Method for improving citrus canker resistance

Abstract

The invention belongs to the technical field of agricultural biological genes, and particularly relates to a method for improving citrus canker resistance. The invention discloses an application of a pcchensinin-1b-LP4-CaLasLYS2 fused bivalent disease-resistant protein gene in improving the disease resistance of citrus. The pcchensinin-1b-LP4-CaLasLYS2 fused bivalent disease-resistant protein gene comprises a pcchensinin-1b gene, a CaLasLYS2 gene and an LP4 gene, wherein the pcchensinin-1b gene is connected with the CaLasLYS2 gene, and the LP4 gene is used for connecting the pcchensinin-1b gene with the CaLasLYS2 gene. By means of the method, citrus plants with high canker resistance can be obtained, the problem that citrus plants are prone to being affected by cankers in the planting process is effectively solved, and then the problems that in the prior art, the environment is prone to being polluted, and the prevention effect is not ideal when citrus cankers are prevented and treated are solved.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural biological genes, and particularly relates to a method for improving resistance to citrus canker. Background Art

[0002] Citrus is one of the important economic crops and is widely planted around the world. However, citrus canker has seriously hindered the healthy development of the citrus industry. Citrus canker is caused by Xanthomonas citrisubsp.citri (Xcc). The pathogen mainly infects citrus leaves, branches, fruits, etc., among which seedlings and young trees are more seriously affected. Diseased trees will experience leaf drop, dead branches, weak tree vigor, and fruit drop, which seriously affects citrus yield and quality. Citrus producing areas are plagued by citrus canker, and among citrus crops, sweet orange is the most susceptible to the disease, followed by sour orange and grapefruit.

[0003] At present, comprehensive prevention and control strategies are usually adopted to control the damage of citrus canker, with chemical prevention as the main method and biological prevention as the auxiliary method. However, chemical prevention is very likely to cause environmental pollution, is environmentally unfriendly, and requires a lot of manpower and material resources; biological prevention has poor effects and high costs, so there is still a need in the art for a prevention and control method for citrus canker that has good prevention and control effects, saves manpower and material resources, reduces the application of pesticides, and reduces long-term investment.

[0004] Therefore, how to provide a method for improving resistance to citrus canker that has broad-spectrum resistance to different pathogens of citrus canker and can reduce the amount of pesticides used in citrus cultivation has become an urgent problem to be solved in the field. Summary of the invention

[0005] In order to solve the problems of easy environmental pollution and low prevention efficiency in the prior art control methods of citrus canker, the present invention provides a control method for improving resistance to citrus canker, which specifically includes the following technical solutions:

[0006] A use of a pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene in improving disease resistance of citrus, wherein the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene comprises a pchensinin-1b gene, a CalasLYS2 gene and an LP4 gene connecting the pchensinin-1b gene and the CalasLYS2 gene;

[0007] The sequence of the pcchensinin-1b gene is shown in SEQ ID NO.1; the nucleotide sequence of the CalasLYS2 gene is shown in SEQ ID NO.2; and the nucleotide sequence of the LP4 is shown in SEQ ID NO.3.

[0008] The present invention also provides a biological material containing the above-mentioned pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease-resistant protein gene.

[0009] Preferably, the biological material comprises a recombinant vector and / or a recombinant microorganism containing the pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene as claimed in claim 1.

[0010] Preferably, the recombinant vector comprises an initial vector and a pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene inserted into the initial vector, and the basic vector is a plasmid vector;

[0011] The initial strain of the recombinant microorganism is Agrobacterium tumefaciens.

[0012] The present invention also provides the use of the above-mentioned biological material in improving the disease resistance of citrus.

[0013] The present invention also provides a method for improving resistance to citrus canker, comprising the following steps:

[0014] The pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene as described above was transformed into citrus to obtain transgenic citrus plants with high resistance to citrus canker.

[0015] Preferably, the operation of transforming the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene into citrus explants comprises the following steps:

[0016] The recombinant expression vector containing the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene is transformed into citrus to obtain transgenic citrus plants.

[0017] Preferably, the step of transforming the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene recombinant expression vector into citrus explants comprises the following steps:

[0018] The pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene recombinant expression vector is transformed into Agrobacterium tumefaciens by electric shock method, and then the citrus explants are transformed by Agrobacterium tumefaciens mediation.

