Recombinant vector of over-expression Tgm2 gene, recombinant CHO cell and application of recombinant vector in improvement of foreign protein expression

Abstract

The invention provides a recombinant vector for overexpressing a Tgm2 gene, a recombinant CHO cell and application of the recombinant vector and the recombinant CHO cell in improvement of exogenous recombinant protein expression, and belongs to the technical field of genetic engineering. The gene Tgm2 for coding transglutaminase 2 has the effect of improving the expression level of exogenous recombinant protein in mammalian cells creatively; an overexpression vector of the gene Tgm2 is transfected to CHO cells to construct the CHO cell line for overexpressing the Tgm2, the CHO cell line can remarkably improve the mRNA and protein expression level of the Tgm2, meanwhile, the CHO cell line serves as a host cell for recombinant protein expression, compared with a wild type CHO cell line, the expression quantity of recombinant protein can be increased, and the expression level of the recombinant protein can be increased. The problem that the expression level of an existing CHO cell expression system is low is effectively solved.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and particularly relates to a recombinant vector for overexpressing a Tgm2 gene, a recombinant CHO cell and an application thereof in improving the expression of foreign proteins. Background Art

[0002] Chinese hamster ovary (CHO) cells are currently the most widely used mammalian cell expression system, but they still have prominent problems such as low recombinant protein expression and heterogeneity, and cannot meet the growing demand for vaccine development, clinical therapeutic drugs and gene therapy. Therefore, using gene and cell engineering methods to conduct CHO cell recombinant expression research is of great significance and application value for improving its transgenic expression level and expression stability and establishing a high-yield and stable recombinant protein CHO cell expression system.

[0003] Transglutaminase 2 (Tgm2) is an important cytoplasmic enzyme that is widely involved in various cellular biological processes, including cell proliferation, apoptosis, autophagy, and remodeling of the extracellular matrix. It plays a role in cell proliferation and survival by regulating multiple cell signaling pathways. However, studies on the effect of Tgm2 on recombinant protein expression in cells have not been reported. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a recombinant vector overexpressing the Tgm2 gene, a recombinant CHO cell and its use in increasing the expression of exogenous proteins. The present invention finds that overexpressing the Tgm2 gene in CHO cells can promote the expression of exogenous recombinant proteins and increase the expression level of exogenous recombinant proteins.

[0005] The present invention provides application of gene Tgm2 in improving the expression of exogenous protein in mammalian cells. The nucleotide sequence of gene Tgm2 is shown as SEQ ID No.1.

[0006] Preferably, the mammalian cell is a CHO cell.

[0007] Preferably, the purpose of increasing the expression of exogenous proteins in CHO cells is achieved by overexpressing the gene Tgm2 in the CHO cells.

[0008] The invention provides a recombinant vector for overexpressing gene Tgm2, comprising a starting vector and gene Tgm2, wherein the starting vector is a piggyBac vector.

[0009] Preferably, the gene Tgm2 is inserted into the downstream position of the LAC promoter of the starting vector.

[0010] The present invention provides a recombinant CHO cell over-expressing gene Tgm2, which is obtained by transfecting the recombinant vector into the initial CHO cell.

[0011] The present invention provides the use of the recombinant CHO cells in the expression of foreign proteins.

[0012] The invention provides a recombinant protein expression system, comprising the recombinant vector, transposase, host cell CHO and an overexpression vector of a target recombinant protein encoding gene.

[0013] The present invention also provides another recombinant protein expression system, comprising the recombinant CHO cell and an overexpression vector of a target recombinant protein encoding gene.

