A method for improving multi-stress tolerance in wheat

Abstract

The application belongs to the field of plant breeding, and particularly relates to a method for improving multi-stress resistance of wheat. A gene affecting multi-stress resistance of wheat is obtained through big data analysis. Manipulation of the gene can improve multi-stress resistance of wheat.

Description

Technical Field

[0001] The invention belongs to the field of plant breeding, and particularly relates to a method for improving the multi-adversity resistance of wheat. Background Art

[0002] Drought, salinity, high temperatures, and other stresses are major environmental factors affecting plant growth and development, severely impacting crop yields. Cultivating high-quality stress-tolerant crops is an effective approach to addressing this problem. Wheat is a staple crop in my country and the second-largest food crop worldwide. Improving wheat's tolerance to abiotic stresses plays a crucial role in increasing wheat yields both in my country and globally.

[0003] Many wheat genes are associated with stress tolerance, such as TaLEA (Yu Jianing. Cloning, Analysis, and Functional Study of Drought- and Salt-Tolerance-Related Genes in Wheat [D]. Northwest Agriculture and Forestry University, 2003), TaWHY2-6A (CN118910132A), TaERF16-B (CN118834991A), and TaSnRK1 (CN118812685A). More genes related to stress tolerance need to be identified to improve wheat stress tolerance. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for improving the multi-adversity resistance of wheat.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides an application of a gene in regulating wheat multi-adversity resistance, characterized in that the gene includes any one of the following:

[0007] (1) A gene with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2;

[0008] (2) a gene encoding the sequence shown in SEQ ID NO. 3;

[0009] (3) the gene numbered TraesCS3B02G056100 in the wheat gene database;

[0010] The multiple adversities include any one of salt, alkali, drought, and high temperature, or a combination thereof.

[0011] The present invention also provides an application of a biological material in regulating wheat multi-adversity resistance, characterized in that the biological material comprises any one of the following:

[0012] (1) an expression cassette containing the above-mentioned gene;

[0013] (2) an expression vector containing the above-mentioned gene;

[0014] (3) A host cell containing the above gene, wherein the host cell is a bacterial cell or a non-renewable plant cell.

[0015] The present invention also provides a method for improving wheat resistance to multiple adversities, characterized in that the method comprises the following steps:

[0016] (1) increasing the expression of the above-mentioned gene in the wheat material to be improved;

[0017] (2) Select wheat plants with improved resistance to multiple stresses.

[0018] The multiple adversities include any one of salt, alkali, drought, and high temperature, or a combination thereof.

[0019] In some embodiments, the method for increasing gene expression is to use a high-activity promoter to drive the expression of the gene of claim 1.

[0020] In some embodiments, the high-activity promoter is SEQ ID NO.4.

[0021] The present invention also provides application of the above method in improving the resistance of wheat to multiple adversities.

[0022] The advantages and beneficial effects of the present invention are as follows: The present invention obtains a new gene that affects wheat's resistance to multiple stresses through transcriptome analysis. Manipulating this gene can improve wheat's resistance to multiple stresses. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The expression level of the TraesCS1B02G056100 gene in #7AABB and SHW3_AABBDD is expressed in TPM (transcripts per million).

[0024] Figure 2 Figure 1. Overexpression vector diagram. Components are labeled on the diagram.

[0025] Figure 3 Results of DNA-level positive detection and transcriptional expression detection of transgenic plants. A: Positive detection results of four positive transformants (OE-1 to OE-4). B: Expression detection of two of the lines, ZR28-466 and ZR28-524.

[0026] Figure 4Phenotypes of overexpressing plants and control plants after saline-alkali stress treatment. A: Phenotypic photographs taken 12 days after saline-alkali stress treatment. The three plants on the left of each photo are overexpressing materials, and the three plants on the right are control materials. B: Statistical data on the percentage of yellow leaves in each material after 12 days of treatment. "**" indicates a highly significant difference. ZR28-OX-466 and ZR28-OX-524 are the overexpressing materials ZR28-466 and ZR28-524.