[0019] Preferably, the citrus explant comprises an epicotyl.

[0020] Preferably, the basic vector in the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene recombinant expression vector includes a pLGN vector, and the Agrobacterium tumefaciens includes Agrobacterium tumefaciens EHA105.

[0021] The beneficial effects of the present invention are:

[0022] The present invention provides an application of a pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene in improving the disease resistance of citrus, comprising the following steps: synthesizing the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene, and transforming the fusion bivalent disease resistance protein gene into citrus to obtain transgenic citrus plants with high resistance to citrus canker. The method of the present invention is used to transform citrus varieties susceptible to citrus canker, and the degree of canker resistance of the obtained transgenic plants can be comparable to that of kumquats with high resistance to canker. In summary, the method for improving citrus canker provided by the present invention is expected to fundamentally solve the problem of the difficulty in preventing and controlling canker in citrus production. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0024] Figure 1 This is a schematic diagram of the inhibition zone results of different proteins against citrus canker bacteria in Example 2 of the present invention;

[0025] Among them, P in A and B represents pcchensinin-1b protein; C represents CalasLYS2 protein; the order of the protein abbreviations represents the order of protein inoculation; H 2 O represents water; Kan represents kanamycin; 0.5, 0.25, and 0.125 refer to protein concentrations of 0.5 mg / mL, 0.25 mg / mL, and 0.125 mg / mL, respectively;

[0026] Figure 2 This is a schematic diagram of the structure of the entire fragment of the fused bivalent disease-resistant protein gene in Example 3 of the present invention;

[0027] Figure 3This is a schematic diagram of the structure of the fused bivalent disease-resistant protein gene overexpression vector in Example 4 of the present invention;

[0028] Figure 4 This is a schematic diagram of the genetic transformation process of citrus in Example 5 of the present invention;

[0029] Among them, A is a schematic diagram of the regeneration culture of the epicotyl transformation explants of the long-leaf orange on the screening medium; B is a schematic diagram of the growth of the regenerated shoots of the long-leaf orange; C is a schematic diagram of the results of GUS staining of the regenerated shoots to screen the transgenic positive shoots; D is a schematic diagram of the test tube grafted seedlings of the transgenic shoots;

[0030] Figure 5 This is a schematic diagram of the PCR detection results of the transgenic plants in Example 6 of the present invention;

[0031] Among them, A is a schematic diagram of the growth of different long-leaf orange samples, in which WT represents non-transgenic long-leaf orange; PC-3\5\6\7\8 are transgenic long-leaf orange lines; B is a schematic diagram of the PCR electrophoresis results of transgenic long-leaf orange plants;

[0032] Figure 6 This is a schematic diagram of the qRT-PCR detection results of the transgenic plants in Example 6 of the present invention;

[0033] Figure 7 This is a schematic diagram of the incidence of ulcer bacteria inoculated in the CK group and different transgenic plants in Example 7 of the present invention;

[0034] Figure 8 This is a schematic diagram of the statistical results of the lesion area of ​​the CK group and different transgenic plants in Example 7 of the present invention;

[0035] Fig. 9 This is a schematic diagram of the statistical results of the disease index of the CK group and different transgenic plants in Example 7 of the present invention;

[0036] Fig.10 Schematic diagram of the antibacterial effect of the total protein from leaves of each transgenic strain on canker bacteria in Example 7 of the present invention, wherein - represents the canker bacteria solution used when inoculating the pathogen. DETAILED DESCRIPTION

[0037] The invention provides an application of a pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene in improving the disease resistance of citrus. The pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene comprises a pchensinin-1b gene, a CalasLYS2 gene and an LP4 gene connecting the pchensinin-1b gene and the CalasLYS2 gene; the sequence of the pchensinin-1b gene is shown in SEQ ID NO.1; the nucleotide sequence of the CalasLYS2 gene is shown in SEQ ID NO.2; and the nucleotide sequence of the LP4 is shown in SEQ ID NO.3.

