Synthetic self-amplifying mRNA molecules with secretory antigens and immunomodulators

Abstract

Lipid nanoparticles (LNPs) encapsulating self-amplifying mRNA, compositions, and methods of use of the novel nucleic acid constructs and compositions are disclosed. The LNP constructs comprise a novel ionizable lipid. The novel sa-mRNA constructs encode a modified SARS-CoV-2 spike protein in which the polynucleotide has been truncated to comprise no nucleotides encoding SARS-CoV-2 transmembrane domain and short cytoplasmic domain amino acids, as well as immunomodulators. The sa-mRNA may be used as a therapeutic, diagnostic and / or prophylactic agent for mammalian cells or organs.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 63 / 341,018, filed May 12, 2022, and U.S. Provisional Application No. 63 / 393,688, filed July 29, 2022, each of which is incorporated herein by reference in its entirety for all purposes.

[0003] Sequence Listing Statement

[0004] This application contains a sequence listing in electronic format submitted via EFS-Web. The sequence listing was created on May 10, 2023, is named "5292-102ST26.xml", and is 169,401 bytes in size. The information in the electronic sequence listing is part of this application and is incorporated herein by reference in its entirety. Technical Field

[0005] The present disclosure provides novel self-amplifying mRNA (sa-mRNA) constructs, compositions comprising such constructs, and methods of delivering one or more biologically active agents to a subject in need thereof. Background Art

[0006] mRNA vaccine platforms are able to stimulate humoral and cellular immune responses to encoded foreign antigens and are an improvement over traditional vaccines because they can be manufactured rapidly, scalably, and cell-free. However, achieving sufficient antigen expression to achieve protection or immunomodulation is a medical challenge for existing mRNA vaccines because the number of mRNA transcripts available in the body is proportional to the number of mRNA transcripts successfully delivered during vaccination, and therefore existing mRNA vaccines require large doses or repeated administration. Large doses and repeated administration of mRNA vaccines, circular mRNA, and sa-mRNA vaccines are undesirable because large doses of mRNA, circular mRNA, or sa-mRNA may cause undesirable immune responses, while repeated administration may reduce the effectiveness of subsequent administrations of the same vaccine.

[0007] Sa-mRNA is a type of mRNA that has the ability to self-replicate in cells and amplify the expression of its cargo gene (e.g., a gene of interest). However, due to its large size and immunogenicity due to its alphavirus origin, achieving sufficient sa-mRNA production and interferon response remains difficult. Therefore, there remains a need to increase intracellular mRNA transcripts in vivo, thereby generating a better immune response at a lower dose and avoiding safety challenges.

[0008] The delivery of bioactive agents, including sa-mRNA, is also a medical challenge due to the inherent properties of RNA, including its high negative charge and its size (much larger than modified mRNA and circular mRNA). Specifically, the delivery of bioactive agents to cells is very difficult due to the relative instability and low cell permeability of such molecules, as well as safety issues due to cytotoxicity. Ionizable lipids are a component of LNPs and are believed to play a key role in the uptake of LNPs by cells and their release from endosomes. Therefore, there is a need to develop compounds, compositions, and methods to improve the delivery of therapeutic, diagnostic, and / or prophylactic molecules to cells or organs. Summary of the Invention

[0009] The present invention addresses these needs by providing novel ionizable lipids, nanoparticle compositions, and sa-mRNAs that improve delivery of bioactive agents to cells or organs while reducing safety concerns associated with incompatible high transcript levels and / or rapid decay of the bioactive agent, thereby enabling increased administration. The present disclosure provides novel sa-mRNAs, as well as compositions and methods involving the same.

[0010] In one aspect, the present disclosure provides a method for improving the transfection efficiency of nanoparticle formulations and reducing the cytotoxicity of the nanoparticle formulations by using novel ionizable lipids in LNP formulations. In some aspects, the methods and compositions include the ionizable lipid formula E6 (1,1',1"-(1,3,5-triazinane-1,3,5-triyl)tris(3-(ditridecylamino)propan-1-one)):

[0011]

[0012] In some aspects, the methods and compositions include an ionizable lipid of formula E2 (1,1′,1″-(1,3,5-triazinane-1,3,5-triyl)tris(3-(dinonylamino)propan-1-one)):

[0013]

[0014] In some aspects, the methods and compositions include an ionizable lipid of formula P6 (N-(2-(cyclohex-1-en-1-ylamino)-1-(1-ethylpiperidin-4-yl)-2-oxoethyl)-N-(heptadecan-9-yl)palmitamide):

[0015]

[0016] In one aspect, the sa-mRNA of the present disclosure is delivered to host cells via LNPs formulated with ionizable lipids, helper lipids, cholesterol, and / or PEG-lipids. The present disclosure includes the ionizable lipid component of PCT patent application PCT / US2023 / 017777, which is incorporated herein in its entirety. In one aspect, the LNPs have a molar ratio of about 2%-60% ionizable lipid, about 5%-40% helper lipid, about 30%-80% cholesterol, and about 0.5%-30% PEG-lipid. The present disclosure encompasses any integer or fraction thereof within the recited range, as expressly provided herein. In one aspect, LNP has a molar ratio of about 5% to 50% or 8% to 40% or 10% to 30% ionizable lipid, about 10% to 30% or 13% to 25% or 15% to 20% helper lipid, about 40% to 70% or 45% to 65% or 50% to 60% cholesterol and about 1% to 20% or 3% to 15% or 5% to 10% PEG-lipid. In one aspect, LNP has a molar ratio of about 2%-10% ionizable lipid, about 5%-15% helper lipid, about 40%-80% cholesterol and about 0.5%-3% PEG-lipid. In one aspect, the ionizable lipid is E6. In one aspect, the helper lipid is independently selected from DOPE (2-dioleoyl-sn-glycero-3-phosphoethanolamine), DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine) and POPE (1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine). In one aspect, the LNP of the present disclosure, the ionizable lipid is E6, the helper lipid is DOPE, and the PEG-lipid is DMG-PEG2000. In one aspect of the present disclosure, the LNP is composed of E6, DOPE, cholesterol and DMG-PEG-2000. In one aspect, the LNP of the present disclosure has a molar ratio of 50% ionizable lipid, 10% helper lipid, 38.5% cholesterol and 1.5% PEG-lipid. In another aspect, the LNP of the present disclosure has a molar ratio of 7.5% ionizable lipid, 15% helper lipid, 75% cholesterol and 2.5% PEG-lipid. In another aspect, the LNPs of the present disclosure have a molar ratio of 5% ionizable lipid, 10% helper lipid, 50% cholesterol, and 1.5% PEG-lipid. In one aspect, the ionizable lipid is E6, the helper lipid is DOPE, and the PEG-lipid is DMG-PEG2000.

[0017] In one aspect, the bioactive agent is a nucleic acid molecule, and the nucleic acid molecule is RNA or DNA. In one aspect, the bioactive agent is RNA, and the RNA is mRNA, tRNA, rRNA, siRNA, or snRNA. In one aspect of the present disclosure, the bioactive agent is sa-mRNA. In one aspect, the mRNA is chemically modified. In one aspect, the chemically modified mRNA is composed of nucleotides selected from the group consisting of: 1-methyl-pseudouridine, 5-methyl-uridine, and 5-methyl-cytidine. In one aspect, the bioactive agent is sa-mRNA encoding one or more antigens and one or more immunomodulators. In one aspect, the encoded antigen is a viral antigen. In one aspect, the encoded antigen is a modified SARS-CoV-2 spike protein. In one aspect, the immunomodulator is a cytokine, chemokine, or other immune stimulator or inhibitor.

[0018] In one aspect, the present disclosure provides a method for increasing the copy number of a nucleic acid encoding two expression units, the nucleic acid comprising: i) an origin of replication sequence (Ori); ii) a first expression unit encoding a first nucleotide sequence operably linked to a first promoter; and iii) a second expression unit encoding a second nucleotide sequence operably linked to a second promoter, wherein the first expression unit encodes a selective marker and the second expression unit encodes a self-amplifying mRNA; b) selecting cells expressing the selective marker; c) subculturing the selected cells to obtain a cell population expressing the selective marker; and d) causing the cell population to proliferate to increase the copy number of the nucleic acid. In some aspects, the nucleic acid is an RNA molecule. In one aspect, the nucleic acid molecule of the present disclosure is a recombinant DNA molecule. In one aspect, the nucleic acid molecule of the present disclosure is a closed circular molecule or a linear molecule. In one aspect, the nucleic acid molecule is a plasmid. In one aspect, the initial nucleic acid encoding the two expression units is synthesized using standard synthesis techniques (e.g., using an automated DNA synthesizer).

[0019] In one aspect, the nucleic acid comprises a replication system that allows the nucleic acid to maintain expression or be cloned and amplified in the host. The nucleic acid can be present in a high copy number or a low copy number in the cell. Generally speaking, there will be about 5 to about 200 times the mRNA copies of the housekeeping gene β-actin in the host cell. Host cells containing high copy number mRNA transcripts will preferably contain at least about 10 to about 20 times the mRNA copies of the housekeeping gene β-actin. Host cells containing small amounts of nucleic acid will preferably contain about 1 to 10 times, typically about 1 to 4 times the mRNA copies of the housekeeping gene β-actin. The copy number of nucleic acids, including mRNA transcripts, can be controlled by selecting different replication origins according to methods known in the art. Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd edition (January 15, 2001) Cold Spring Harbor Laboratory Press, ISBN: 0879695765.

[0020] In one aspect, the first expression unit comprises the following operably linked nucleic acid sequences in the 5' to 3' direction or in the 3' to 5' direction:

[0021] [Pr1]-[SM]

[0022] Wherein, Pr1 is the first promoter sequence, and SM is a selective marker.In some respects, the first promoter is a promoter that is identified by a bacterial mechanism and drives the transcription of the selective marker of the encoding.In some respects, the first expression unit encodes a selective marker, and this selective marker allows the selection of the transformed bacterial host cell.Selective marker can be expressed in bacterial host cells, and can include genes (Davies et al., Ann.Rev.Microbiol., 32:469 (1978)) that make antibacterials produce resistance to drugs (such as ampicillin, kanamycin (neomycin), chloramphenicol, erythromycin and tetracycline).

[0023] In one aspect, the second expression unit comprises, from 5' to 3', the following operably linked nucleic acid sequence:

[0024] Pr2-5'UTR-nsP-SGP-GOI-3'UTR-PolyA

[0025] Wherein, Pr2 is a second promoter sequence, 5'UTR is a 5' untranslated region, nsP is a plurality of nonstructural replicase domain sequences, SGP is a subgenomic promoter, GOI is one or more target genes, 3'UTR is a 3' untranslated region, and Poly-A is a 3' polyadenylation tail (poly-A tail). In some aspects, when there is more than one GOI, each GOI is operably linked to its own SGP.

[0026] In some aspects, the second promoter is a promoter that drives transcription of the encoded self-amplifying mRNA using the second expression unit as a template for in vitro transcription of the nucleic acid (e.g., mRNA). Suitable promoters include, for example, T7 promoter, T3 promoter, SV40 promoter, SP6 promoter, T5 promoter, beta-lactamase promoter, Escherichia coli (E. coli) galactose promoter, arabinose promoter, alkaline phosphatase promoter, tryptophan (trp) promoter, lactose operator (lac) promoter, lacUV5 promoter, trc promoter, tac promoter, etc., or mutants of these promoters. sa-mRNA can be prepared by transcribing (e.g., in vitro transcription) DNA encoding the sa-mRNA using a suitable DNA-dependent RNA polymerase, such as T7 bacteriophage RNA polymerase, SP6 bacteriophage RNA polymerase, T3 bacteriophage RNA polymerase, T5 bacteriophage RNA polymerase, RNA polymerase III, RNA polymerase II, Taq polymerase, Vent polymerase, etc., or mutants of these polymerases. The transcription reaction will contain nucleotides, and in some aspects, the transcription reaction will include modified nucleotides, as well as other components that support the activity of the selected polymerase, such as a suitable buffer and a suitable salt. In some aspects, nucleotide analogs will be incorporated into the sa-mRNA, for example, to alter the stability of such RNA molecules, increase resistance to RNases, establish replication after introduction into appropriate host cells ("infectivity" of the RNA), and / or induce or reduce innate and adaptive immune responses.