[0014] Preferably, the target recombinant protein includes recombinant adalimumab.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention creatively discovered that the gene Tgm2 encoding transglutaminase 2 has the effect of increasing the expression level of exogenous recombinant proteins in mammalian cells. Therefore, a recombinant vector overexpressing the gene Tgm2 is used to construct a recombinant protein expression system to increase the expression amount of the recombinant protein. The present invention transfects the gene Tgm2 overexpression vector into CHO cells to construct a CHO cell line overexpressing Tgm2. The CHO cell line can significantly increase the mRNA and protein expression levels of Tgm2. At the same time, the CHO cell line is used as a host cell for recombinant protein expression. Compared with the wild-type CHO cell line, the expression amount of the recombinant protein can be increased, which effectively overcomes the problem of low expression level in the current CHO cell expression system. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a schematic diagram of the structure of the Tgm2 overexpression vector constructed in Example 1 of the present invention;

[0018] Figure 2 This is a graph showing the relative expression of Tgm2 mRNA overexpressed in CHO cells detected by qPCR in Example 3 of the present invention; wherein Control: normal CHO cell control group, OE Tgm2: CHO cell group overexpressing Tgm2;

[0019] Figure 3 This is a graph showing the results of Western blot detection of overexpressed Tgm2 protein in CHO cells in Example 3 of the present invention; Control: normal CHO cell control group, OE Tgm2: CHO cell group overexpressing Tgm2;

[0020] Figure 4This is a graph showing the result of using a cell counter to detect the density of live cells overexpressing Tgm2 in CHO cells in Example 4 of the present invention;

[0021] Figure 5 This is a graph of the proliferation of CHO cells overexpressing the Tgm2 gene constructed in Example 2 detected by the CCK-8 method in Example 4 of the present invention;

[0022] Figure 6 This is a graph showing the results of Western blot analysis of the expression of recombinant adalimumab in normal CHO cells and CHO cells overexpressing Tgm2 in Example 5 of the present invention. DETAILED DESCRIPTION

[0023]

[0024] In the present invention, the mammalian cell is preferably a CHO cell. The present invention preferably achieves the purpose of increasing the expression of foreign proteins in CHO cells by overexpressing the gene Tgm2 in the CHO cells.

[0025] The present invention provides a recombinant vector for overexpressing gene Tgm2 encoding transglutaminase 2, comprising a starting vector and gene Tgm2, wherein the starting vector is a piggyBac vector. In the present invention, the gene Tgm2 is preferably inserted into the downstream position of the LAC promoter of the starting vector. The present invention has no special limitation on the method of inserting the gene Tgm2 into the starting vector, and methods well known in the art may be used. In the specific implementation of the present invention, it is preferably carried out by enzyme cutting and connection. In the present invention, the piggyBac vector is preferably purchased from Haixing Biotechnology Co., Ltd. The structural schematic diagram of the recombinant vector for overexpressing gene Tgm2 in the present invention is shown as follows Figure 1 shown.

[0026] The present invention also provides a recombinant CHO cell that overexpresses the gene Tgm2 encoding transglutaminase 2, which is obtained by transfecting the recombinant vector in the initial CHO cell. The present invention uses a Tgm2 overexpression vector constructed by a starting vector piggyBac vector having a transposon element, and continuously and efficiently catalyzes the integration of the Tgm2 overexpression vector into the gene of the CHO cell by the transposase, thereby achieving stable overexpression of Tgm2 in the CHO cell. In the present invention, the transfection preferably adopts a liposome transfection method.

[0027] The present invention also provides the use of the recombinant CHO cells in the expression of exogenous proteins. The recombinant CHO cells constructed by the present invention can improve the ability of host cells to express exogenous recombinant proteins and increase the yield of exogenous recombinant proteins due to overexpression of the gene Tgm2 in the CHO cells. The present invention does not specifically limit the specific type of the exogenous recombinant protein, and any exogenous recombinant protein can be used.

[0028] The present invention also provides a recombinant protein expression system, comprising the recombinant vector, transposase, host cell CHO and an overexpression vector of a target recombinant protein encoding gene.

[0029] The present invention also provides another recombinant protein expression system, comprising the recombinant CHO cell and an overexpression vector of a target recombinant protein encoding gene.

[0030] In the present invention, the target recombinant protein preferably includes recombinant adalimumab.