[0038] The sequence of the pcchensinin-1b gene is shown in SEQ ID NO.1;

[0039] SEQ ID NO.1: 5'-ATGTCTAAGGTTTGGAGACATTGGAGAAGATTTTGGCATAGAGCTCATAGATTGCATTGA-3';

[0040] The nucleotide sequence of the CalasLYS2 gene is shown in SEQ ID NO.2;

[0041] SEQ ID NO.2: 5'-ATGACTATTACTGCTAAGGAAGCTGAAGATTTGTTG TTGTCTGATTTGAGATCTCATTTGGATTTGTTGTTGGATGCTTCTCCTACTTTGAAGTCTGCTTCTGAAAATAGATTGGTTGCTGTTGCTGATTTTGTTTTTAATTTGGGAATTGGAAATTATAATAAGTCTACTTTT AAGCAAAGAGTTGATGCTCAAGATTGGGAAAAGGCTGCTGAAGAATGTAAGAAGTGGACTAAGGCTGGAGGACAATCTTTGAGAGGAATTGAAAATAGAAGAGCTGAAGGAGCTACTATGTTGTTGAATGGATAA-3';

[0042] The nucleotide sequence of LP4 is shown in SEQ ID NO.3;

[0043] SEQ ID NO. 3: 5'-ATGTCTAATGCTGCTGATGAAGTTGCTACTCCTGAAGATGTTGAACCTGGATAA-3'.

[0044] The present invention also provides a biological material containing the above-mentioned pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease-resistant protein gene.

[0045] The sequence of the pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene is shown in SEQ ID NO.4;

[0046] SEQ ID NO.4: 5'-ATGTCTAAGGTTTGGAGACATTGGAGAAGATTTTGG CATAGAGCTCATAGATTGCATTGAATGTCTAATGCTGCTGATGAAGTTGCTACTCCTGAAGATGTTGAACCTGGATAAATGACTATTACTGCTAAGGAAGCTGAAGATTTGTTGTTGTCTGATTTGAGATCTCATTTGGATTTGTTGTTGGATGCTTCTCCTACTTTGAAGTCTGCTTCTGAAAATAGATTGGTT GCTGTTGCTGATTTTGTTTTTAATTTGGGAATTGGAAATTATAATAAGTCTACTTTTAAGCAAAGAGTTGATGCTCAAGATTGGGAAAAGGCTGCTGAAGAATGTAAGAAGTGGACTAAGGCTGGAGGACAATCTTTGAGAGGAATTGAAAATAGAAGAGCTGAAGGAGCTACTATGTTGTTGAATGGATAA-3'.

[0047] As an embodiment, the biomaterial of the present invention includes a recombinant vector and / or a recombinant microorganism containing the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease-resistant protein gene as described above. As an embodiment, the recombinant vector includes an initial vector and a pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease-resistant protein gene inserted into the initial vector, and the basic vector is a plasmid vector. As an embodiment, the initial strain of the recombinant microorganism is Agrobacterium tumefaciens. As an embodiment, the Agrobacterium tumefaciens includes an engineered strain; as an embodiment, the engineered strain is Agrobacterium EHA105; as an embodiment, the Agrobacterium EHA105 is an Agrobacterium competent cell EHA105. As an embodiment, the insertion position in the recombinant vector of the present invention is BamH I and SalI; as an embodiment, the present invention obtains a recombinant microorganism after mixing the plasmid of the recombinant vector with Agrobacterium tumefaciens.

[0048] The present invention also provides the use of the above-mentioned biological material in improving the disease resistance of citrus.

[0049] The present invention also provides a method for improving resistance to citrus canker as described above, comprising the following steps:

[0050] The above-mentioned pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease-resistant protein gene was transformed into citrus to obtain transgenic citrus plants with high resistance to citrus canker.

[0051] As an embodiment, the operation of transforming the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease-resistant protein gene into citrus explants according to the present invention comprises the following steps: transforming the recombinant expression vector containing the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease-resistant protein gene into citrus to obtain transgenic citrus plants. As an embodiment, the operation of transforming the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease-resistant protein gene recombinant expression vector into citrus explants according to the present invention comprises the following steps: transforming the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease-resistant protein gene recombinant expression vector into Agrobacterium tumefaciens by electric shock, and then transforming the citrus explants mediated by Agrobacterium tumefaciens. As an embodiment, the types of citrus explants according to the present invention include epicotyls. As an embodiment, the basic vector in the pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene recombinant expression vector of the present invention includes a plasmid vector; as an embodiment, the plasmid vector is a pLGN vector. As an embodiment, the Agrobacterium tumefaciens of the present invention includes an engineered strain; as an embodiment, the engineered strain includes Agrobacterium tumefaciens EHA105.