[0027] In another aspect, the nucleic acid is engineered to express an alphavirus nonstructural protein. U.S. Patents 7,045,335, 7,078,218, 7,425,337, and 7,442,381 describe various constructs of such alphavirus RNA replicons consisting of 5' and 3' alphavirus replication recognition sequences, coding sequences for alphavirus nonstructural proteins, and polyadenylation sequences, and such constructs are incorporated herein by reference.

[0028] In some aspects, the at least one nonstructural replicase domain sequence comprises a sequence selected from Group IV RNA viruses, including Eastern Equine Encephalitis virus (EEE), Venezuelan Equine Encephalitis virus (VEE), Everglades virus, Mucambo virus, Pixuna virus, Western Equine Encephalitis virus (WEE), Sindbis virus, Semliki Forest virus, Middelburg virus, Chikungunya virus, O'nyong-nyong virus, Ross River virus, Barmah Forest virus, Getah virus, Sagiyama virus, Bebaru virus, Mayaro virus, In some aspects, the nonstructural replicase domain sequences are derived from alphavirus nonstructural proteins 1-4 (nsP1-4), and in some aspects, the sa-mRNA of the present disclosure contains a subgenomic promoter that directs the expression of said proteins.

[0029] In some aspects, the GOI can encode a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a reporter gene, an antigen, or a gene encoding a regulatory structure. In some aspects, the GOI can encode an infectious disease antigen, an allergic antigen, or a tumor antigen. In some aspects, the GOI is a non-coding gene that encodes a regulatory structure, such as a small interfering RNA (siRNA), a microRNA (miRNA), a self-activating RNA (saRNA), a transfer RNA (tRNA), a guide or guide RNA (gRNA), or a long intergenic non-coding RNA (lincRNA).

[0030] In some aspects, the nucleic acids of the present disclosure comprise a sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SAM001 (SEQ ID NO:35), SAM002 (SEQ ID NO:36), SAM003 (SEQ ID NO:37), SAM004 (SEQ ID NO:38), SAM005 (SEQ ID NO:39), SAM006 (SEQ ID NO:40), MOD001 (SEQ ID NO:41), or T7-VEE-GFP (SEQ ID NO:42).

[0031] In some aspects, the nucleic acid molecules of the present disclosure are suitable for in vitro transcription of RNA, especially in vitro transcription of self-amplified mRNA, especially after linearization. The circular plasmid is usually linearized downstream of the poly-A tail of the second expression unit by a type II restriction enzyme (corresponding to the recognition sequence of the cleavage site) before in vitro transcription. The linearized plasmid can then be used as a template for in vitro transcription, and the resulting transcript ends with a poly-A sequence.

[0032] Thus, in one aspect, preferably, the nucleic acid molecules of the present disclosure can be cleaved within the nucleic acid sequence, preferably enzymatically or by another biochemical means, in such a way that said cleavage produces a nucleic acid molecule comprising the following elements in the 5'→3' transcriptional direction:

[0033] L1-Ori-SM-Pr1-L2-Pr2-5'UTR

[0034] -nsP-SGP-L3-GOI-L4-3'UTR-PolyA

[0035] Wherein, L1 is the first linker, Ori is the replication origin sequence, SM is a selective marker, Pr1 is the first promoter sequence, L2 is the second linker, Pr2 is the second promoter sequence, 5'UTR is the 5' untranslated region, nsP is a plurality of non-structural replicase domain sequences, SGP is a subgenomic promoter, L3 is the third linker, GOI is one or more target genes, L4 is the fourth linker, 3'UTR is the 3' untranslated region, and Poly-A is a 3' polyadenylation tail. The nucleic acid molecules of the present invention are preferably closed circular molecules before cutting, and are preferably linear molecules after cutting. Preferably, cutting is carried out with the assistance of a restriction cleavage site, which is preferably a restriction cleavage site of an IIS type restriction endonuclease. In one aspect, the recognition sequence of the IIS type restriction endonuclease is 5-26 base pairs. In aspect, restriction enzyme MluI is used at the end of poly A.

[0036] In one aspect, the nucleic acid comprises one or more linkers, wherein each linker is independently selected from the group consisting of

[0037] CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT (SEQ ID NO: 43),

[0038] CACATTTCCCCGAAAAGTGCCACCTGAGCTC (SEQ ID NO:44),

[0039] TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45) or

[0040] CATCGATGATATCGCGGCCGCATACAGCAGC (SEQ ID NO: 46). In some aspects, L1 comprises SEQ ID NO: 43

[0041] (CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT); L2 contains SEQ ID NO: 44

[0042] (CACATTTCCCCGAAAAGTGCCACCTGAGCTC); L3 comprises SEQ ID NO:45

[0043] (TTCGAAGGCGCGCCTCTAGAGCCACC); and L4 comprises SEQ ID NO:46

[0044] (CATCGATGATATCGCGGCCGCATACAGCAGC).

[0045] In one aspect, the present disclosure relates to a method for obtaining self-amplified mRNA, comprising: a) performing an in vitro transcription reaction using an initial amount of a nucleic acid molecule of the present disclosure, and b) producing sa-mRNA by in vitro transcription using the nucleic acid molecule as a template and an RNA polymerase (e.g., T7 polymerase).

[0046] In another aspect, the present disclosure relates to nucleic acid molecules that are preferably obtained by linearizing the nucleic acid molecule by cleavage within the nucleic acid sequence, and to sa-mRNA that can be obtained by transcription (preferably in vitro transcription) using the nucleic acid molecule under the control of a second promoter.

[0047] Thus, in one aspect, the present disclosure relates to a sa-mRNA comprising the following elements in the 5'→3' direction:

[0048] 5'UTR-nsP-SGP-GOI-3'UTR-PolyA

[0049] Wherein, 5'UTR is 5' untranslated region, nsP is multiple non-structural replicase domain sequences, SGP is subgenomic promoter, GOI is one or more target genes, 3'UTR is 3' untranslated region, and Poly-A is 3' polyadenylation tail. In some aspects, the RNA further comprises a linker before the nsP and between the GOI and the 3'UTR.

[0050] The methods of the present disclosure can be performed in vitro or in vivo. In one aspect of any of the methods of the present disclosure, transcription is performed in vitro.

[0051] In one aspect, the present disclosure provides nucleic acids and modified regulatory elements whose use improves transcription efficiency while reducing the amount of truncated single-stranded RNA (ssRNA) (e.g., sa-mRNA) transcripts produced during in vitro transcription (IVT) reactions. In a typical IVT reaction, greater than 50% (volume molarity) of the RNA transcripts produced are truncated, abortive products (referred to herein as truncated ssRNA transcripts). Only a small fraction (e.g., 0.2%-0.5%) of initiation events produce full-length "runoff" ssRNA transcripts, which is inefficient and costly for large-scale IVT RNA synthesis systems. In particular, sa-mRNA transcripts are longer than conventional mRNA (over 7 kilonucleotides long) and are particularly susceptible to truncated abortive products. Thus, in some aspects, use of the disclosed IVT methods (which include, for example, nucleic acids, modified promoters, and / or modified 5'UTRs) results in at least a 40% higher yield of sa-mRNA transcripts compared to the yield of sa-mRNA transcripts using IVT methods that do not use the disclosed modified regulatory elements.

[0052] In one aspect, the present disclosure provides a nucleic acid template comprising a modified T7 promoter operably linked to a nucleic acid comprising a sequence encoding a modified 5' untranslated region (UTR), a plurality of nonstructural replicase domain sequences, one or more genes of interest (GOIs), a 3'UTR, and a poly-A tail, wherein the sequence encoding the T7 promoter and the sequence encoding the 5'UTR are modified to enhance the binding strength of the T7 polymerase to the T7 promoter to increase transcript yield.

[0053] In some aspects, the modified T7 promoter comprises at least one insertion at the 5' end of the wild-type T7 promoter nucleotide sequence. For example, the modification can be the insertion of a single guanine (G) at the 5' end of the wild-type T7 promoter. In some aspects, the modified T7 promoter comprises SEQ ID NO: 47 (TAATACGACTCACTATAGG).

[0054] In some aspects, the modified 5'UTR comprises at least one insertion at position 3 relative to the 5' end of the wild-type 5'UTR nucleotide sequence. The modification can be, for example, the insertion of a single adenine (A) at position 3 of the wild-type 5'UTR of wild-type T7-VEE-GFP (SEQ ID NO: 42). In some aspects, the modified 5'UTR comprises ATAGG.

[0055] In one aspect, the present disclosure provides nucleic acids and modified regulatory elements, the use of which modulates, preferably reduces, the immunogenicity and / or immunostimulatory capacity (immune response to mRNA) (preferably self-amplifying mRNA) (by preferably increasing the adenine (A) content of the 3'UTR), the mRNA encoding at least one biologically active polypeptide or protein. In some aspects, the use of the nucleic acids and modified regulatory elements of the present disclosure (which include, for example, nucleic acid constructs and / or modified 3'UTRs) results in an interferon response that is 1 / 2, 1 / 3, 1 / 4, or 1 / 5 times lower than the interferon response to self-amplifying mRNA without the use of the modified regulatory elements of the present disclosure one day after transfection. In one aspect, the nucleic acids and modified regulatory elements of the present disclosure are capable of regulating, preferably reducing, the immunogenicity and / or immunostimulatory capacity (immune response to mRNA) (by preferably increasing the adenine (A) content of the 3'UTR), the mRNA encoding at least one biologically active polypeptide or protein. 1 -methylpseudouridine-5'-triphosphate)-induced reduction of interferon response.

[0056] In some aspects, the modified 3'UTR comprises at least one modification at any one of positions 6, -1, or -2 relative to the conserved 19-nucleotide sequence of SEQ ID NO: 49 (GGATTTTGTTTTTAATATTTC). The modification can be, for example, a mutant 3'UTR of an alphavirus comprising a point mutation at position 6 relative to the conserved 19-nucleotide sequence of SEQ ID NO: 49 of the wild-type 3'UTR of an alphavirus. The modification can also be, for example, a mutant 3'UTR of an alphavirus comprising point mutations at positions -1 and -2 relative to the conserved 19-nucleotide sequence of SEQ ID NO: 49 of the wild-type 3'UTR of an alphavirus. The modification can also be, for example, a mutant 3'UTR of an alphavirus comprising point mutations at positions -1, -2, and 6 relative to the conserved 19-nucleotide sequence of SEQ ID NO: 49 of the wild-type 3'UTR of an alphavirus. In some aspects, the modified 3'UTR consensus sequence comprises GGATTTTATTTTTAATATTTC (SEQ ID NO: 50), AAATTTTGTTTTTAATATTTC (SEQ ID NO: 51), or AAATTTTATTTTTAATATTTC (SEQ ID NO: 52).

[0057] In one aspect, the bioactive agent comprises an sa-mRNA comprising a polynucleotide sequence selected from the group consisting of:

[0058] a) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 1 (BA.1-1273);

[0059] b) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 2 (BA.1-1273-S2P);

[0060] c) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 3 (BA.2-1273);

[0061] d) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 4 (BA.2-1273-S2P);

[0062] e) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 5 (BA.1-1208); or

[0063] f) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 6 (BA.1-1208-S2P);

[0064] g) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 7 (BA.2-1208); or

[0065] h) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 8 (BA.2-1208-S2P).

[0066] In one aspect, the sa-mRNA of the present disclosure encodes two separate expression units, the sa-mRNA comprising:

[0067] i) a first expression unit comprising a polynucleotide encoding a modified antigen, wherein the polynucleotide encoding the modified antigen is truncated to not include nucleotides encoding amino acids of the transmembrane domain and the short cytoplasmic domain of the antigen, the polynucleotide being operably linked to a first subgenomic promoter; and

[0068] ii) a second expression unit encoding an immune modulator (IM) operably linked to a second subgenomic promoter.

[0069] In one aspect, the polynucleotide sequence encoding the modified antigen comprises replacement of the transmembrane domain of the antigen with a secreted antigen. In one aspect, the antigen is a modified SARS-CoV-2 spike protein, wherein the polynucleotide has been truncated to not include nucleotides encoding the SARS-CoV-2 transmembrane domain and short cytoplasmic domain amino acids. In one aspect, the polynucleotide sequence encoding the coronavirus spike protein, wherein the polynucleotide has been truncated to not include nucleotides encoding the SARS-CoV-2 transmembrane domain and short cytoplasmic domain amino acids corresponding to amino acids 1209-1273 of the polynucleotide, is selected from the group consisting of SEQ ID NO: 1 (BA.1-1273) and SEQ ID NO: 3 (BA.2-1273).