[0031] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0032] Example 1

[0033] Construction of overexpression vector of gene Tgm2

[0034] 1) According to the sequence of Chinese hamster Tgm2 in NCBI GenBank (No.: NW003613641) and the design principles of expression vectors, the nucleic acid fragment sequence encoding Tgm2 was designed as shown in SEQ ID NO.1;

[0035] 2) Using piggyBac vector (purchased from Haixing Biotechnology Co., Ltd.) as the starting vector, 2 μg of piggyBac vector was digested with 2 μl of SmalHI and BamHI, and 5 μl of the digested vector was connected with 5 μl of the purified target fragment to insert the target sequence downstream of the LAC promoter of piggyBac. The nucleic acid fragment synthesized in step 1) was inserted downstream of the LAC promoter of the starting vector to construct a transposon vector expressing Tgm2. Its structural schematic diagram is shown in the figure Figure 1 shown.

[0036] Example 2

[0037] Construction of CHO cell line overexpressing Tgm2 gene

[0038] 1) Prepare cells for transfection: CHO-S cells from Life Technologies (#A11557-01; Carlsbad, USA) were grown in DMEM / F12 medium containing 10% inactivated fetal bovine serum at 37°C and 5% CO2. Before transfection, 4.0×10 5 CHO-S cells were seeded in 12-well culture plates and used for cell transfection when the cell confluence reached about 85% after 24 h of culture.

[0039] 2) Transfection: Before transfection, the medium was changed to 1 mL of serum-free medium, 100 μL of DMEM / F12 medium was added, and the transposon vector expressing Tgm2 constructed in Example 1 (1.2 μg / well) was transfected into the cells prepared according to step) by liposome transfection under the action of transposase to construct a Tgm2 overexpressing CHO cell line as the over expression (OE) group;

[0040] Using liposome transfection method, only the starting vector piggyBac is transfected into the cells prepared in step 1) under the action of transposase, as a control group (control);

[0041] Liposome transfection method is as follows:

[0042] ① Taking a 12-well plate as an example, take a 1.5 ml centrifuge tube and mark the vector name, add 100 μL of basic DMEM / F12 medium into the tube, then take 1.2 μg of the Tgm2 overexpression vector constructed in Example 1 and 0.4 μg of transposase, add them into the tube respectively, mix well, and let stand at room temperature for 5 minutes;

[0043] ②Take another centrifuge tube, mark it as the transfection reagent tube, add 100 μL of basic DMEM / F12 medium into the tube, then add 4 μL of transfection reagent Lip2000 into the tube, mix thoroughly, and let stand at room temperature for five minutes;

[0044] ③ Add the mixed solution in step ② dropwise into the plasmid tube in step 1, mix thoroughly, and let stand at room temperature for 20 minutes.

[0045] ④ Take out the cells plated for transfection the day before from the incubator, discard the old culture medium, wash each well twice with 1× PBS buffer, and then add 1 ml of new DMEM / F12 reduced serum culture medium without double antibody;

[0046] ⑤ Add the mixed solution in step ③ to the wells, gently shake the culture plate to evenly distribute the mixed solution, and then place it in the incubator for culture. After incubation for 5 hours, remove the culture plate and replace with fresh complete culture medium to continue culture;

[0047] 3) Screening: 48 hours after transfection, hygromycin (hygro) screening was used. When the cell confluence reached 80%, the cells were passaged at a ratio of 1:2 to 1:3, and hygromycin screening and culture were continued to obtain a cell line with stable expression after transfection.

[0048] Example 3

[0049] Overexpression efficiency detection

[0050] The normal CHO cell control group (Control) and the CHO cell group (OE) with stable expression screened after transfection were collected respectively, and the expression level of Tgm2 in each group was detected at the mRNA level by qPCR experiment. The specific experimental method is as follows:

[0051] 1) qPCR experiments

[0052] Design and synthesize primers for qPCR detection of target gene Tgm2 and internal reference gene β-actin respectively Tgm2

[0053] F: TCAACGCTGATGTGGTGGACTG (SEQ ID NO. 2);

[0054] R: GGGTACTTGTAGGTGTGGGGTGATG (SEQ ID NO.3)

[0055] β-actin

[0056] F: GTCGTACCACTGGCATTGTG (SEQ ID NO.4);