[0052] In order to further illustrate the present invention, a method for improving the prevention and treatment of citrus canker provided by the present invention is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0053] Example 1 Obtaining PCchensinin-1b Protein and CalasLYS2 Protein

[0054] The PCR-based long-fragment precise synthesis method was used to synthesize the pchensinin-1b gene shown in SEQ ID NO.1 and the CalasLYS2 gene shown in SEQ ID NO.2, respectively, and the genes were connected between the NdeI (CATATG)-XbaI (TCTAGA) sites of the vector pCZN1 to obtain a recombinant plasmid, and then the recombinant plasmid was transferred into the TOP10 cloning strain, and the positive clones were selected for sequencing, and the clone bacterial liquid that was completely consistent with the expected sequence was stored in glycerol and stored in a refrigerator at -80°C for standby use; the recombinant plasmid obtained above was transformed into the Arctic Express high-efficiency expression strain, and low-temperature induced expression was performed, and Ni column affinity purification was performed, and the purified proteins were subjected to SDS-PAGE purity identification to obtain pchensinin-1b protein and CalasLYS2 protein.

[0055] Example 2 Determination of the antibacterial effect of pcchensinin-1b protein and CalasLYS2 protein on citrus canker bacteria

[0056] The pcchensinin-1b protein and the CalasLYS2 protein prepared in Example 1 were diluted with PBS buffer to solutions with concentrations of 0.125 mg / mL, 0.25 mg / mL, and 0.5 mg / mL, respectively, and then an antibacterial test was performed using the Oxford cup method.

[0057] The antibacterial test was carried out using the citrus canker pathogen Xcc stored on the LB plate by the present invention as an example. The citrus canker pathogen Xcc is the citrus canker pathogen disclosed in the paper "Zou Xiuping et al., Overexpression of CsGH3.6 enhances resistance to citrus canker by inhibiting auxin signal transduction. Chinese Agricultural Science 2019, 52(21): 3806-3818". A single colony of citrus canker pathogen Xcc on the LB plate was picked up and placed in a liquid LB medium, and cultured overnight on a constant temperature shaker at 28°C and 220rpm. The concentration of the bacterial solution was determined, and the bacterial solution was diluted to OD 600 The bacterial solution with a value of 0.2 was prepared in the following way: 2 mL of the diluted bacterial solution was mixed thoroughly with 25 mL of solid LB culture medium cooled to about 60°C, and the plate was poured on the clean bench. After cooling to room temperature, a sterilized Oxford cup was placed on the culture dish. In the Oxford cup, proteins of different concentrations as shown in Table 1 were added to the different groups. For the single protein group, 25 μL of protein of corresponding concentration was added, and for the compound protein group, 12.5 μL of protein of corresponding concentration was added to each protein. Different concentrations and ratios of pchensinin-1b protein and / or CalasLYS2 protein as shown in Table 1 were added to twelve plates with citrus canker bacteria Xcc. Each group was treated 6 times and then placed in a dark incubator at 28°C for 2 days. The diameter of the inhibition zone was measured with a vernier caliper. The results are shown in Table 1. The culture medium containing all the groups shown in Table 1 was randomly selected for display. The results are shown in Table 1. Figure 1 As shown in A to B; the diameters of the inhibition zones of proteins in different groups were analyzed for significant differences, and the results are shown in Figure 1 As shown in C to D.