[0070] In one aspect, the sa-mRNA comprises, from 5' to 3', the following operably linked nucleic acid sequence:

[0071] nsP-SGP1-Ag-SGP2-IM

[0072] in

[0073] nsP is a sequence of multiple nonstructural replicase domains.

[0074] SGP1 is the first subgenomic promoter,

[0075] Ag is a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208), SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208) or SEQ ID NO: 8 (BA.2-1208-S2P).

[0076] SGP2 is the second subgenomic promoter, and

[0077] IM is an immune modulator.

[0078] In one aspect, the sa-mRNA comprises, from 5' to 3', the following operably linked nucleic acid sequence:

[0079] nsP-SGP1-IM-SGP2-AG

[0080] in

[0081] nsP is a sequence of multiple nonstructural replicase domains.

[0082] SGP1 is the first subgenomic promoter,

[0083] IM is an immune regulator.

[0084] SGP2 is the second subgenomic promoter, and

[0085] Ag is a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208), SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208) or SEQ ID NO: 8 (BA.2-1208-S2P).

[0086] In some aspects, the IM encodes one or more cytokines, chemokines, immunostimulators, or inhibitors. In one aspect, the IM is selected from IL12 and IL21. In one aspect, the IM encodes one or more cytokines selected from SEQ ID NO: 22 (hIL12-P40), SEQ ID NO: 24 (hIL12-P35), SEQ ID NO: 15 (mIL12 P40), SEQ ID NO: 17 (mIL12-P35), and SEQ ID NO: 19 (mIL21). In one aspect, SGP1 is SEQ ID NO: 9 (SGP1). In one aspect, SGP2 is SEQ ID NO: 11 (SGP2). In one aspect, the IM is selected from SEQ ID NO: 13 (IM1) and SEQ ID NO: 20 (IM2).

[0087] In another aspect, the present disclosure includes a sa-mRNA comprising, from 5' to 3', the following operably linked nucleic acid sequences:

[0088] SP-IL12 P40-L1–IL12 P35-L2–IL21

[0089] in

[0090] SP is a signal peptide,

[0091] IL12-p40 is interleukin-12 containing the heavy chain p40.

[0092] L1 is connector 1,

[0093] IL12 P35 is interleukin-12 containing the light chain p35.

[0094] L2 is connector 2, and

[0095] IL21 is interleukin-21.

[0096] In some aspects, SP is selected from SEQ ID NO: 14 (MSP) and SEQ ID NO: 21 (HSP). In some aspects, IL12-P40 is selected from SEQ ID NO: 15 (mIL12-P40) and SEQ ID NO: 22 (hIL12-P40). In some aspects, L1 is selected from SEQ ID NO: 16 (L(a)) and SEQ ID NO: 23 (L(c)). In some aspects, IL12-P35 is selected from SEQ ID NO: 17 (mIL12-P35) and SEQ ID NO: 24 (hIL12-P35). In some aspects, L2 is selected from SEQ ID NO: 18 (L(b)) and SEQ ID NO: 25 (L(d)). In some aspects, IL12-P40 is selected from SEQ ID NO: 19 (mIL21) and SEQ ID NO: 26 (hIL21).

[0097] In some aspects, the at least one nonstructural replicase domain sequence comprises a sequence selected from a Group IV RNA virus selected from the families Picornaviridae, Togaviridae, Coronaviridae, Hepeviridae, Caliciviridae, Flaviviridae, and Astroviridae. In some aspects, the at least one nonstructural replicase domain sequence comprises a sequence selected from the group consisting of Eastern Equine Encephalitis virus (EEE), Venezuelan Equine Encephalitis virus (VEE), Everglades virus, Mucambo virus, Pixuna virus, Western Equine Encephalitis virus (WEE), Sindbis virus, Semliki Forest virus, Middelburg virus, Chikungunya virus, O'nyong-nyong virus, Ross River virus, Barmah Forest virus, Getah virus, Sagiyama virus, Bebaru virus, Mayaro virus, Una virus, In some aspects, the plurality of nonstructural replicase domain sequences are sequences of alphavirus nonstructural proteins 1-4 (nsP1-4).

[0098] In some aspects, SGP1 is a viral promoter recognized by viral RNA-dependent RNA polymerase (RdRP). In some aspects, SGP2 is a viral promoter recognized by viral RNA-dependent RNA polymerase (RdRP). In some aspects, SGP1 and SGP2 are different subgenomic promoters.

[0099] In some aspects, the sa-mRNA of the present disclosure comprises one or more linkers. In some aspects, the linker is selected from the group consisting of SEQ ID NO: 13 (L(a)), SEQ ID NO: 15 (L(b)), SEQ ID NO: 20 (L(c)), and SEQ ID NO: 22 (L(d)).

[0100] In some aspects, the sa-mRNA of the present disclosure comprises a polynucleotide encoding a modified SARS-CoV-2 spike protein. In some aspects, the polynucleotide encoding the modified SARS-CoV-2 spike protein comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273), SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208), and SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208), or SEQ ID NO: 8 (BA.2-1208-S2P).

[0101] The molecules, platforms, methods, and other aspects of the present disclosure can be used, for example, to increase the expression of certain biologically active proteins in cell transcription and expression. In some aspects, the present disclosure can be used to induce the expression of recombinant proteins. For example, this includes recombinant antibodies, hormones, cytokines, enzymes, and the like.

[0102] The nucleic acid molecules of the present disclosure can also be used in gene therapy applications. Thus, in some aspects, the nucleic acid molecules of the present disclosure can be gene therapy vectors and used to express transgenes. Preferably, an alphavirus vector system can be used.

[0103] The nucleic acid molecules of the present disclosure can also be used for gene regulation applications. In some aspects, the present disclosure can be used to regulate, increase or decrease the transcription of certain genes for therapeutic purposes. This includes, for example, small interfering RNA (siRNA), guide RNA (gRNA), microRNA (miRNA), self-activating RNA (saRNA), transfer RNA (tRNA), long intergenic non-coding RNA (lincRNA), etc.

[0104] Cells can be transfected with these nucleic acid molecules in vitro, for example in lymphocytes or dendritic cells, or these nucleic acid molecules can be directly administered in vivo.

[0105] The Sa-mRNA disclosed herein (e.g., obtained using the nucleic acid molecules described herein as transcription templates) can be used, for example, for transient expression or silencing of genes, with possible application areas being self-amplifying mRNA-based vaccines (transfected into cells in vitro or directly administered in vivo), transient expression of functional recombinant proteins in vitro (e.g., to study protein function), and transient expression or silencing of functional proteins (such as erythropoietin, hormones, coagulation inhibitors, etc.), especially as drugs, in vivo.

[0106] The Sa-mRNA disclosed herein can be used to transfect antigen-presenting cells, thereby serving as a means for delivering an antigen to be presented, wherein the antigen corresponds to a peptide, protein, or protein fragment expressed by or derived from the self-amplifying mRNA, particularly by intracellular processing such as cleavage. Such antigen-presenting cells can be used to stimulate T cells, particularly CD4+ and / or CD8+ T cells.

[0107] Thus, in another aspect, the present disclosure relates to the use of the self-amplifying mRNA of the present disclosure to transfect a host cell. In one aspect, the host cell is an antigen presenting cell, such as a dendritic cell, a monocyte or a macrophage.

[0108] In another aspect, the present disclosure relates to the use of the sa-mRNA of the present disclosure for therapy, in particular for vaccination.

[0109] In another aspect, the present disclosure relates to a pharmaceutical composition, such as a vaccine composition, comprising the sa-mRNA of the present disclosure. In one aspect, the sa-mRNA of the present disclosure is formulated in a pharmaceutically acceptable carrier. In some aspects, the pharmaceutically acceptable carrier is a sa-mRNA delivery system, preferably a nanoparticle composition. In some aspects, the nanoparticle composition comprises a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid.

[0110] In one aspect, the present disclosure provides a method of delivering a peptide to a subject, the method comprising administering to the subject a pharmaceutical composition containing one or more self-amplifying mRNAs of the present disclosure, wherein the sa-mRNA of the present disclosure produces a detectable amount of the peptide in a tissue of the subject.

[0111] In another aspect, the present disclosure relates to the use of the sa-mRNA of the present disclosure as a research tool, for example, transfecting cells with the sa-mRNA of the present disclosure encoding a reporter gene, particularly a reporter gene encoding green fluorescent protein (GFP).

[0112] Also provided herein are methods for generating libraries of sa-mRNA using the sa-mRNA disclosed herein as a reference.

[0113] Each of the aspects of the present disclosure may encompass various elements of the present disclosure. Therefore, it is contemplated that each of the aspects of the present disclosure relating to any element or combination of elements may be included in each aspect of the present disclosure. The application of the present disclosure is not limited to the configuration details and arrangement of components described in the following specific embodiments or shown in the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0114] Figure 1a A schematic diagram of a linearized nucleic acid used as a template for sa-mRNA production is shown. The abbreviations in the nucleotide sequence diagram are defined as follows: L1 is the first linker, Ori is the replication origin sequence, SM is the selectable marker, Pr1 is the first promoter sequence, L2 is the second linker, Pr2 is the second promoter sequence, 5'UTR is the 5' untranslated region, nsP is the multiple nonstructural replicase domain sequences, SGP is the subgenomic promoter, L3 is the third linker, GOI is one or more genes of interest, L4 is the fourth linker, 3'UTR is the 3' untranslated region, and Poly-A is the 3' polyadenylation tail. It is noteworthy that any of the various exemplary components of the molecule are optional, and the present disclosure includes aspects containing fewer than all of the illustrated elements. Figure 1b Shown are the engineered sa-mRNA constructs (SAM001, SAM002, and SAM003) of the present disclosure and the nucleotide and amino acid sequences that are altered in the nsP region compared to wild-type SAM001.

[0115] Figure 2 Shown is FACS of four individual sa-mRNAs in 293T cells over time.

[0116] Figure 3 Shown are FACS of SAM002 and T7-VEE-GFP sa-mRNA expressing GFP-mRNA in 293T cells at day 1 post-transfection.

[0117] Figure 4 Comparison of the nucleotide sequences of the junction region between the T7 promoter and the 5′UTR in T7-VEE-GFP and SAM002 is shown.

[0118] Figure 5 Shown are sa-mRNAs produced by in vitro transcription using micrograms of template within 30 minutes of in vitro transcription using T7 polymerase.

[0119] Figure 6The structure prediction of the 3'UTR of wild-type VEE is shown.

[0120] Figure 7 Shown is a nucleotide sequence comparison of the conserved 19 nucleotide sequence of the 3'UTR of wild-type VEE and the modified sequences of the present disclosure.

[0121] Figure 8 Shown are reporter gene assays for five individual sa-mRNAs in Raw-ISG-Lucia cells at day 1 post-transfection.

[0122] Figure 9 Shown are reporter gene assays for four individual sa-mRNAs in Raw-ISG-Lucia cells at day 1 post-transfection, with GFP expression normalized by nsP3 compared to SAM002.

[0123] Figure 10 Schematic diagram of an in vivo experiment showing the toxicity of the E6-C9 LNP formulation by examining the changes in blood sampling and body weight of Balb / C mice injected intramuscularly at doses of 10, 5, 2.5, and 1.25 μg mRNA (5 mice / group). Blood was collected and the body weight of the mice was measured on days 0, 1, 3, and 7 after injection.

[0124] Figure 11 Shown are the body weight changes of Balb / C mice injected intramuscularly with doses of 10, 5, 2.5, 1.25 μg mRNA on days 0, 1, 3, and 7 after injection (5 mice / group).

[0125] Figure 12 Shown are changes in the proinflammatory cytokine IFNg in mice injected intramuscularly at a dose of 10, 5, 2.5, 1.25 μg mRNA at day 0, 1, 3, and 7 post-injection (5 mice / group). The positive control (standard) is marked in red. Elisa graphs of absorbance (Y-axis) and dilution factor (X-axis) are shown.