[0027] Figure 5 Phenotypes of overexpressing plants and control plants after drought and heat stress. A: Phenotypic photographs taken 12 days after drought and heat stress treatment and 7 days after rewatering. The three plants on the left are the control strain Fielder, the three plants in the middle are the overexpressing strain ZR28-466, and the three plants on the right are the overexpressing strain ZR28-524. ZR28-OX-466 and ZR28-OX-524 are the overexpressing strains ZR28-466 and ZR28-524, respectively. B: Statistical data on leaf curling of each strain 7 days after rewatering. "**" indicates a highly significant difference. DETAILED DESCRIPTION

[0028] The following definitions and methods are provided to better define this application and to guide those skilled in the art in practicing this application. Unless otherwise noted, terms are to be understood according to conventional usage by those skilled in the relevant art. All patent documents, academic papers, industry standards, and other publications cited herein are hereby incorporated by reference in their entirety.

[0029] In the present application, the words “comprise”, “include” or variations thereof should be understood as including other elements, numbers or steps in addition to the elements, numbers or steps described.

[0030] Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in an amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers defining the ranges. As used herein, "nucleic acid" includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and, unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides, which hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the terms "encoding" or "encoded" are used in the context of a specific nucleic acid to refer to the nucleic acid containing the necessary information for directing the translation of the nucleotide sequence into a specific protein. Codons are used to represent information encoding proteins. As used herein, the "full-length sequence" of a specific polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the specific protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). Amino acids can be naturally occurring amino acids and, unless otherwise limited, can include known analogs of naturally occurring amino acids that can function in a manner similar to naturally occurring amino acids.

[0031] In some embodiments, the nucleotide sequences of the present application can be altered to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequences of the present application can be substituted without changing the amino acid sequence according to the disclosed monocot codon preferences, for example, codons encoding the same amino acid sequence can be replaced with codons preferred by monocots without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, part of the nucleotide sequence in the present application is replaced with different codons encoding the same amino acid sequence, thereby not changing the amino acid sequence encoded by the nucleotide sequence while changing the nucleotide sequence. Conservative variants include those sequences that encode the amino acid sequence of one of the proteins of the embodiments due to the degeneracy of the genetic code. In some embodiments, part of the nucleotide sequence in the present application is replaced according to the monocot codon preference. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of the amino acid side chain substituents, for example, the hydrophobicity, charge, size, etc. of the substituents. Exemplary amino acid substitution groups with various aforementioned properties are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions such as replacing one amino acid with another amino acid having similar properties can be performed. The identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences that are present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism. The hybridization probe can be a genomic DNA fragment, a cDNA fragment, an RNA fragment or other oligonucleotide, and can be marked with a detectable group such as 32P or other detectable markers. Thus, for example, a hybridization probe can be prepared by marking a synthetic oligonucleotide based on the embodiment sequence. The method for preparing hybridization probes and building cDNA and genomic libraries is generally known in the art. The hybridization of the sequence can be carried out under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" represents following conditions, i.e., under these conditions, relative to hybridizing with other sequences, the probe will hybridize with its target sequence to a greater extent (e.g., at least 2 times, 5 times or 10 times of background) that can be detected.Stringent conditions are sequence-dependent and vary in different environments. By controlling hybridization stringency and / or controlling washing conditions, a target sequence that is 100% complementary to the probe can be identified (homologous probe method). Alternatively, stringent conditions can be adjusted to allow some sequence mismatches in order to detect lower similarities (heterologous probe method). Typically, the probe length is less than about 1000 or 500 nucleotides. Typically, stringent conditions are those in which the salt concentration is less than about 1.5 M Na ions, typically about 0.01 M to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is at least about 30° C. when used for short probes (e.g., 10 to 50 nucleotides); at least about 60° C. when used for long probes (e.g., greater than 50 nucleotides). Stringent conditions can also be achieved by adding destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization at 37°C using 30% to 35% formamide buffer, 1M NaCl, 1% SDS (sodium dodecyl sulfate), and washing in 1× to 2× SSC (20× SSC = 3.0M NaCl / 0.3M trisodium citrate) at 50°C to 55°C. Exemplary moderate stringency conditions include hybridization at 37°C in 40% to 45% formamide, 1.0M NaCl, 1% SDS, and washing in 0.5× to 1× SSC at 55°C to 60°C. Exemplary high stringency conditions include hybridization at 37°C in 50% formamide, 1M NaCl, 1% SDS, and a final wash in 0.1× SSC at 60°C to 65°C for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. The duration of hybridization is typically less than about 24 hours, typically about 4 hours to about 12 hours. Specificity often depends on post-hybridization washes, with the key factors being the ionic strength and temperature of the final wash solution. The Tm (thermodynamic melting point) of a DNA-DNA hybrid can be approximated by the formula of Meinkot and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% formamide) - 500 / L, where M is the molar concentration of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, "% formamide" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Washes are typically performed at least until equilibrium is reached and low background levels of hybridization are achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mismatch should reduce the Tm by about 1°C; thus, the Tm, hybridization, and / or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ≥90% identity are desired, the Tm can be reduced by 10°C.Generally, stringent conditions are selected to be about 5°C lower than the Tm of the specific sequence and its complement at a defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C below the Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C below the Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C below the Tm.