[0058] Table 1 Measurement results of the diameter of the inhibition zone in different experimental groups

[0059]

[0060]

[0061] Depend on Figure 1It can be seen that the group inoculated with 0.5 mg / mL pcchensinin-1b protein alone had a maximum inhibition zone diameter of 0.834 cm; the group inoculated with 0.5 mg / mL CaLasLYS2 protein alone had a maximum inhibition zone diameter of 0.804 cm; the group inoculated with 0.5 mg / mL pcchensinin-1b protein and 0.5 mg / mL CaLasLYS2 protein mixed had a maximum inhibition zone diameter of 0.848 cm. It can be seen that the antibacterial effect of the group inoculated with the two proteins is better than that of the group inoculated with pcchensinin-1b protein or CaLasLYS2 protein alone, and the combined application of pcchensinin-1b protein and CaLasLYS2 protein has a synergistic effect.

[0062] Example 3 Preparation method of a pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene

[0063] The method steps are as follows:

[0064] The LP4 connecting peptide was used to connect the wood frog antimicrobial peptide pcchensinin-1b with the citrus Huanglong pathogenic phage lytic enzyme CalasLYS2. After the fusion bivalent disease resistance protein gene sequence shown in SEQ ID NO.4 was sent to Shanghai Yingjun Company, the company synthesized the fusion bivalent disease resistance protein gene full fragment. The fusion bivalent disease resistance protein gene full fragment structure is as follows Figure 2 shown.

[0065] Among them, the protein encoded by the pcchensinin-1b gene is an antimicrobial peptide; the protein encoded by the CalasLYS2 gene is a lytic enzyme; and the LP4 is a polypeptide connected by the above two genes.

[0066] Example 4 Construction of Fusion Bivalent Disease Resistance Protein Gene Expression Vector and Transformation of Agrobacterium

[0067] 1. Construction of overexpression vector

[0068] The fusion bivalent disease-resistant protein gene fragment and expression vector pLGN prepared in Example 3 were double-digested with restriction endonucleases BamH I and SalI (ThermoFisher), recovered from the gel and ligated overnight at 16°C, and ligated using T4 DNA Ligase kit (Promega, CAT: M1801). The ligated product was transformed into E. coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the fusion bivalent disease-resistant protein gene overexpression vector, the structure of which is as follows: Figure 3 shown.

[0069] 2. Transformation of the Expression Vector into Agrobacterium

[0070] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 using electroporation.

[0071] The method is as follows: pre-thaw frozen Agrobacterium competent cells EHA105 (50 μL) on ice; then add 2 μL of plasmid fused with a bivalent disease resistance protein gene overexpression vector to the competent cells, pipette and mix to obtain a mixed solution, and place the mixed solution on ice for 5 minutes.

[0072] Transfer the mixed solution to the bottom of the previously dried electric shock cup, put the electric shock cup into the slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1mL LB liquid culture medium to the electric shock cup, blow and mix with a pipette, transfer to a sterile centrifuge tube, and shake and culture at 260r / min and 28°C for 60min; centrifuge the bacterial solution at 10000r / min for 1min, discard the supernatant (leaving about 100μL of resuspended bacteria), spread after resuspending, and culture in the dark at 28°C for 2 days; after the plaque grows, use the primers pc-F shown in SEQ ID NO.5 and pc-R shown in SEQ ID NO.6 to perform PCR verification on the single colony, and the PCR reaction system and reaction conditions are as follows.

[0073] SEQ ID NO.5: 5'-GGATCCATGTCTAAGGTTTGGAGA-3';

[0074] SEQ ID NO.6: 5'-GGATCCATGTCTAAGGTTTGGAGA-3';

[0075] PCR reaction system: 2×PhantaMasterMix: 10μL; Primer pc-F (10μmol / L): 0.5μL; Primer pc-R (10μmol / L): 0.5μL; DNA about 30ng; add ddH 2 0 to 20 μL.

[0076] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0077] Example 5 Genetic transformation of citrus using fusion bivalent disease resistance protein gene expression vector

[0078] according to Figure 4 The genetic transformation of citrus was carried out according to the process shown in A to D. The specific operations are as follows:

[0079] 1. Obtaining epicotyls of citrus seedlings

[0080] Wash fresh long-leaf orange fruits, disinfect the fruit surface with 70% alcohol, then take out the seeds under sterile conditions, peel off the seed coat, and culture them in the dark at 28°C on a seed germination medium for 2 weeks until the seeds germinate. After the seeds germinate, culture them for 1 week under 16h light / 8h dark conditions, with other conditions unchanged; take the epicotyls of the germinated seedlings under sterile conditions and cut them into 1cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0081] 2. Preparation of Agrobacterium tumefaciens