[0126] Figure 13 Shown are changes in the proinflammatory cytokine IL6 in mice injected intramuscularly with 10, 5, 2.5, and 1.25 μg mRNA at days 0, 1, 3, and 7 after injection (5 mice / group). The positive control (standard) is marked in red. Elisa graphs of absorbance (Y-axis) and dilution factor (X-axis) are shown.

[0127] Figure 14Shown are changes in the proinflammatory cytokine IL1-β in mice injected intramuscularly with 10, 5, 2.5, and 1.25 μg mRNA at days 0, 1, 3, and 7 after injection (5 mice / group). The positive control (standard) is marked in red. Elisa graphs of absorbance (Y-axis) and dilution factor (X-axis) are shown.

[0128] Figure 15 Shown are changes in the proinflammatory cytokine TNFα in mice injected intramuscularly at doses of 10, 5, 2.5, and 1.25 μg mRNA at days 0, 1, 3, and 7 post-injection (5 mice / group). The positive control (standard) is marked in red. Elisa graphs of absorbance (Y-axis) and dilution factor (X-axis) are shown.

[0129] Figure 16 A schematic diagram of the disclosed mRNA sequences of BioNTech-Pfizer (BNT162b2) and Moderna vaccines (mRNA-1273) is shown. The antigen is 1273 amino acids, including S1 (RBD), S2, a transmembrane domain, and a short cytoplasmic domain. Because the transmembrane domain causes the spike antigen to be expressed on the cell surface, the transfected cells can be targeted by the immune system, which may cause BNT162b2 and mRNA-1273 to induce hepatitis and myocarditis. The schematic diagram also shows the location of the two proline mutations (S2P) on S2, which are present in the mRNA of the new crown vaccine BNT162b2, but not in the mRNA of mRNA-1273. This form of the mRNA polypeptide sequence encoding the spike protein is referred to as "1273" below.

[0130] Figure 17 A schematic diagram of the truncated, secreted form of the spike protein (1-1208) is shown. Amino acids 1-1208 were used for structural studies of the truncated spike protein ("1028"). The schematic also shows the location of the two proline mutations (S2P) on S2, which are present in the mRNA of the COVID-19 vaccine BNT162b2 but not in the mRNA of mRNA-1273.

[0131] Figure 18FACS plots of GFP (a) expression (X-axis) and 7-AAD live-dead dye staining (Y-axis) of E6-LNPs containing sa-mRNA encoding SARS-CoV-2-BA.1-1273, SARS-CoV-2-BA.2-1273, SARS-CoV-2-BA.1-1273-S2P, and SARS-CoV-2-BA.2-1273-S2P were transfected into 293T cells by lipofectamine. Cells were collected and flow cytometry was used to detect the spikes of Omicron BA.1 and BA.2 using SPD-M265 bnAb (broad-spectrum neutralizing antibody). The results showed that S2P is not necessary for stabilizing the structure of the spike with a transmembrane domain (recognized by SPD-M265 bnAb). Cells were analyzed by flow cytometry on day 1 after transfection.

[0132] Figure 19 Shown is a FACS graph of the binding of spike expression to its receptor ACE2 and live-dead dye staining (Y-axis) of 7-AAD. E6-LNP contains sa-mRNA encoding SARS-CoV-2-BA.1-1273, SARS-CoV-2-BA.2-1273, SARS-CoV-2-BA.1-1273-S2P and SARS-CoV-2-BA.2-1273-S2P, which is transfected into 293T cells by lipofectamine. The treated cells were collected and the spikes of Omicron BA.1 and BA.2 were detected by flow cytometry using ACE 2 conjugated to FITC. The results show that S2P is unnecessary for stabilizing the structure of the spike with a transmembrane domain (recognized by the spike receptor ACE2 conjugated to FITC). Cells were analyzed by flow cytometry on the first day after transfection.

[0133] Figure 20 ELISA data are shown with absorbance on the Y-axis and dilution factor on the X-axis, comparing the effect of S2P on the secreted forms of BA.1-1208, BA.1-1208-S2P, BA.2-1208, and BA.2-1208-S2P by lipofectamine transfection of 293T cells with different sa-mRNAs encoding BA.1-1208, BA.1-1208-S2P, BA.2-1208, and BA.2-1208-S2P, and detecting absorbance using SPD-M265-bnAb. The data suggest that S2P is essential for stabilizing the structure of secreted spikes that do not have a transmembrane domain. Supernatants of transfected cells were analyzed by ELISA on day 1 post-transfection.

[0134] Figure 21 Schematic diagram of mouse experiments is shown, in which Balb / c mice (10 mice per group) were injected with 2 μg of E6-C9-LNPs encapsulated with sa-mRNA encoding BA.2-1208, BA.2-1273, BA.2-1208-S2P, BA.2-1273-S2P, or sa-mRNA encoding SARS-CoV-2 Omicron variants alone on day 0 and 2WP1 and 2WP2 (two weeks after the second injection) to compare vaccine efficacy over time between different groups.

[0135] Figure 22 The results of the mouse experiment show the determination of the binding titer of receptor binding domain (RBD)-specific immunoglobulin G (IgG) against SARS-CoV-2, in which Balb / c mice (10 mice per group) were injected with 2 μg of E6-C9-LNPs encoding sa-mRNAs including BA.2-1208, BA.2-1273, BA.2-1208-S2P, BA.2-1273-S2P, or sa-mRNAs encoding SARS-CoV-2 Omicron variants alone on day 0 and 2WP1 and 2WP2 (two weeks after the second injection) to compare the vaccine efficacy over time between different groups.

[0136] Figure 23 A schematic diagram of the dual subgenomic promoter sa-mRNA is shown, where the expression vector encodes SARS-CoV-2 antigens and immune modulators (such as cytokines, etc.) under subgenomic promoters 1 and 2, respectively.

[0137] Figure 24 A schematic diagram of the dual subgenomic promoter sa-mRNA is shown, where the expression vector encodes immune modulators (such as cytokines, etc.) and SARS-CoV-2 antigens under subgenomic promoters 1 and 2, respectively.

[0138] Figure 25Transcripts for nsP3 and enhanced green fluorescent protein (eGFP) encoded by sa-mRNA and modified mRNA constructs SAM001, SAM002, SAM003, and modified mRNA from MOD001, normalized to mouse actin β, are shown (n=3). C2C12 cells were transfected with P6-LNPs encapsulated with SAM001 or SAM002 encoding GFP. On day 1 post-transfection, total RNA was extracted and reverse transcribed into cDNA. Quantitative polymerase chain reaction (qPCR) was then performed using probes specifically targeting nsP3 and eGFP. Fold changes in nsP3 and eGFP normalized to mouse actin β are shown (n=3).

[0139] Figure 26 The comparison of transcript expression in vivo between SAM001 and SAM002 sa-mRNA constructs encoding luciferase is shown. The P6-LNP of SAM001 or SAM002 encoding luciferase is encapsulated in the double hind leg intramuscular injection of Balb-c mice of 6-8 week age. 200 μ l luciferin (30 mg / ml) is injected into each mouse peritoneum, and after luciferin injection, imaging is performed by in vitro imaging system (Perkin Elmer) within 5 minutes. The total flux (photon / second) at the designated time point (n=10) is shown.

[0140] Figure 27 Figure 2 shows a comparison of LLC1 tumor growth treated with E2-LNP-SAM001-IL12 and E2-LNP-SAM002-IL12. 6-8 week old C57BL6 / J mice (n=5) were injected subcutaneously with 1 million Lewis lung carcinoma (LLC1) cells. On day 7 after injection, mice were treated intratumorally with PBS, E2-LNP-SAM001-IL12, and E2-LNP-SAM002-IL12. Tumor area (Y-axis) versus time (X-axis) is shown.

[0141] Figure 28a A schematic diagram of linearized SAM002 used as a template for sa-mRNA production is shown. The abbreviations in the nucleotide sequence diagram are defined as follows: 5UTR is 5' untranslated region, nsP is multiple nonstructural replicase domain sequences, SGP is subgenomic promoter, puromycin R is the puromycin resistance gene, 3UTR is 3' untranslated region, and contigs are subgenomic intervals (generated as vectors for sequencing and numbered after directed evolution for mutation identification).

[0142] Figure 28bThe positions of nucleotide and amino acid mutations in the nonstructural protein of the linearized nucleic acid after directed evolution are shown. The contig numbers correspond to the regions where mutations occurred on linearized SAM002.

[0143] Figure 28c The positions of the mutations occurring in the mutants with respect to the SAM002 contig and the number of alleles per mutant are shown.

[0144] It is noted that any of the various exemplary components of the molecule are optional, and the disclosure includes aspects containing fewer than all of the illustrated elements. DETAILED DESCRIPTION

[0145] The present disclosure relates to novel nucleic acid constructs and compositions, as well as methods for delivering one or more bioactive agents to a subject in need thereof and methods involving the novel nucleic acid constructs and compositions. The present disclosure also provides methods for delivering bioactive agents to cells, specifically, delivering therapeutic, diagnostic, and / or prophylactic agents to an organ, producing a sa-mRNA of interest in a cell, and methods for treating a disease or condition in a subject in need thereof. For example, a method for producing a sa-mRNA of interest in a cell involves contacting a nanoparticle composition comprising the sa-mRNA with the cell, thereby allowing the sa-mRNA to be translated to produce a polypeptide of interest. A method for delivering a bioactive agent to a mammalian cell or organ can involve administering a nanoparticle composition comprising the bioactive agent to a subject, wherein the administering involves contacting the cell or organ with the composition, thereby delivering the bioactive agent to the cell or organ.

[0146] Importantly, while many of the methods described and examples given in this specification focus on vaccine development, they are equally applicable to other intended uses of sa-mRNA, such as for gene therapy or gene regulation.

[0147] Although the present disclosure is described in detail below, it should be understood that the present disclosure is not limited to the specific methods, protocols and reagents described herein, as these methods, protocols and reagents may vary. It should also be understood that the terms used herein are only used to describe specific aspects and are not intended to limit the scope of the present disclosure. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art.

[0148] The present disclosure includes constructs of sa-mRNA and variants thereof shown and described, as well as methods for making and using these constructs. The present disclosure includes non-cytopathic and cytopathic forms of sa-mRNA and variants thereof. The present disclosure includes sequence and conjugate engineering between the elements of the constructs shown and described. The present disclosure includes self-amplifying mRNA that reduces the number of transcripts of sa-mRNA (e.g., nsP3) and subgenomes (e.g., eGFP) to produce less cytopathic forms of sa-mRNA. The present disclosure includes methods and constructs for expressing payload genes that encode various desired payloads for therapeutic, prophylactic, and / or diagnostic uses. The present disclosure includes methods and constructs that include structure-based engineering to control the replication rate and interferon response of sa-mRNA. The present disclosure includes methods for directed evolution to identify mutations on sa-mRNA by encoding a puromycin resistance gene in a subgenome. The present disclosure includes sa-mRNAs having identified mutations according to the present disclosure, including contigs having identified mutations, and combinations thereof. The present disclosure encompasses antigen design in combination with immune modulators, such as cytokines and chemokines, and antigens from infectious diseases and tumors.

[0149] In addition, several documents are cited throughout this specification. Each of the documents cited herein, supra or infra (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.) is hereby incorporated by reference in its entirety.

[0150] definition

[0151] As used herein, the terms "gene of interest," "genes of interest," "gene(s) of interest," "GOI," or "coding region" refer to nucleotide sequences that encode amino acids present in polypeptides and proteins produced as a result of translation of mRNA molecules, including mRNA molecules derived from sa-mRNA. For the purposes of this disclosure, GOIs include, but are not limited to, polynucleotides encoding antigens (such as the SARS-CoV2 Omicron variant) and immunomodulators (such as IL12 and IL21).

[0152] As used herein, "nucleotide" is a technical term and refers to a molecule containing a nucleoside or deoxynucleoside and at least one phosphate. A nucleoside or deoxynucleoside contains a single 5-carbon sugar moiety (e.g., ribose or deoxyribose) connected to a nitrogenous base, which is a substituted pyrimidine (e.g., cytosine (C), thymine (T), or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). A "polynucleotide" refers to a sequence of nucleotides or nucleotides.