[0057] R:AGGGCACATAGCACAGCTT(SEQ ID NO.5)

[0058] The cultured CHO cell lines of the Control group and OE group were collected, and the total RNA of each group of cells was extracted with Trizol, and then the total RNA was reverse transcribed into cDNA using the HiScript IIQ RT SuperMix for qPCR (+gDNA wiper) kit (purchased from Nanjing Novozymes Biotech Co., Ltd.). The cDNA was diluted at a ratio of 1:4 and used as a template; a 20.0μL reaction system was used: 10.0μL of SYBR GreenMix, 2.0μL of diluted template, 1.0μL of primers (F / R), and 6.0μL of enzyme-free water were added. The reaction conditions were: pre-denaturation at 95℃ for 30s, amplification stage (95℃ for 10s, 60℃ for 30s, and 45 cycles of reactions). The melting curve stage was 95℃ for 15s, and 60-95℃ for 1min. Finally, according to 2 -△△CT The relative expression of Tgm2 mRNA was calculated by the algorithm. Figure 2 As shown, the mRNA expression level of Tgm2 in the CHO cell line of the OE group was significantly increased to 2.94±0.29 times that of the CHO cells of the control group.

[0059] 2) Western blot experiment

[0060] Western blot was used to analyze the expression of Tgm2 protein in the CHO cell lines of the OE group and the control group. Specifically, the cells were washed twice with ice-cold PBS, and the cells were lysed with RIPA buffer. The culture supernatants of the two groups of CHO cells were added to 5×SDS sample buffer and boiled in a water bath for 10 minutes to fully denature. 10 μL of protein samples were taken respectively and separated by 10% SDS-PAGE gel electrophoresis, and then transferred to nitrocellulose membranes by wet transfer. The membrane was blocked in 5% skim milk TBST buffer for 2 hours, and incubated with Anti-Tgm2 (1:1000) and Anti-β-actin (1:1000) overnight, and then incubated with Anti-Rabbit IgG (1:10000) for 2 hours. After washing the membrane three times with TBST, chemiluminescent colorimetric solution was added for development, and the image results were observed and collected on a gel imager to analyze the expression level of the protein to be tested. The results are shown in Figure 2. Figure 3 As shown, the expression level of Tgm2 protein in the CHO cells of the OE group was significantly increased compared with that in the CHO cells of the Control group.

[0061] Example 4

[0062] Verification of biological characteristics of CHO cell lines overexpressing Tgm2 gene

[0063] By detecting cell biological characteristics such as cell proliferation, it was verified whether CHO cells overexpressing the Tgm2 gene could grow and subculture normally; specifically, the cell growth characteristics of the CHO cell lines in the Control group and the OE group were compared and verified, including observation of cell morphology and growth status, suspension counting to detect viable cell density (viable cells), and CCK-8 method to detect cell proliferation.

[0064] CHO cells in the Control group and OE group were cultured at 5×10 5 / mL suspension for 7 days, and cells were collected every day. The density of live cells was detected by BioTech cell counter (Shanghai Ruiyu Biotechnology Co., Ltd.). Cell proliferation was detected by CCK-8 kit (Cell Counting Kit-8 kit, Beyotime Biological Company);

[0065] The results are as follows Figure 4 and Figure 5 As shown, the biological characteristics such as cell growth status, morphology, cell proliferation, and viable cell density of the CHO cell line overexpressing the Tgm2 gene (OE group) were compared with those of the Control group cells. Cell growth and cell proliferation were enhanced, indicating that the CHO cell line overexpressing Tgm2 can grow, proliferate, and be subcultured normally.