[0082] Before transfection, the Agrobacterium transformed with the expression vector prepared in Example 4 was streaked on an LB solid medium containing 50 mg / L kanamycin; a single colony was picked and inoculated into 25 mL of LB liquid medium containing the same antibiotics, and cultured overnight at 28° C. with shaking; the bacterial solution was diluted to OD=0.1 and then continued to be cultured to OD=0.5, and then centrifuged at 5000 r / min for 10 min, the supernatant was discarded, and the solution was resuspended in MS liquid medium at pH 5.4 to obtain an Agrobacterium bacterial solution for transfection.

[0083] The raw material ratio of the LB liquid culture medium is: 5g / L yeast extract, 10g / L tryptone, 10g / L sodium chloride, pH=7.00; the LB solid culture medium contains 3.75g / 250mL agar powder on the basis of the LB liquid culture medium.

[0084] 3. Transformation of Citrus Epicotyls

[0085] Soak the citrus epicotyl stem segments in Agrobacterium solution for 13 minutes and then wipe them dry. Transfer the stem segments to co-cultivation medium and culture them in the dark at 26°C for 2 days. After the co-cultivation is completed, transfer the epicotyls to the screening medium and culture them in the dark at 28°C for 7 days. Culture the epicotyls at 28°C, 16h light / 8h dark conditions, subculture every two weeks, and then identify them by GUS staining.

[0086] 4. Seedling Culture of Transformants

[0087] When the transformed regenerated buds grow to more than 1 cm, they are cut off and grafted into yellowed seedlings of long-leaf orange in sterile test tubes and cultured in seedling medium; when the test tube grafted seedlings grow to about 5 cm, they are grafted into fresh seedlings of bitter orange and cultured in a greenhouse at 28°C to obtain transgenic long-leaf orange plants.

[0088] The culture medium used in this embodiment is as follows:

[0089] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0090] Co-culture medium: MS+2mg / L BA+0.5mg / L IAA+1mg / L 2,4-D+100μmol AS+30g / L sucrose+2.5g / L Gelrite, pH 5.8.

[0091] Screening medium: MS+2mg / LBA+0.5mg / LIAA+500mg / L Cef+50mg / LKan+30g / L sucrose+2.5g / L Gelrite, pH 5.8.

[0092] Seedling medium: MS + 50g / L sucrose, pH 5.8.

[0093] Example 6 Verification of transgenic plants expressing LP4 linked to pcchensinin-1b and CalasLYS2

[0094] 1. GUS staining identification of transgenic plants

[0095] The transgenic long-leaf orange plant leaves obtained through the initial screening in Example 5 and the long-leaf orange plant that has not been genetically modified were taken as WT plants, and leaves of the WT plants were taken. The above leaves were subjected to GUS histochemical staining for 24 hours. The results are as follows Figure 4 As shown in C, the transgenic long-leaf orange plants appear blue, while the WT plants do not show color.

[0096] 2. PCR Identification of Transgenic Plants

[0097] 100 mg of transgenic plant leaves were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the pcchensinin-1b-LP4-CaLasLYS2 fragment into the citrus genome. The detection primers were pc-F as shown in SEQ ID NO.5 and pc-R as shown in SEQ ID NO.6. The detection results are shown in Figure 5 As shown in B, it can be seen that the positive plant can obtain a 354 bp amplified fragment, while the WT plant has no amplification.

[0098] SEQ ID NO.5: 5'-GGATCCATGTCTAAGGTTTGGAGA-3';

[0099] SEQ ID NO.6: 5'-GGATCCATGTCTAAGGTTTGGAGA-3';

[0100] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0101] PCR reaction system: 2×PhantaMasterMix: 10μL; Primer pc-F (10μmol / L): 0.5μL; Primer pc-R (10μmol / L): 0.5μL; DNA about 30ng; add ddH 2 0 to 20 μL.

[0102] 3. Phenotypic observation of transgenic plants

[0103] The phenotypes of the five transgenic plants were observed and analyzed. Figure 5 As shown in Figure A, there is no obvious abnormality in the appearance and growth of transgenic plants and WT plants, indicating that the expression of LP4 linking pcchensinin-1b and CalasLYS2 genes has no significant effect on the phenotype and development of the plants.