[0153] As used herein, the term "modified nucleotide" refers to a nucleotide that contains one or more chemical modifications (e.g., substitutions) in or on the nitrogenous base of a nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G)). Nucleotide analogs can contain additional chemical modifications in or on the sugar moiety (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, a six-membered sugar analog, or an open-chain sugar analog) or phosphate of the nucleoside. There are more than 96 naturally occurring modified nucleosides on mammalian RNA. See, e.g., Limbach et al., Nucleic Acids Research, 22(12):2183-2196 (1994). The preparation of nucleotides and modified nucleotides and nucleosides is well known in the art, for example, from U.S. Patents 4,373,071, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530, 5,700,642, all of which are incorporated herein by reference in their entirety, and many modified nucleosides and modified nucleotides are commercially available.

[0154] As used herein, "nucleic acid" refers to a nucleic acid molecule. According to the present disclosure, nucleic acids include genomic DNA, cDNA, RNA, recombinantly prepared and chemically synthesized molecules. According to the present disclosure, nucleic acids can be in the form of single-stranded or double-stranded and linear or covalently closed circular molecules. The nucleic acids of the present disclosure can also contain non-natural nucleotides and modified nucleotides. "Nucleic acid" also refers to a continuous list of abbreviations, letters, characters or words representing nucleotides. In some aspects, "nucleic acid template" refers to a nucleic acid that can be transcribed into RNA (e.g., self-amplifying mRNA).

[0155] As used herein, the term "overlap" refers to a continuous region of a DNA sequence. An "overlap" can be determined by a variety of methods known in the art, such as by comparing sequencing reads of overlapping sequences, and / or by comparing sequencing reads with a database of known sequences to identify which sequencing reads have a higher probability of being continuous. Overlaps are typically assembled from a single sequence read or a combination of previously assembled sequence information and sequence reads with overlapping end or edge sequences. Typically, but not exclusively, overlaps are comprised of overlapping sequence reads that are assembled into larger sequence groupings in the absence of many regions with intervening gaps or undetermined sequences, or in the absence of regions with known sequences and unknown lengths.

[0156] The term "allele" refers to an alternative form of a gene, reference nucleic acid, or portion thereof. Alleles occupy the same locus or position on homologous chromosomes. Alleles of a particular gene or reference can differ from one another in a single nucleotide or several nucleotides and can include substitutions, deletions, and insertions of nucleotides. Alleles can also be in the form of reference nucleic acids containing mutations.

[0157] In one aspect, the library comprises the set of nucleic acid members, for example, the set of full genome, subgenomic fragment, cDNA, cDNA fragment, RNA (for example, mRNA or sa-mRNA), RNA fragment or their combination.As used herein, " member " or " library member " or other similar terms refer to the nucleic acid molecules (for example, DNA, RNA) or their combination as the member of the library.The data of each library member can include the quantity of the independent nucleoside in the amplicon produced for each allele using each primer or the nucleotide sequence of each member.In this respect of filling the database, the nucleic acid with specific allele is selected and primer is used to produce amplicon.The nucleotide sequence of amplicon can be determined using methods known in the art (such as BAC clone order-checking, physical map drawing and Sanger (Sanger) order-checking).In the database, create an entry that is associated with allele, overlapping group or library member by base composition.

[0158] As used herein, the term "selective marker" refers to the nucleotide sequence of a coding gene product that can be used to select transformed bacterial cells. Selective markers can be expressed in bacterial hosts and can include genes that make bacteria resistant to drugs such as ampicillin, chloramphenicol, erythromycin, kanamycin (neomycin) and tetracycline (Davies et al., Ann. Rev. Microbiol., 32: 469 (1978)). Selective markers can also include biosynthetic genes, such as those in histidine, tryptophan and leucine biosynthetic pathways.

[0159] As used herein, the term "regulatory element" refers to a nucleotide sequence that at least partially controls the transcription of one or more target genes. Regulatory elements can include promoters, enhancers, and other nucleic acid sequences (e.g., polyadenylation signals) that control or help control nucleic acid transcription or translation. Examples of transcriptional regulatory elements are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, Calif., 1990).

[0160] As used herein, the term "non-coding" refers to nucleotide sequences that do not encode polypeptides or expressed proteins. Non-coding sequences include, but are not limited to, introns, enhancers, promoter regions, 3' untranslated regions, 5' untranslated regions, linkers, and GOIs encoding regulatory structures.

[0161] As used herein, the term "operably linked" refers to a first molecule being connected to a second molecule, wherein the molecules are arranged in such a way that the first molecule affects the function of the second molecule. The two molecules may be part of a single continuous molecule or may not be part of a single continuous molecule, and may be adjacent or may not be adjacent. For example, if a promoter regulates the transcription of the GOI in a cell, the promoter is operably linked to the GOI. In addition, if two parts of a transcriptional regulatory element are linked together so that the transcriptional activation function of one part is not adversely affected by the presence of the other part, the two parts are operably linked to each other. Two transcriptional regulatory elements can be operably linked to each other by a linker nucleic acid (e.g., an intervening non-coding nucleic acid), or can be operably linked to each other in the absence of an intervening nucleotide.

[0162] As used herein, the term "linker" refers to a nucleotide sequence added between two nucleotide sequences for connecting the two nucleotide sequences. There is no particular limitation on the linker sequence.

[0163] As used herein, the term "subgenomic promoter" is a promoter of the subgenomic region of an alphavirus that can be used to transcribe a structural protein encoded by an RNA-dependent RNA polymerase encoded by an nsP. When two or more subgenomic promoters are present in a nucleic acid comprising multiple expression units, the promoters can be the same or different. In certain aspects, the subgenomic promoter can be modified using techniques known in the art to increase or decrease viral transcription of a protein, see, for example, U.S. Patent No. 6,592,874, which is incorporated herein by reference in its entirety.

[0164] As used herein, the term "expression unit" refers to a nucleotide sequence capable of directing the expression of a specific GOI in an appropriate cell, comprising a promoter and coding region that function in the cell. If translation is required, sequences required for proper translation of the nucleotide sequence are typically also included. A GOI can encode a protein or polypeptide of interest, but can also encode a regulatory structure of interest, such as an siRNA or any other non-coding regulatory RNA. A single nucleic acid can contain multiple expression units. An expression unit comprising a nucleotide sequence of interest can be chimeric, meaning that at least one component of the expression unit is heterologous with respect to at least one other component of the expression unit. An expression unit can also be naturally occurring but obtained in a recombinant form suitable for heterologous expression. However, typically, an expression unit is heterologous with respect to the host cell, meaning that the specific DNA or RNA sequence of the expression unit is not naturally present in the host cell and must be introduced into the host cell or an ancestor of the host cell through a transformation event. Expression of the nucleotide sequence in an expression unit can be under the control of a constitutive promoter or an inducible promoter, which initiates transcription only when the host cell is exposed to some specific external stimulus.

[0165] As used herein, the term "genomic DNA" refers to the heritable genetic information of a host organism. The genomic DNA includes the DNA of the cell nucleus (also referred to as chromosomal DNA) and also includes the DNA of other organelles (e.g., mitochondria). In some aspects, the term genomic DNA refers to the chromosomal DNA of the cell nucleus.

[0166] As used herein, the terms "polypeptide," "peptide," "oligopeptide," "gene product," "expression product," and "protein" are used interchangeably herein to refer to a polymer or oligomer of consecutive amino acid residues. The terms "gene product" and "expression product" may also refer to a regulatory structure.

[0167] As used herein, an "effective amount" of sa-mRNA refers to an amount sufficient to result in the expression of a detectable amount of an antigen or protein, e.g., an amount suitable to produce the desired therapeutic, diagnostic, or prophylactic effect.

[0168] As used herein, the term "naked" refers to a nucleic acid that is substantially free of other macromolecules, such as lipids, polymers, and proteins. A "naked" nucleic acid, such as a plasmid or sa-mRNA, is not formulated with other macromolecules that improve cellular uptake. Thus, a naked nucleic acid cannot be encapsulated by, absorbed into, or bound to liposomes, microparticles or nanoparticles, cationic emulsions, or the like.

[0169] As used herein, the term "transfection" or "transformation" refers to the introduction of one or more nucleic acids into an organism or host cell. Nucleic acids can be introduced into cells in vitro or in vivo using a variety of methods. Such methods include transfection of nucleic acid-CaPO4 precipitates, transfection of nucleic acids associated with DEAE, transfection of viruses carrying the target nucleic acid, liposome-mediated transfection, lipid nanoparticle (LNP)-mediated transfection, lipofectamine, etc.

[0170] As used herein, the term "reporter gene" relates to a molecule, typically a peptide or protein, that is encoded by the reporter gene and measured in a reporter gene assay. Existing systems typically employ an enzyme reporter gene (eg, GFP or luciferase) and measure the activity of the reporter gene.

[0171] As used herein, "encapsulation efficiency" refers to the amount of biological agent that becomes part of the nanoparticle composition relative to the initial total amount of biologically active agent used to prepare the nanoparticle composition. For example, if the total amount of biologically active agent initially provided to the composition is 100 mg, of which 97 mg of biologically active agent is encapsulated in the nanoparticle composition, the encapsulation efficiency can be 97%. As used herein, "encapsulation" can refer to completely, substantially, or partially enclosing, confining, surrounding, or enclosing.

[0172] As used herein, a "nanoparticle composition" or "LNP formulation" is a composition comprising one or more lipids. The size of the nanoparticle composition is typically micron-sized or smaller and may comprise a lipid bilayer. The nanoparticle composition encompasses lipid nanoparticles (LNP), liposomes (e.g., lipid vesicles), and lipid complexes. For example, the nanoparticle composition can be a liposome having a lipid bilayer having a diameter of 500 nm or less. For example, the lipid component of the nanoparticle composition can include one or more cationic / ionizable, pegylated, structural, or other lipids, such as phospholipids.

[0173] As used herein, a "lipid component" is a component of a nanoparticle composition that includes one or more lipids. For example, the lipid component can include one or more cationic / ionizable, pegylated, structural or other lipids, such as phospholipids.

[0174] As used herein, the term "PEG lipid" or "PEGylated lipid" refers to a lipid comprising a polyethylene glycol component. For example, the PEG lipid can be selected from the following non-limiting group: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0175] As used herein, the term "phospholipid" or "helper lipid" refers to a lipid comprising a phosphoric acid moiety and one or more carbon chains (such as unsaturated fatty acid chains). Phospholipids can comprise one or more multiple bonds (e.g., double bonds or triple bonds) (e.g., one or more unsaturated bonds). Specific phospholipids can contribute to membrane fusion. For example, cationic phospholipids can interact with one or more negatively charged phospholipids of a membrane (e.g., a cell membrane or an intracellular membrane). The fusion of phospholipids with the membrane can allow one or more components containing a lipid composition to pass through the membrane, thereby allowing, for example, one or more components to be delivered to the cell. Generally speaking, phospholipids can comprise a phospholipid moiety and one or more fatty acid moieties.

[0176] Phospholipids useful in the compositions and methods of the present disclosure can be selected from the following non-limiting group: 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diondecanoyl-sn-glycero-3-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0-Diether PC), 1-oleoyl-2-cholesterol hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diamidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME In some embodiments, the nanoparticle composition comprises DSPC. In certain embodiments, the nanoparticle composition comprises DOPE.

[0177] As used herein, an "ionizable lipid" is a lipid that can have a positive charge or partial positive charge at physiological pH, other than the lipid of formula (E6) disclosed in PCT patent application PCT / US2023 / 017777, which is incorporated herein in its entirety.

[0178] As used herein, the term "staining" includes methods for detecting cell subpopulations in a cell sample, specifically methods for detecting dead cells in a cell sample using a membrane permeable nucleic acid binding fluorescent marker. Staining methods can be used in combination with a cell capture system and / or an optical detection system to detect the presence of living cells and / or dead cells in a cell sample. For example, dead cells can be detected using fluorescent DNA binding dyes such as propidium iodide and 7-aminoactinomycin D (7-AAD) because the cell membrane integrity of dead cells is impaired compared to living cells (Lecoeur et al., 2002; Gaforio et al., Cytometry 49:8, 2002; Ormerod et al., Cytometry 14:595, 1993; Schmid et al., J. Immunol. Methods 170:145, 1994; Philpott et al., Blood 87:2244, 1996).

[0179] As used herein, the terms "treat," "treating," or "treatment" may include alleviating, reducing, or ameliorating symptoms of a disease or condition, preventing other symptoms, ameliorating or preventing potential metabolic causes of symptoms, inhibiting a disease or condition (e.g., arresting the development of a disease or condition), relieving a disease or condition, causing regression of a disease or condition, relieving a condition caused by a disease or condition, or stopping symptoms of a disease or condition. The terms "treat," "treating," or "treatment" may include, but are not limited to, prophylactic, diagnostic, and / or therapeutic treatments.

