriate amount of sodium pentobarbital intraperitoneally to anesthetize the mice, and after the mice completely lose consciousness and mobility, use depilatory cream and shaver to remove the hair behind the right ear of the mice to expose the skin behind the ear. b) Use iodine tincture and 75% alcohol to thoroughly disinfect the exposed skin, carefully cut the subcutaneous tissue behind the ear with Venus scissors, and then tear the subcutaneous fat tissue with surgical forceps disinfected with 75% alcohol, and carefully search deep to avoid damaging the surrounding blood vessels and nerves until the posterior semicircular canal is exposed. c) Carefully tear open the muscle tissue and membrane structure on the posterior semicircular canal, and use pointed surgical forceps to chisel an opening on the posterior semicircular canal with a diameter equivalent to the glass tube for injection. Place the tip of the glass tube into the opening, slowly inject 1μl of virus in the tube, and slowly remove the glass tube after one minute of rest. e) After injection, first use veterinary tissue glue to glue the opening at the posterior semicircular canal, and then use sutures to suture the wounds of the skin and muscles. Subsequently, the mice were placed on a 37°C constant temperature heating pad after surgery and returned to the animal room for breeding after they woke up naturally. Any damaged cochleae would not be used for subsequent research. 14 days after virus injection, cochlear tissue was collected and immunofluorescence staining was performed to analyze viral infection.

[0111] like Figure 3 , Figure 4 and Figure 5 As shown in the figure, at the same titer, rAAV-ACM205 has an infection efficiency of almost 100% compared with wild-type AAV2 and modified AAV2.7m8 commonly used in the ear, but its fluorescence intensity of infection of inner hair cells is much higher than these two viruses; and compared with wild-type viruses such as AAV1, AAV5, AAV6, AAV8, and AAV9, rAAV-ACM205 has outstanding advantages in both infection efficiency and infection fluorescence intensity. Figure 3 The infection efficiency of each vector on inner hair cells and Figure 5The fluorescence intensity of each vector infecting inner hair cells at the same titer. This shows that compared with other common serotypes, rAAV-ACM205 has a higher infection rate on the inner hair cells of the cochlea at the same titer and can be used for otologic gene therapy.

[0112] Further analysis of the infection direction of rAAV-ACM205 on ear hair cells Figure 6 As shown, rAAV-ACM205 can effectively infect the apex, middle and base layers of the inner hair cells of the cochlea. Therefore, adeno-associated virus AAV-ACM205 has broad prospects for gene therapy in otology.

[0113] Example 3 Comparison of adeno-associated virus rAAV-ACM205 and other peptide-inserted AAVs

[0114] Referring to Example 1, a peptide segment having an amino acid sequence of SEQ ID NO.8 or SEQ ID NO.9 was inserted between positions 587 and 588 of the amino acid sequence Seq ID No.1 derived from AAV2, and the corresponding AAV virus was prepared.

[0115] Referring to Example 2, the adeno-associated virus for the experiment was delivered into the cochlea of ​​adult mice by microinjection of the posterior semicircular canal using a glass electrode. Figure 7 As shown in the figure, AAVs inserted with different peptides can infect inner hair cells, but the insertion of different peptides will obviously have different infection efficiencies, among which the infection efficiency of adeno-associated virus rAAV-ACM205, i.e., the peptide inserted with the amino acid sequence shown in SEQ ID No.3, is significantly stronger than the peptide inserted with the amino acid sequence shown in SEQ ID No.9, and the peptide inserted with the amino acid sequence shown in SEQ ID No.9 is stronger than the peptide inserted with the amino acid sequence shown in SEQ ID No.8, and the infection efficiency of adeno-associated virus rAAV-ACM205 is close to 100%, which indicates that the insertion of a polypeptide between the 587 and 588 sites of the amino acid sequence Seq ID No.1 derived from AAV2 can infect inner hair cells, but the effect of inserting the peptide inserted with the amino acid sequence shown in SEQ ID No.3 is the most significant.

[0116] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. A capsid protein of an adeno-associated virus AAV-ACM205, characterized in that: The capsid protein comprises a wild-type AAV2 capsid protein or a variant thereof, and the wild-type AAV2 capsid protein or a variant thereof comprises a peptide segment having an amino acid sequence as shown in SEQ ID NO.6 and SEQ ID NO.7, and a random peptide segment is inserted between SEQ ID NO.6 and SEQ ID NO.

7.

2. The capsid protein according to claim 1, characterized in that The amino acid sequence of the wild-type AAV2 capsid protein peptide segment is shown in SEQ ID NO.

1.

3. The capsid protein according to claim 1, characterized in that The random peptide segment consists of 7-11 amino acids.

4. The capsid protein according to claim 3, characterized in that The amino acid sequence of the random peptide segment is shown in SEQ ID NO.

4.

5. The capsid protein according to claim 1, characterized in that: a) the amino acid sequence of the capsid protein is shown in SEQ ID NO.3; or, b) a polypeptide fragment having a sequence identity of 90% or more to SEQ ID No. 3 and having the function of the amino acid sequence defined in a).

6. A polynucleotide, characterized in that The polynucleotide encodes the capsid protein according to any one of claims 1 to 5.

7. The polynucleotide according to claim 6, characterized in that The nucleotide sequence of the polynucleotide is shown as SEQ ID No.

2.

8. A nucleic acid construct, characterized in that The nucleic acid construct comprises the polynucleotide of claim 6 or 7.

9. An adeno-associated virus, characterized in that The adeno-associated virus comprises the capsid protein according to any one of claims 1-5.

10. A host cell, characterized in that The host cell contains the nucleic acid construct according to any one of claim 8, or has the polynucleotide according to claim 6 or 7 integrated into its genome, or contains the adeno-associated virus according to claim 9.

11. An adeno-associated virus vector system, characterized in that: The adeno-associated virus vector system comprises a packaging plasmid, and the packaging plasmid comprises the polynucleotide according to claim 6 or 7.

12. The adeno-associated virus vector system according to claim 11, characterized in that: The packaging plasmid also contains a rep gene segment of an adeno-associated virus; And / or, the adeno-associated virus vector system further comprises an expression plasmid, wherein the expression plasmid comprises a heterologous polynucleotide responsible for encoding a target product; And / or, the adeno-associated virus vector system further includes a helper virus plasmid or a helper virus.

13. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the adeno-associated virus of claim 9 or the adeno-associated virus vector system of claim 11 or 12 and a pharmaceutically acceptable excipient.

14. Use of the capsid protein of any one of claims 1-5, the polynucleotide of any one of claims 6-7, the nucleic acid construct of claim 8, the adeno-associated virus of claim 9, the host cell of claim 10, the adeno-associated virus vector system of any one of claims 11-12, or the pharmaceutical composition of claim 13 in the preparation of a product for treating ear diseases.

15. The use according to claim 14, characterized in that The ear disease is selected from one or more of Meniere's disease, sensorineural hearing loss, noise-induced hearing loss, age-related hearing loss, autoimmune ear disease, tinnitus, endolymphatic hydrops, labyrinthitis, Ramsay Hunt syndrome, vestibular neuronitis, microvascular compression syndrome, hyperacusis, senile balance disorder, central auditory processing disorder or auditory neuropathy.

Images