[0104] 4. qRT-PCR Analysis of Transgenic Plants

[0105] Total RNA (Adela, CAT No: RN09) was extracted from the leaves of transgenic plants, and cDNA was synthesized using the reverse transcription kit PrimeScript RT MasterMix (TaKaRa, CAT No: RR036A), and the expression level of the target gene was detected by qRT-PCR.

[0106] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0107] qRT-PCR reaction system: 6 μL 2×SYBR Green fluorescent dye, 4.4 μL H 2 O, 0.3 μL 10 μmol L -1 Upstream and downstream primers, 1 μL cDNA. The upstream and downstream primers include primers for detecting pcchensinin-1b protein and primers for detecting CalasLYS2 protein.

[0108] The primers used to detect the pcchensinin-1b protein are RT-pcchensinin-1b-F as shown in SEQ ID NO.7 and RT-pcchensinin-1b-R as shown in SEQ ID NO.8;

[0109] SEQ ID NO.7: 5'-TCCATGTCTAAGGTTTGGAGACA-3';

[0110] SEQ ID NO.8: 5'-TGCAATCTATGAGCTCTATGCCA-3';

[0111] The primers used to detect the CalasLYS2 protein are RT-CaLasLYS2-F as shown in SEQ ID NO.9 and RT-CaLasLYS2-R as shown in SEQ ID NO.10.

[0112] SEQ ID NO.9: 5'-AGATTGGTTGCTGTTGCTGAT-3';

[0113] SEQ ID NO.10: 5'-GTCCTCCAGCCTTAGTCCAC-3';

[0114] Adoption 2 -△△Ct The relative expression of pcchensinin-1b and CalasLYS2 genes in transgenic plants was calculated by the method. The water-treated sample was defined as the reference factor, that is, its pcchensinin-1b / CaLasLYS2 expression level was 1, and then the multiple of the gene expression in transgenic citrus relative to the reference factor was calculated. -△△Ct , which is the relative expression level. Figure 6 As shown by Figure 6 It can be seen that the pcchensinin-1b gene and the CalasLYS2 gene were expressed at a higher level in the transgenic plants than in the wild-type plants, and there were significant differences between the results, with the highest being more than 3100 times that of the control.

[0115] Example 7 Detection of resistance of transgenic plants to citrus canker

[0116] The transgenic long-leaf orange plants were used as the test group, and the long-leaf orange plants that had not been treated with expression were used as the WT group. After the mature leaves of the test group and the WT group were washed, they were disinfected with 75% alcohol, and then rinsed with sterile water and placed on a clean bench; the leaf veins were punctured with needles, and the ulcer pathogen liquid was spotted with a pipette, with 1 μL spotted per needle hole. The effective live bacteria concentration of the ulcer pathogen liquid was 1X10 5 CFU / mL. After spotting, the leaves were placed in a 28°C constant temperature light incubator, and the light setting was: 16h light / 8h dark. The leaves were photographed 10 days after the bacteria were spotted, and the resistance results such as the lesion area and disease index were calculated using Image JV1.47 software. The results are as follows Figures 7-10As shown in Table 2. It should be noted that due to the different numbers of leaves in different groups of citrus plants, the number of repetitions of disease index detection in different groups was also different, as shown in Table 2, PC-3 and PC-6 transgenic citrus plants repeated the experiment twice, WT, PC-7, PC-8 transgenic citrus plants repeated the experiment three times, JG-WT citrus plants repeated the experiment four times, PC-5 transgenic citrus plants repeated the experiment five times, and each group of plants randomly selected one repeated experiment for display.

[0117] The disease is divided into grades 0 to 7 according to the area of ​​the lesions. The letter R represents the area of ​​the lesions. The grading standards for the lesion area are as follows:

[0118] Level 0: R ≤ 0.25 mm 2 ;

[0119] Level 1: 0.25mm 2 <R≤0.5mm 2 ;

[0120] Level 2: 0.5mm 2 <R≤0.75mm 2 ;

[0121] Level 3: 0.75mm 2 <R≤1mm 2 ;

[0122] Level 4: 1.0mm 2 <R≤1.25mm 2 ;

[0123] Level 5: 1.25mm 2 <R≤1.5mm 2 ;

[0124] Level 6: 1.5mm 2 <R≤1.75mm 2 ;

[0125] Level 7: R>1.75mm 2 .