[0180] As used herein, the terms "associated with," "conjugated," "connected," "attached," and "tethered," when applied to two or more moieties, mean that the moieties are physically associated or connected to one another (whether directly or through one or more additional moieties as a connecting medium) to form a sufficiently stable structure such that the moieties remain physically associated under conditions under which the structure is used (e.g., physiological conditions).

[0181] As used herein, the phrase "biological activity" refers to a characteristic of any substance that is active in a biological system and / or organism. The term "biologically active agent" refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect. Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

[0182] As used herein, the term "payload" refers to a portion whose biological activity is delivered to and / or located in a cell or tissue that is desired. Payloads include, but are not limited to, bioactive agents and the like. In some aspects, a payload can be a nucleic acid encoding a protein or polypeptide. In some aspects, a payload can include or encode a cytokine, a chemokine, an antibody or antibody fragment, a receptor or receptor fragment, an enzyme, an enzyme inhibitor, a hormone, a lymphokine, a plasminogen activator, a natural or modified immunoglobulin or a fragment thereof, an antigen, a chimeric antibody receptor, a variable region or hypervariable region (V L 、V H ), variable fragment (Fv), Fab' fragment, F(ab')2 fragment, Fab fragment, single-chain antibody (scAb), single-chain variable region (scFv), complementarity determining region (CDR), domain antibody (dAb), BHH or BNAR type single domain heavy chain immunoglobulin, single domain light chain immunoglobulin, or other polypeptides known in the art containing AB capable of binding to a target protein or an epitope on a target protein, or any other desired biological macromolecule.

[0183] The cytokines of the present disclosure may include, but are not limited to, interferon, interleukin, GM-CSF, G-CSF, LIF, OSM, CD154, LT-β, ​​TNF-α, TNF-β, 4-1BBL, APRIL, CD70, CD153, CD178, GITRL, LIGHT, OX40L, TALL-1, TRAIL, TWEAK, TRANCE, TGF-β1, TGF-β1, TGF-β3, Epo, Tpo, Flt-3L, SCF, M-CSF and MSP, optionally wherein CP1 and / or CP2 are independently selected from IL-2, IL-7, IL-8, IL-10, IL-12, IL-15, IL-18, IL-17, IL-21, IFN-α, IFNβ, IFNγ, GM-CSF, TGF-β, LIGHT, GITR-L, CD40L, CD27L, 4-1BB-L, OX40 and OX40L.

[0184] As used herein, the term "conservative" refers to a nucleotide sequence that does not change on the same position of two or more related sequences compared. Relatively conservative nucleotide sequences are those nucleotide sequences that are conservative in the more relevant sequence than the nucleotide sequence that occurs elsewhere in the sequence. In some respects, if two or more sequences are 100% identical to each other, then they are claimed to be conservative. In some respects, if two or more sequences are approximately 95% identical, approximately 98% identical or approximately 99% identical to each other, then they are claimed to be conservative.

[0185] As used herein, the term "transcription" includes "in vitro transcription," wherein the term "in vitro transcription" relates to a method for synthesizing RNA (especially sa-mRNA) in vitro in a cell-free manner.

[0186] As used herein, "expression" of a nucleic acid refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (eg, by transcription); and (2) translation of the RNA into a polypeptide or protein.

[0187] As used herein, two nucleic acids are substantially homologous when the nucleotide sequence has at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The percent identity between two sequences is a function of the quantity of the total identical positions of the sequences, taking into account the quantity and the length of each gap that need to be introduced in order to achieve the best comparison of the two sequences. The sequence homology of nucleic acids (also referred to as percent sequence identity) is measured using sequence analysis software. See, for example, the sequence analysis software package of the Genetics Computer Group (GCG) of the University of Wisconsin Biotechnology Center (910 University Avenue, Madison, Wis. 53705). A typical algorithm used to compare a molecular sequence to a database containing a large number of sequences from different organisms is the computer program BLAST (Altschul, 1990; Gish, 1993; Madden, 1996; Altschul, 1997; Zhang, 1997), in particular blastp or tblastn (Altschul, 1997).

[0188] As used herein, the term "contacting" means establishing a physical connection between two or more entities. For example, contacting a cell with a nanoparticle composition comprising sa-mRNA means that the mammalian cell and the nanoparticle are in physical contact. Methods for contacting cells with external entities in vivo and in vitro are well known in the art of biology.

[0189] As used herein, the term "delivery" means providing an entity to a target. For example, delivering a bioactive agent to a subject can involve administering a nanoparticle composition comprising sa-mRNA (including the bioactive agent) to the subject (e.g., via an intravenous, intranasal, intratracheal, intracerebral, intratumoral, intraperitoneal, intramuscular, intradermal, or subcutaneous route).

[0190] As used herein, the term "in vitro" refers to events that occur in an artificial environment, eg, in a test tube or reaction vessel, in cell culture, in a petri dish, etc., rather than within an organism (eg, an animal, plant, or microorganism).

[0191] As used herein, the term "in vivo" refers to events that occur within an organism (eg, an animal, plant, or microorganism).

[0192] As used herein, the term "referring to" refers to an event occurring in its original location or natural environment.

[0193] As used herein, the term "isolated" means that a substance or entity has been (1) separated from at least some of the components with which it was originally associated when it was produced (whether in nature or in an experimental setting), and / or (2) produced, prepared and / or manufactured in vitro. An isolated substance and / or entity can be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more of the other components with which it was originally associated. In some aspects, the purity of the isolated agent is greater than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or greater than about 99%. As used herein, a substance is "pure" if it is substantially free of other components.

[0194] As used herein, the term "substantially" refers to the qualitative condition of exhibiting a full or nearly full degree or degree of a characteristic or property of interest.

[0195] As used herein, the term "polypeptide" or "polypeptide of interest" refers to a polymer of amino acid residues, typically linked by peptide bonds, which polymer of amino acid residues may be naturally occurring (eg, isolated or purified) or synthetically produced.

[0196] As used herein, "size" or "average size" in the context of a nanoparticle composition refers to the average diameter of the nanoparticle composition.

[0197] As used herein, the term "subject" or "patient" refers to any organism that can receive administration of a composition according to the present disclosure, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.

[0198] As used herein, the term "therapeutically effective amount" means the amount of an agent (e.g., a nucleic acid, a drug, a composition, a therapeutic agent, a diagnostic agent, a prophylactic agent, etc.) to be delivered that is sufficient, when administered to a subject having or susceptible to an infection, disease, condition, and / or disorder, to treat the infection, disease, condition, and / or disorder, to ameliorate the symptoms of the infection, disease, condition, and / or disorder, to diagnose the infection, disease, condition, and / or disorder, to prevent the infection, disease, condition, and / or disorder, and / or to delay the onset of the infection, disease, condition, and / or disorder.

[0199] As used herein, "administration method" can include intravenous, intranasal, intratracheal, intracerebral, intratumoral, intraperitoneal, intramuscular, intradermal, subcutaneous, or other methods of delivering the composition to the subject. The administration method can be selected to target delivery (e.g., specific delivery) to a specific area or system of the body.

[0200] As used herein, "modified" means non-natural. For example, RNA can be modified RNA. That is, the RNA can include one or more nucleobases, nucleosides, nucleotides, or linkers that do not occur naturally. "Modified" species can also be referred to herein as "altered" species. A species can be chemically, structurally, or functionally modified or altered. For example, a modified nucleobase species can include one or more substitutions that do not occur naturally.

[0201] As used herein, "naturally occurring" means occurring in nature without human assistance.

[0202] As used herein, the term "subgenomic" or "subgenome" refers to a nucleotide sequence (e.g., RNA or DNA) that is smaller in length or size than the genomic nucleotide sequence from which it is derived. For example, the subgenome can be a region encoding a VEE structural protein, and the subgenomic RNA can be transcribed from the subgenome using an internal subgenomic promoter, the sequence of the subgenomic RNA being present within the genomic viral RNA or its complement. Transcription of the subgenome can be mediated by a virally encoded polymerase associated with host cell-encoded proteins (e.g., nsP1-4). In some aspects of the present disclosure, the subgenomic sa-mRNA is produced from a modified alphavirus replicon (e.g., a modified VEE replicon) as disclosed herein and encodes or expresses one or more genes of interest (GOIs).

[0203] As used herein, the phrase "pharmaceutically acceptable" refers to those compounds, materials, compositions, and / or dosage forms that are reasonably suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications.

[0204] A "pharmaceutically acceptable composition" may also include one or more salts of the compound. The salt may be a pharmaceutically acceptable salt. As used herein, "pharmaceutically acceptable salt" refers to a derivative of a disclosed compound wherein the parent compound is modified by converting an existing acid or base moiety into its salt form. Generally, such salts can be prepared by reacting the free acid or base form of these compounds with a stoichiometric amount of an appropriate base or acid in water or an organic solvent, or a mixture of the two. In some aspects, non-aqueous media such as diethyl ether, ethyl acetate, ethanol, isopropanol, or acetonitrile may be used. Lists of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is herein incorporated by reference in its entirety.

[0205] As used herein, the term "innate immune response" includes cellular responses to exogenous single-stranded nucleic acids (generally derived from viruses or bacteria), which relate to the induction of cytokine expression and release, especially interferon and cell death. During the innate cellular immune response, protein synthesis also can be reduced. The disclosure provides modified self-amplification mRNA that can substantially reduce immune response (including interferon signaling). In some aspects, immune response is the interferon response of host cells, which is 1 / 2 times, 1 / 3 times, 1 / 4 times, 1 / 5 times or 1 / 6 times of the immune response induced by corresponding unmodified nucleic acid. This reduction can be measured by the expression or activity level of type 1 interferon or the expression of interferon regulatory genes (such as Toll-like receptors (for example, TLR3, TLR7 and TLR8) and RIG-I sample receptors (for example, RIG1, MDA5 and LGP2)). Reduction of the innate immune response can also be measured by a decrease in cell death following one or more administrations of the modified RNA to a cell population; for example, the cell death is an interferon response of the host cell and is 1 / 2, 1 / 3, 1 / 4, 1 / 5, or 1 / 6 the frequency of cell death observed with the corresponding unmodified nucleic acid.

[0206] As used herein, the term "immunomodulator" includes cytokines, stem cell growth factors, lymphotoxins, such as tumor necrosis factor (TNF) and hematopoietic factors, such as interleukins (e.g., interleukin-1 (IL-1), IL-2, IL-3, IL-6, IL-10, IL-12, IL-18 and IL-21), colony stimulating factors (e.g., granulocyte-colony stimulating factor (G-CSF) and granulocyte macrophage-colony stimulating factor (GM-CSF)), interferons (e.g., interferon-α, interferon-β and interferon-γ), stem cell growth factor (referred to as "S1 factor"), erythropoietin, thrombopoietin, and the like.

[0207] For the purposes of this disclosure, cytokines include any cytokine, including but not limited to IL-1, IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, IL-21, interferon-α, interferon-β and interferon-γ. The cytokine can also be a colony stimulating factor, such as GM-CSF, G-CSF, M-CSF, erythropoietin, thrombopoietin, etc.

[0208] As used herein, the terms "about" and "approximately," when applied to one or more values ​​of interest, refer to values ​​that are + / - 20% of the stated value.

[0209] Self-amplifying mRNA

[0210] In some aspects, the bioactive agents of the present disclosure are one or more sa-mRNA molecules.

[0211] The sa-mRNA disclosed herein has the ability to self-replicate in cells and can therefore be used to induce expression of gene products encoded by the sa-mRNA, such as proteins (e.g., antigens) and regulatory structures (e.g., siRNA, miRNA, saRNA, tRNA, and lincRNA). Furthermore, sa-mRNA is often based on the genome of an RNA virus (e.g., Group IV positive-sense single-stranded RNA virus) and is therefore an exogenous nucleic acid that can stimulate the innate immune system (e.g., inducing an interferon response). This can lead to undesirable outcomes and safety concerns, such as rapid inactivation and clearance of the RNA, injection site irritation and / or inflammation and / or pain.