[0032] Unless otherwise indicated, all numbers used in the specification and claims expressing amounts of ingredients, reaction conditions, and the like should be understood as being modified in all instances by the term "about." As used herein, the term "about," when referring to a measurable value such as an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations of ±20% from the stated amount in some embodiments, ±10% from the stated amount in some embodiments, ±5% from the stated amount in some embodiments, ±1% from the stated amount in some embodiments, ±0.5% from the stated amount in some embodiments, and ±0.1% from the stated amount in some embodiments, as such variations are suitable for performing the disclosed methods and / or using the disclosed compositions, nucleic acids, polypeptides, and the like. Therefore, unless indicated to the contrary, the numerical parameters set forth in the specification and appended claims are approximate values ​​that may vary depending upon the desired properties sought to be obtained by the subject matter disclosed herein.

[0033] The following examples are used to illustrate the present invention, but are not used to limit the scope of the invention. Without departing from the spirit and essence of the present invention, the modification or replacement of the inventive method, step or condition, all belong to the scope of the application. If not otherwise specified, the embodiments are according to conventional experimental conditions, such as the molecular cloning laboratory manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001) of the people such as Sambrook, or according to the conditions of manufacturer's instructions. If not otherwise specified, the chemical reagent used in the embodiments is conventional commercially available reagent, and the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0034] Example

[0035] Example 1 Discovery of wheat stress tolerance genes

[0036] Common wheat, an important food crop, is a typical allohexaploid species with A, B, and D genomes. Its development underwent two allopolyploidization processes: the first occurred approximately 500,000 years ago, resulting in the formation of an early tetraploid (AABB) from two diploids of Triticum urartu (AA) and a species similar to Aegilops speltoides (SS). The second polyploidization occurred approximately 8,000 years ago, resulting from a natural hybridization between a domesticated tetraploid (T. turgidum, AABB) and a wild goatgrass (Ae. tauschii, DD) through chromosome doubling. This hybridization, through subsequent natural selection and artificial domestication, gave rise to the present-day common wheat. Wheat serves as an important genetic model for studying polyploid evolution and crop domestication. However, the extent and impact of these changes in wheat evolution, particularly the transition from tetraploid to hexaploid, remain unclear. The addition of the D genome significantly improved wheat's adaptability and quality.