[0066] Example 5

[0067] Recombinant protein expression

[0068] In this example, the CHO cell line overexpressing Tgm2 screened and verified in Example 2 was applied to recombinant protein expression, including construction of a recombinant protein expression system. The specific construction process is as follows:

[0069] 1) Construction of recombinant adalimumab eukaryotic expression vector

[0070] The element sequences required for constructing the eukaryotic expression vector include CMV promoter, SV40 polyA, IRES, EF-1α promoter, HC chain and LC chain of adalimumab, blasticidin (BSD) resistance gene, and puromycin (Puro) resistance gene sequence, which were synthesized by General Biotechnology (Anhui) Co., Ltd. First, the LC and HC sequences were cloned into the promoters EF2 / CMV and CMV / EF1 of the pCHO1.0 expression vector (Thermo Fisher Scientific) to obtain the control eukaryotic expression vector pCHO-HL. Subsequently, the CMV promoter and BSD resistance gene sequences were used to replace the pEF2 / CMV-LC-polyA-pCMV / EF1 and Puro sequences in the pCHO-HL expression vector, respectively, to construct the vector pHC-BSD. Then, the HC and BSD resistance gene sequences in the pHC-BSD vector were replaced with the LC and Puro resistance gene sequences, respectively, to construct the pLC-Puro vector. Finally, the LC-polyA-EF-1α expression cassette was cloned into the pHC-BSD vector to construct the pLC-pHC dual-promoter eukaryotic expression vector for expressing adalimumab.

[0071] 2) Transfection and recombinant protein expression detection

[0072] The eukaryotic expression vector constructed in step 1) was transfected into CHO cells of OE group and Control group respectively, and the transfected cells were cultured in a medium containing oryzacidin (1 mg / mL) for 15 days to screen the stably transfected recombinant cell pool. The recombinant CHO cells were then cultured in a six-well plate with 3 mL of protein-free, serum-free, chemically defined CD CHO medium (Henan Punoyi Biological Products Research Institute Co., Ltd.) for 7 days, and the cells were collected every day. The cell density and viability were detected by BioTech cell counter (Shanghai Ruiyu Biotechnology Co., Ltd.), and the supernatant was collected by centrifugation on the 7th day and quantified with the same cell number for the detection and analysis of the expression of recombinant adalimumab.

[0073] Western blot was used to analyze the expression of adalimumab in CHO cells of OE group and Control group. Figure 6 As shown, Tgm2-overexpressing CHO cells can significantly increase the expression level of recombinant adalimumab, with the expression level increasing by 2.05±0.27 times.

[0074] It can be seen from the above embodiments that the present invention transfects the gene Tgm2 overexpression vector into CHO cells to construct a CHO cell line overexpressing Tgm2. The CHO cell line can significantly increase the mRNA and protein expression levels of Tgm2. At the same time, the CHO cell line is used as a host cell for recombinant protein expression. Compared with the wild-type CHO cell line, the CHO cell line can increase the expression amount of the recombinant protein, effectively overcoming the problem of low expression level in the current CHO cell expression system.

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of gene Tgm2 in improving the expression of exogenous recombinant protein in mammalian cells, characterized in that: The nucleotide sequence of the gene Tgm2 is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The mammalian cells are CHO cells.

3. The use according to claim 2, characterized in that: The purpose of increasing the expression of exogenous recombinant proteins in CHO cells is achieved by overexpressing the gene Tgm2 in the CHO cells.

4. A recombinant vector for overexpressing gene Tgm2, characterized in that: It comprises a starting vector and gene Tgm2, wherein the starting vector is a piggyBac vector.

5. The recombinant vector according to claim 4, characterized in that The gene Tgm2 is inserted into the downstream position of the LAC promoter of the starting vector.

6. A recombinant CHO cell overexpressing the gene Tgm2, characterized in that: The method is obtained by transfecting the recombinant vector according to claim 4 or 5 into initial CHO cells.

7. Use of the recombinant CHO cell according to claim 6 in the expression of exogenous recombinant proteins.

8. A recombinant protein expression system, characterized in that: The invention comprises the recombinant vector according to claim 4 or 5, a transposase, a host cell CHO and an overexpression vector of a target recombinant protein encoding gene.

9. A recombinant protein expression system, characterized in that: It comprises the recombinant CHO cell according to claim 6 and an overexpression vector of a target recombinant protein encoding gene.

10. The recombinant protein expression system according to claim 8 or 9, characterized in that: The target recombinant protein includes recombinant adalimumab.

Images