[0212] The sa-mRNA disclosed herein contains a modified structure and has a reduced ability to stimulate the innate immune system, which can lead to rapid decay of the sa-mRNA and its associated gene products. Rapid decay of sa-mRNA and its associated gene products can lead to increased frequency of administration, which is associated with safety concerns and reduced therapeutic efficacy. Therefore, one aspect of the present invention is sa-mRNA that has reduced cytotoxic effects on host cells or subjects. This provides enhanced safety and offers additional advantages to the sa-mRNA disclosed herein. For example, an advantage of sa-mRNA with low cytotoxicity is that it allows for the administration of large doses of sa-mRNA to produce high expression levels of the encoded gene product while reducing the risk of undesirable effects, such as injection site irritation and / or pain. Furthermore, because the sa-mRNA disclosed herein have a reduced ability to stimulate the innate immune system, they are well-suited for use as vaccines to boost immunity.

[0213] For the production of sa-mRNA of the present disclosure, a suitable system is to use an alphavirus-based RNA replicon. Alphavirus-based replicons are positive (+) single-stranded replicons that can be translated to produce a replicase (or replicase-transcriptase) after delivery to the cell. The replicase is translated into a polyprotein that is automatically cleaved to provide a replication complex containing multiple non-structural replicase domain sequences, which produces a genomic (-) strand copy of the (+) strand delivered RNA. These (-) strand transcripts can themselves be transcribed to produce additional copies of the (+) strand parent RNA and can also produce mRNA transcripts encoding the desired gene product. Thus, translation of the subgenomic transcripts allows infected cells to express the desired gene product in situ.

[0214] The sa-mRNA can encode (i) an RNA-dependent RNA polymerase that can replicate RNA from the sa-mRNA and perform transcription (ii) a subgenomic GOI. The polymerase can be an alphavirus replicase, for example comprising alphavirus nonstructural proteins 1, 2, 3, and 4.

[0215] Given that native alphavirus genomes encode structural proteins in addition to nonstructural replicases, in one aspect, alphavirus-based sa-mRNAs do not encode alphavirus structural proteins. Thus, sa-mRNA can produce RNA copies of itself in cells, but does not produce RNA-containing alphavirus virions. This inability to produce these virions means that, unlike wild-type alphaviruses, sa-mRNA itself cannot persist in an infectious form. Alphavirus structural proteins, which are essential for the persistence of wild-type viruses, are absent from the self-amplifying mRNA; their place is occupied by the GOI, resulting in sa-mRNA transcripts encoding the desired gene products rather than structural alphavirus particle proteins.

[0216] Thus, the sa-mRNAs of the present disclosure can have more than one coding region. A first (5') coding region encodes multiple nonstructural replicase domain sequences; a second (3') coding region encodes a gene of interest operably linked to a subgenomic promoter. In some aspects, sa-mRNAs can have additional (downstream) coding regions, e.g., encoding other desired gene products. Coding region molecules can have 5' sequences compatible with the encoded replicase.

[0217] The sa-mRNA of the present disclosure can be derived from or based on viruses other than alphaviruses, including but not limited to Group IV positive single-stranded RNA viruses, such as picornaviridae, togaviridae, coronaviridae, hepeviridae, caliciviridae, flaviviridae, and astroviridae. Suitable wild-type alphavirus sequences are well known and available from sequence depositories such as the American Type Culture Collection (Rockville, Md.). Representative examples of suitable alphaviruses include Eastern Equine Encephalitis virus (EEE), Venezuelan Equine Encephalitis virus (VEE), Everglades virus, Mucambo virus, Pixuna virus, Western Equine Encephalitis virus (WEE), Sindbis virus, Semliki Forest virus, Middelburg virus, Chikungunya virus, O'nyong-nyong virus, Ross River virus, Barmah Forest virus, Getah virus, Sagiyama virus, Bebaru virus, Mayaro virus, Una virus, Aura virus, virus, Whataroa virus, Babanki virus, Kyzylagach virus, Highlands J virus, Fort Morgan virus, Ndumu virus and Buggy Creek virus.

[0218] As described herein, sa-mRNA can self-amplify and initiate expression of heterologous gene products in host cells. Unlike mRNA, the sa-mRNA of the present disclosure utilizes its own encoded viral polymerase to amplify itself. Certain sa-mRNAs, such as those based on Group IV RNA viruses (such as alphaviruses), generate large quantities of subgenomic mRNA from which a large number of proteins (or regulatory structures) can be expressed.

[0219] Advantageously, the host cell's own machinery is exploited by sa-mRNA to exponentially increase the encoded gene product (such as a protein, antigen, or regulatory structure), which can accumulate in the cell or be secreted from the cell. Increasing protein or antigen by self-amplifying mRNA can exploit immunostimulatory adjuvant effects, including stimulation of Toll-like receptors (TLRs) 3, 7, and 8 and non-TLR pathways (e.g., RIG-I-like receptors, RIG-I, MDA-5, LGP2), as well as translation (inducing apoptosis in transfected cells) through RNA replication and amplified products.

[0220] The sa-mRNA of the present disclosure can encode any desired gene product, such as a regulatory structure, a polypeptide, a protein or polypeptide, or a fragment of a protein or polypeptide. Furthermore, the sa-mRNA of the present disclosure can encode a single polypeptide, or optionally, two or more sequences linked together in a manner such that each sequence maintains its identity when expressed as an amino acid sequence (e.g., tandemly linked). The polypeptides produced by the sa-mRNA of the present disclosure can then be produced as fusion proteins or engineered to produce separate polypeptide or peptide sequences.

[0221] The sa-mRNA of the present disclosure can encode one or more immunogenic polypeptides containing a series of epitopes. In some aspects, such epitopes are capable of eliciting a helper T cell response or a cytotoxic T cell response, or both.

[0222] The sa-mRNA described herein can be engineered to express multiple GOIs from two or more coding regions, thereby allowing for the co-expression of proteins and / or regulatory structures, such as co-expression of two or more antigens with cytokines or other immunomodulators, which can enhance the generation of an immune response. Such sa-mRNA can be particularly useful, for example, for the simultaneous production of multiple gene products (e.g., proteins), for example, as bivalent or multivalent vaccines, or for gene therapy applications.

[0223] Exemplary gene products that can be encoded by the sa-mRNA of the present disclosure include proteins and peptides from pathogens such as bacteria, viruses, fungi, and parasites, including any antigenic viral proteins (e.g., proteins or peptides from coronaviruses, cytomegaloviruses, parvoviruses, flaviviruses, picornaviruses, noroviruses, influenza viruses, rhinoviruses, yellow fever viruses, human immunodeficiency virus (HIV), etc.). Other exemplary gene products that can be encoded by the sa-mRNA of the present disclosure include any desired eukaryotic polypeptide, for example, a mammalian polypeptide, such as an enzyme, an enzyme inhibitor, a hormone, a lymphokine, a cytokine, a chemokine, a plasminogen activator, a natural or modified immunoglobulin or fragment thereof, green fluorescent protein, or any desired combination of the foregoing. Other exemplary gene products that can be encoded by the sa-mRNA of the present disclosure include regulatory structures such as siRNA, miRNA, gRNA, saRNA, tRNA, and lincRNA, which can be used to regulate the expression of endogenous host genes.

[0224] The sa-mRNA may also comprise at least one modified nucleic acid and may be prepared using any suitable method. The modifications may include compounds selected from the non-limiting group of: pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio- 1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, Pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebullin, 5-aza-zebullin, 5-methyl-zebullin, 5-aza-2-thio-zebullin, 2-thio-zebullin, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diamino Purine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylaminoformyladenosine, N6-threonylaminoformyladenosine, 2-methylthio-N6-threonylaminoformyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wyobutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N1-methylpseudouridine-5'-triphosphate, and N2,N2-dimethyl-6-thio-guanosine. In another aspect, modification is independently selected from: 5-methylcytosine, pseudouridine and 1-methylpseudouridine. In one aspect, modification can be positioned on the core base of modified nucleic acid molecule. The modification on core base can be selected from the group consisting of the following: cytosine, guanine, adenine, thymine and uracil. The modification on core base can be selected from the group consisting of the following: deazaadenosine and deazaguanosine, and the joint can be attached at the C-7 or C-8 position of deazaadenosine or deazaguanosine. The modified core base is selected from the group consisting of the following: cytosine and uracil, and the joint can be attached to the modified core base at the N-3 or C-5 position. The joint attached to the core base can be selected from the group consisting of the following: diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, tetraethylene glycol, divalent alkyl, alkenyl, alkynyl moiety, ester, amide and ether moiety. In one aspect, the two modifications of the nucleic acid molecule can be located on nucleosides of the modified nucleic acid molecule. The modified nucleosides can be selected from 5-methylcytosine and pseudouridine.

[0225] A variety of methods are known in the art that are suitable for producing RNA molecules containing modified nucleotides. For example, as described and exemplified herein, sa-mRNA containing modified nucleotides can be prepared by transcribing (e.g., in vitro) a nucleic acid encoding the sa-mRNA using a suitable DNA-dependent RNA polymerase, such as T7 bacteriophage RNA polymerase, SP6 bacteriophage RNA polymerase, T3 bacteriophage RNA polymerase, T5 bacteriophage RNA polymerase, RNA polymerase III, RNA polymerase II, Taq polymerase, Vent polymerase, etc., or mutants of these polymerases that allow for efficient incorporation of modified nucleotides into RNA molecules. The transcription reaction will contain nucleotides and modified nucleotides, as well as other components that support the activity of the selected polymerase, such as a suitable buffer and a suitable salt. The incorporation of modified nucleotides into sa-mRNA can be engineered, for example, to alter the stability of such RNA molecules, increase resistance to RNases, establish replication ("infectivity" of the RNA) upon introduction into an appropriate host cell, and / or induce or reduce innate and adaptive immune responses.

[0226] In one aspect, the sa-mRNA of the present disclosure comprises a polynucleotide sequence selected from the group consisting of:

[0227] a) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 1 (BA.1-1273);

[0228] b) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 2 (BA.1-1273-S2P);

[0229] c) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 3 (BA.2-1273);

[0230] d) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 4 (BA.2-1273-S2P);

[0231] e) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 5 (BA.1-1208); or

[0232] f) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 6 (BA.1-1208-S2P).

[0233] g) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 7 (BA.2-1208); or

[0234] h) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 8 (BA.2-1208-S2P).

[0235] In one aspect of the present disclosure, the sa-mRNA comprises, from 5' to 3', the following operably linked nucleic acid sequence:

[0236] nsP-SGP1-Ag-SGP2-IM

[0237] in

[0238] nsP is a sequence of multiple nonstructural replicase domains.

[0239] SGP1 is the first subgenomic promoter,

[0240] Ag is a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208) or SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208) or SEQ ID NO: 8 (BA.2-1208-S2P).

[0241] SGP2 is the second subgenomic promoter, and

[0242] IM is an immune modulator.

[0243] In one aspect, the sa-mRNA comprises, from 5' to 3', the following operably linked nucleic acid sequence:

[0244] nsP-SGP1-IM-SGP2-AG

[0245] in

[0246] nsP is a sequence of multiple nonstructural replicase domains.

[0247] SGP1 is the first subgenomic promoter,

[0248] IM is an immune regulator.

[0249] SGP2 is the second subgenomic promoter, and

[0250] Ag is a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208) or SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208) or SEQ ID NO: 8 (BA.2-1208-S2P).

[0251] In some aspects, the IM encodes one or more cytokines, chemokines, immunostimulators, or inhibitors. In one aspect, the IM is selected from IL12 and IL21. In one aspect, the IM encodes one or more cytokines selected from SEQ ID NO: 22 (hIL12-P40), SEQ ID NO: 24 (hIL12-P35), SEQ ID NO: 15 (mIL12 P40), SEQ ID NO: 17 (mIL12-P35), and SEQ ID NO: 21 (mIL21). In one aspect, SGP1 is SEQ ID NO: 9 (SGP1). In one aspect, SGP2 is SEQ ID NO: 11 (SGP2). In one aspect, the IM is selected from SEQ ID NO: 13 (IM1) and SEQ ID NO: 20 (IM2).

[0252] In another aspect, the present disclosure includes a sa-mRNA comprising, from 5' to 3', the following operably linked nucleic acid sequences:

[0253] SP-IL12 P40-L1–IL12 P35-L2–IL21

[0254] in

[0255] SP is a signal peptide,

[0256] IL12-p40 is interleukin-12 containing the heavy chain p40.