[0037] To study the impact of the addition of the D genome on the wheat genome during the evolution from tetraploid to hexaploid wheat, the inventors first obtained tetraploid wheat #7AABB and diploid wheat #10DD, and hybridized the two materials. In the F2 generation, a stable hexaploid synthetic wheat plant SHW3 (AABBDD) was screened. These three materials were grown under normal light conditions to the seedling stage (three-leaf stage), and RNA was extracted from the leaves for transcriptome analysis. The gene expression levels between hexaploid SHW3 (AABBDD) and tetraploid wheat #7AABB were compared. The results showed that compared with tetraploid wheat #7AABB, a total of 2673 upregulated genes and 2076 downregulated genes were identified in hexaploid SHW3 (AABBDD), and a total of 201 genes changed from being expressed to being expressed. Since hexaploid wheat has a wider environmental adaptability than tetraploid wheat, three genes with higher activated expression levels after the addition of tetraploid wheat #7AABB to the D genome were screened out, namely TraesCS1B02G022400, TraesCS2D02G069100, and TraesCS3B02G056100.

[0038] Among them, the gene TraesCS3B02G056100 is not expressed at all in tetraploid wheat #7AABB, but its expression is activated in hexaploid synthetic wheat SHW3 (AABBDD) ( Figure 1), suggesting that this gene may play a role in the adaptation of hexaploid wheat to environmental signals. The gene is identified in the database as TraesCS3B02G056100, with its genomic sequence shown in SEQ ID NO. 1 and its encoded protein sequence in SEQ ID NO. 3.

[0039] Example 2 Gene Function Verification

[0040] To further identify the specific function of the gene, the inventors cloned the gene coding region (CDS) of the TraesCS3B02G056100 gene, the sequence of which is shown in SEQ ID NO. 2. After the empty vector was digested with BamHI, the CDS was constructed into an overexpression vector by homologous recombination, and the plasmid was transformed into Agrobacterium EHA105. Using the Agrobacterium-mediated immature embryo wheat genetic transformation system, the gene was successfully transformed into the wheat variety Fielder. The promoter and terminator used in the overexpression vector are the maize ubiquitin promoter (SEQ ID NO. 4) and nos terminator (SEQ ID NO. 5) commonly used in the art (see vector map). Figure 2 Finally, transformants were obtained, and 4 positive transformants were screened out by positive detection in the T1 generation ( Figure 3 A). RNA was extracted from leaves of two strains, ZR28-466 and ZR28-524. After reverse transcription to obtain cDNA, the expression level of the TraesCS3B02G056100 gene was detected using the qRT-PCR method. It was found that the expression level of the gene in the ZR28-466 and ZR28-524 strains was significantly higher than that in the receptor control ( Figure 3 B) Specific primers for qRT-PCR detection of TraesCS3B02G056100 gene expression were: WRGP-5943, AGAATTGCTGGCCCAGTCTC; WRGP-5944, AGAGCTTGTCTGACGTTGGG. Internal control primers were: TaActin-F, CAGCAATGTATGTCGCAATC; TaActin-R, TAGCATGAGGAAGCGTGTAT.

[0041] After obtaining the overexpression material, the stress resistance of the two strains ZR28-466 and ZR28-524 was further evaluated. ZR28-466, ZR28-524 and the receptor control Fielder were treated with saline-alkali stress and drought-heat stress.

[0042] Salt-alkali stress treatment method: Small square pots measuring 8 cm × 8 cm were filled with soil, with 100 g of soil (including the weight of the pot) per pot. After ensuring that the soil was fully absorbed by water, sowing was performed. Five experimental plants were sown in each pot, with three replicates for each plant, for a total of 15 experimental plants. When wheat reached the "two leaves and one core" stage (approximately 12-13 days of growth, under growth conditions of 20-23°C and a 12-hour day / night cycle), a 400 mmol / L saline-alkali aqueous solution (NaCl:NaHCO₃:Na₂CO₃ ratio of 11:4.5:0.5, with a final pH of 9) was slowly poured over the plant roots. On the first day, 150 mL of saline-alkali water was poured, and the excess water was poured out. On the fourth day, 50 mL of saline-alkali water was poured again. After 12 days of treatment, the number of yellow and green leaves in each plant was counted, the percentage of yellow leaves was calculated, and photographs were taken to assess the effects of salt-alkali stress on wheat growth.