[0126] The disease index (DI) was calculated according to the formula: DI = 100 × Σ [number of lesions at each level × corresponding level value] / (total number of lesions × maximum level).

[0127] Table 2 Results of disease index test in different groups

[0128]

[0129]

[0130] Depend on Figure 7It can be seen that 10 days after inoculation with the ulcer bacteria, the overexpression plants and the WT plants grafted at the same time developed disease to varying degrees, and there were certain differences in the size of the lesions. Figure 8 It can be seen that the lesion area of ​​transgenic plants is significantly smaller than that of wild-type controls. Fig. 9 As shown in Table 2, the disease index of transgenic plants was significantly lower than that of the WT group and the JG-WT group. Fig.10 It can be seen that the OD of the ulcer pathogen in the transgenic leaves of transgenic plants PC-3~8 was 600 The value was significantly lower than that of the WT group, which shows that the leaves of the transgenic plants have significant resistance to the pathogen of citrus canker. It can be seen that LP4 linked pchensinin-1b and CalasLYS2 expression can significantly reduce the lesion area of ​​citrus bacterial canker, and the disease resistance program is equivalent to that of the highly resistant kumquat (JG-WT).

[0131] It can be seen that LP4 linking the expression of pchensinin-1b and CalasLYS2 can greatly reduce the lesion area of ​​ulcer disease and improve the resistance to ulcer disease. The protein expressed by this fusion gene is a new antibacterial protein for molecular breeding of citrus resistance to ulcer disease.

[0132] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments like this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An application of a pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene in improving disease resistance of citrus, characterized in that: The pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene includes a pcchensinin-1b gene, a CalasLYS2 gene, and an LP4 gene connecting the pcchensinin-1b gene and the CalasLYS2 gene; The sequence of the pcchensinin-1b gene is shown in SEQ ID NO.1; the nucleotide sequence of the CalasLYS2 gene is shown in SEQ ID NO.2; and the nucleotide sequence of the LP4 is shown in SEQ ID NO.

3.

2. A biomaterial, characterized in that: It contains the pcchensinin-1b-LP 4-CaLasLYS2 fusion bivalent disease resistance protein gene as claimed in claim 1.

3. The biomaterial according to claim 2, characterized in that The biological material includes a recombinant vector and / or a recombinant microorganism containing the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene as claimed in claim 1.

4. The biomaterial according to claim 3, characterized in that The recombinant vector includes an initial vector and a pcchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene inserted into the initial vector, and the basic vector is a plasmid vector; The initial strain of the recombinant microorganism is Agrobacterium tumefaciens.

5. Use of the biological material according to claim 3 or 4 in improving the disease resistance of citrus.

6. A method for improving resistance to citrus canker, characterized in that: The steps include: The pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene as described in claim 1 is transformed into citrus to obtain transgenic citrus plants with high resistance to citrus canker.

7. The method according to claim 6, characterized in that The operation of transforming the pcchensinin-1b-LP4-CaLa sLYS2 fusion bivalent disease resistance protein gene into citrus explants comprises the following steps: The recombinant expression vector containing the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene is transformed into citrus to obtain transgenic citrus plants.

8. The method according to claim 7, characterized in that The step of transforming the pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene recombinant expression vector into citrus explants comprises the following steps: The pchensinin-1b-LP4-CaLasLYS2 fusion bivalent disease resistance protein gene recombinant expression vector is transformed into Agrobacterium tumefaciens by electric shock method, and then the citrus explants are transformed by Agrobacterium tumefaciens mediation.

9. The method according to claim 8, characterized in that The citrus explant includes an epicotyl.

10. The method according to claim 8, characterized in that The basic vector in the pchensinin-1b-LP4-CaLas LYS2 fusion bivalent disease-resistant protein gene recombinant expression vector includes a pLGN vector, and the Agrobacterium tumefaciens includes Agrobacterium tumefaciens EHA105.

Images