[0043] The drought and heat stress treatment method involved filling small 8cm x 8cm square pots with soil, with each pot containing 100g of soil (including the pot weight). After ensuring the soil was fully absorbed with water, sowing was performed. Five experimental plants were sown in each pot, with three replicates for each plant, for a total of 15 experimental plants. The day before wheat reached the "two leaves and one core" stage (approximately 12-13 days of growth, under growth conditions of 20-23°C and a 12h / 12h day / night cycle), water was applied to ensure that the weight of each pot was roughly the same. After multiple precise measurements, the total weight of the pots before treatment was within the range of 250g ± 4g. Subsequently, the water in the white dish was emptied and the treatment began. The ambient temperature was adjusted to a high temperature range of 33-36°C, and no watering was applied continuously to simulate drought and heat stress. After 12 days of treatment, the plants were rewatered for 7 days, photographed, and the degree of leaf curling was recorded for each plant.

[0044] After 12 days of saline-alkali stress treatment, the number of yellow leaves and green leaves in the transgenic plants were counted, and the ratio of yellow leaves was calculated to measure the resistance of the wheat material to saline-alkali stress. The results showed that the ratio of yellow leaves to green leaves in the overexpression plants was significantly lower than that in the control material Fielder (see Figure 4 ), indicating that overexpression of the TraesCS3B02G056100 gene can significantly improve the salt-alkali tolerance of wheat. After 12 days of drought and heat stress and 7 days of rewatering, the curling rate of the leaves of the overexpressing material was significantly lower than that of the control material Fielder (see Figure 5 ), indicating that overexpression of TraesCS3B02G056100 gene can significantly improve the drought and heat tolerance of wheat.

[0045] The functions of the two genes, TraesCS1B02G022400 and TraesCS2D02G069100, were identified in the same way. It was found that TraesCS1B02G022400 and TraesCS3B02G056100 had similar abilities to resist multiple adversities, while TraesCS2D02G069100 had weaker abilities to resist multiple adversities.

[0046] The above results show that overexpression of the TraesCS3B02G056100 gene significantly improves wheat's resistance to salt, alkali, drought, and heat (high temperature) adversities. Therefore, increasing the expression level of the TraesCS3B02G056100 gene can achieve the technical effect of improving wheat's resistance to multiple adversities, including salt, alkali, drought, and heat. Although the present invention has been described in detail above using general instructions and specific embodiments, it will be apparent to those skilled in the art that modifications or improvements may be made based on the present invention. Therefore, any modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed in the present invention.

Claims

1. Application of a gene in regulating wheat multi-adversity resistance, characterized in that: The gene is any one of the following: (1) A gene with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2; (2) a gene encoding the sequence shown in SEQ ID NO. 3; (3) the gene numbered TraesCS3B02G056100 in the wheat gene database; Wherein, the multiple adversities are any one of salt, alkali, drought, and high temperature or a combination thereof.

2. Application of a biomaterial in regulating wheat multi-adversity resistance, characterized in that: The biological material is any one of the following: (1) An expression cassette containing the gene according to claim 1; (2) an expression vector containing the gene according to claim 1; (3) A host cell containing the gene of claim 1, wherein the host cell is a bacterial cell; Wherein, the multiple adversities are any one of salt, alkali, drought, and high temperature or a combination thereof.

3. A method for improving wheat resistance to multiple adversities, characterized in that: The method comprises the following steps: (1) increasing the expression of the gene of claim 1 in the wheat material to be improved; (2) selecting wheat plants with improved resistance to multiple stresses; Wherein, the multiple adversities are any one of salt, alkali, drought, and high temperature or a combination thereof.

4. The method according to claim 3, characterized in that The method for increasing gene expression is to use a high-activity promoter to drive the expression of the gene according to claim 1.

5. The method according to claim 4, characterized in that The high-activity promoter is shown in SEQ ID NO.

4.

6. Use of the method according to any one of claims 3 to 5 in improving the resistance of wheat to multiple stresses; in, The multiple adversities are any one of salt, alkali, drought, and high temperature, or a combination thereof.

Images