[0257] L1 is connector 1,

[0258] IL12 P35 is interleukin-12 containing the light chain p35.

[0259] L2 is connector 2, and

[0260] IL21 is interleukin-21.

[0261] In some aspects, SP is selected from SEQ ID NO: 14 (MSP) and SEQ ID NO: 21 HSP. In some aspects, IL12-P40 is selected from SEQ ID NO: 15 (mIL12-P40) and SEQ ID NO: 22 (hIL12-P40). In some aspects, L1 is selected from SEQ ID NO: 16 (L(a)) and SEQ ID NO: 23 (L(c)). In some aspects, IL12-P35 is selected from SEQ ID NO: 17 (mIL12-P35) and SEQ ID NO: 24 (hIL12-P35). In some aspects, L2 is selected from SEQ ID NO: 18 (L(b)) and SEQ ID NO: 25 (L(d)). In some aspects, IL12-P40 is selected from SEQ ID NO: 19 (mIL21) and SEQ ID NO: 26 (hIL21).

[0262] In some aspects, the at least one nonstructural replicase domain sequence comprises a sequence selected from a Group IV RNA virus selected from the families Picornaviridae, Togaviridae, Coronaviridae, Hepeviridae, Caliciviridae, Flaviviridae, and Astroviridae. In some aspects, the at least one nonstructural replicase domain sequence comprises a sequence selected from the group consisting of Eastern Equine Encephalitis virus (EEE), Venezuelan Equine Encephalitis virus (VEE), Everglades virus, Mucambo virus, Pixuna virus, Western Equine Encephalitis virus (WEE), Sindbis virus, Semliki Forest virus, Middelburg virus, Chikungunya virus, O'nyong-nyong virus, Ross River virus, Barmah Forest virus, Getah virus, Sagiyama virus, Bebaru virus, Mayaro virus, Una virus, In some aspects, the plurality of nonstructural replicase domain sequences are sequences of alphavirus nonstructural proteins 1-4 (nsP1-4).

[0263] In some aspects, SGP1 is a viral promoter recognized by viral RNA-dependent RNA polymerase (RdRP). In some aspects, SGP2 is a viral promoter recognized by viral RNA-dependent RNA polymerase (RdRP). In some aspects, SGP1 and SGP2 are different subgenomic promoters.

[0264] In some aspects, the sa-mRNA of the present disclosure comprises one or more linkers. In some aspects, the linker is selected from the group consisting of SEQ ID NO: 16 (L(a)), SEQ ID NO: 18 (L(b)), SEQ ID NO: 23 (L(c)), and SEQ ID NO: 25 (L(d)).

[0265] In some aspects, the sa-mRNA of the present disclosure comprises a polynucleotide encoding a modified SARS-CoV-2 spike protein. In some aspects, the polynucleotide encoding the modified SARS-CoV-2 spike protein comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273), SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208), SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208), and SEQ ID NO: 8 (BA.2-1208-S2P).

[0266] The sa-mRNA disclosed herein can be introduced into target cells or subjects using any suitable technique, such as direct injection, microinjection, electroporation, lipofection, biolistics, and the like. Sa-mRNA can also be introduced into cells via receptor-mediated endocytosis. See, for example, U.S. Patent No. 6,090,619; Wu and Wu, J. Biol. Chem., 263:14621 (1988); and Curiel et al., Proc. Natl. Acad. Sci. USA, 88:8850 (1991).

[0267] The sa-mRNA disclosed herein can be delivered to cells via amphiphiles. See, for example, U.S. Patent No. 6,071,890. Generally, nucleic acid molecules can form complexes with cationic amphiphiles. Mammalian cells that come into contact with the complexes can readily absorb the complexes.

[0268] The sa-mRNA of the present disclosure can be delivered as naked RNA (e.g., simply as an aqueous solution of RNA), but to enhance cellular entry and subsequent extracellular effects, the sa-mRNA can be administered in combination with a delivery system, such as a particle or emulsion delivery system. Many delivery systems are well known to those skilled in the art. Such delivery systems include, for example, lipid nanoparticle-based delivery (Debs and Zhu (1993) WO 93 / 24640; Mannino and Gould-Fogerite (1988) BioTechniques 6(7):682-691; Rose, U.S. Pat. No. 5,279,833; Brigham (1991) WO 91 / 06309; and Feigner et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7414), as well as the use of viral vectors {e.g., adenoviral vectors (see, e.g., Berns et al. (1995) Ann. NY Acad. Sci. 772:95-104; AIi et al. (1994) Gene Ther. 1:367-384; and Haddada et al. (1995) Curr. Top. Microbiol. Immunol. 199 (Pt 3):297-306), human papillomavirus vectors, retroviral vectors (see, e.g., Buchscher et al. (1992) J. Virol. 66(5):2731-2739; Johann et al. (1992) J. Virol. 66(5):1635-1640 (1992); Sommerfelt et al. (1990) Virol. 176:58-59; Wilson et al. (1989) J. Virol. 63:2374-2378; Miller et al., J. Virol. 65:2220-2224 (1991); Wong-Staal et al., PCT / US94 / 05700, and Rosenburg and Fauci (1993), in Fundamental Immunology, 3rd ed., Paul (ed.), Raven Press, Ltd., New York and references therein, and Yu et al., Gene Therapy (1994), supra), and adeno-associated viral vectors (see, West et al. (1987) Virology 160:38-47; Carter et al. (1989) U.S. Patent 4,797,368; Carter et al., WO 93 / 24641 (1993); Kotin (1994) Human Gene Therapy 5:793-801; Muzyczka (1994) J. Clin.Invst. 94:1351 and Samulski (see above) for an overview of AAV vectors; see also Lebkowski, U.S. Patent 5,173,414; Tratschin et al. (1985) MoI. Cell. Biol. 5(11):3251-3260; Tratschin et al. (1984) MoI. Cell. Biol, 4:2072-2081; Hermonat and Muzyczka (1984) Proc. Natl. Acad. Sci. USA, 81:6466-6470; McLaughlin et al. (1988) and Samulski et al. (1989) J. Virol, 63:03822-3828), etc.

[0269] Three particularly useful delivery systems are (i) LNPs (ii) non-toxic and biodegradable polymer microparticles (iii) cationic submicron oil-in-water emulsions. In one aspect, the sa-mRNA of the present disclosure is delivered using LNPs.

[0270] In one aspect, the sa-mRNA of the present disclosure encodes two separate expression units, a first expression unit comprising a polynucleotide encoding a modified antigen, wherein the polynucleotide encoding the modified antigen is truncated to nucleotides that do not comprise amino acids encoding the transmembrane domain and short cytoplasmic domain of the antigen, the polynucleotide being operably linked to a first subgenomic promoter; and a second expression unit encoding an immunomodulator (IM), the second expression unit being operably linked to a second subgenomic promoter. The polynucleotide encoding the modified antigen comprises a sequence having 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208), SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208), SEQ ID NO: 8 (BA.2-1208-S2P). In addition, in some aspects, the "T" in any one of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 is replaced with "U". It will be appreciated by those skilled in the art that due to the degenerate nature of the genetic code, a given amino acid may be encoded using codons that differ in the nucleotide sequence. The specific nucleotide sequences encoding the polypeptides described herein are cited merely to illustrate one aspect of the disclosure, and the disclosure includes nucleic acids encoding any sequence of polypeptides comprising the same amino acid sequence as the polypeptides and proteins used in the methods of the disclosure. Similarly, polypeptides can generally tolerate one or more amino acid substitutions, deletions, and insertions in their amino acid sequences without losing or significantly losing the desired activity. The disclosure includes such polypeptides having alternative amino acid sequences, and the amino acid sequences encoded by the RNA or DNA sequences shown herein merely illustrate aspects of the disclosure.

[0271] In one aspect, the sa-mRNA of the present disclosure comprises, from 5' to 3', alphavirus nonstructural proteins 1-4 (nsP1-4) from the TC-83 strain of Venezuelan equine encephalitis virus (VEE); a first subgenomic promoter, a first expression unit encoding an antigen selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273), and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208), SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208), SEQ ID NO: 8 (BA.2-1208-S2P), a second subgenomic promoter, and a second expression unit encoding one or more immunomodulators. In some aspects, the second expression unit encodes from 5' to 3: a signal peptide, interleukin-12 containing heavy chain p40 (IL12-P40), linker 1 (L1), interleukin-12 containing light chain p35 (IL12 P35), linker 2 (L2), and interleukin-21 (IL21).

[0272] In one aspect, the sa-mRNA of the present disclosure comprises alphavirus nonstructural proteins 1-4 (nsP1-4) from the TC-83 strain of Venezuelan equine encephalitis virus (VEE); a first subgenomic promoter, a first expression unit encoding one or more immunomodulators, a second subgenomic promoter, and a second expression unit encoding an antigen selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208), SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.1-1208), SEQ ID NO: 8 (BA.1-1208-S2P). In some aspects, the second expression unit encodes from 5' to 3': a signal peptide, interleukin-12 containing heavy chain p40 (IL12-P40), linker 1 (L1), interleukin-12 containing light chain p35 (IL12 P35), linker 2 (L2), and interleukin-21 (IL21).

[0273] In one aspect, the sa-mRNA of the present disclosure may comprise one or more custom GOIs constructed by synthetic methods known in the art or cloned from cDNA or genomic libraries.

[0274] The sa-mRNA disclosed herein may encode an antigen that can be tested for its ability to induce a humoral immune response, for example, by inducing B cells to produce antibodies specific for the antigen of interest. These assays can be performed using, for example, peripheral B lymphocytes from immunized individuals. Such assays are known to those skilled in the art. Other assays that can be used to characterize the sa-mRNA disclosed herein may involve detecting expression of the encoded antigen by target cells. For example, FACS can be used to detect antigen expression on the cell surface or within the cell. Another advantage of FACS selection is that it can be sorted by different expression levels; sometimes lower expression may be desirable. Other suitable methods for identifying cells expressing a specific antigen involve panning using monoclonal antibodies on plates or capture using magnetic beads coated with monoclonal antibodies.

[0275] De novo synthesis of self-amplifying mRNA

[0276] The sa-mRNA disclosed herein can be produced from a nucleic acid template in the form of a recombinant DNA expression vector, an RNA replicon, or a plasmid. The nucleic acid template disclosed herein encodes two expression units, the nucleic acid template comprising: i) an origin of replication sequence (Ori); ii) a first expression unit encoding a first nucleotide sequence operably linked to a first promoter; and iii) a second expression unit encoding a second nucleotide sequence operably linked to a second promoter, wherein the first expression unit encodes a selectable marker and the second expression unit encodes the sa-mRNA.

[0277] Nucleic acid template can be produced using suitable synthetic method alone or using the combination of suitable synthetic method and one or more other methods.Such method is well known in the art, including chemical synthesis (Masuda et al., (2007) Nucleic Acids Symposium Series 57:3-4) carried out using suitable protecting groups (such as CEM), β-cyanoethyl phosphoramidite method (Beaucage SL et al. (1981) Tetrahedron Lett 22:1859);Nucleoside H-phosphonate method (Garegg P et al. (1986) Tetrahedron Lett 27:4051-4;Froehler BC et al. (1986) Nucl Acid Res 14:5399-407;Garegg P et al. (1986) Tetrahedron Lett 27:4055-8;Gaffney BL et al. (1988) Tetrahedron Lett 29:2619-22). These chemical reactions can be carried out by or adapted for commercially available automated nucleic acid synthesizers. Other suitable synthetic methods are disclosed in Uhlmann et al. (1990) Chem Rev 90:544-84 and Goodchild J (1990) Bioconjugate Chem 1:165. Nucleic acid synthesis can also be carried out using suitable recombinant methods well known in the art and conventional, including cloning, processing and / or expression of polynucleotides and gene products encoded by such polynucleotides. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic polynucleotides are examples of known techniques that can be used for designing and engineering polynucleotide sequences. Site-directed mutagenesis can be used to change nucleic acids and encoded proteins, for example, to insert new restriction sites, change glycosylation patterns, change codon preferences, generate splice variants, introduce mutations, etc. Suitable methods for transcription, translation, and expression of nucleic acid sequences are well known in the art and conventional.(See generally, Current Protocols in Molecular Biology, Vol. 2, Ausubel et al., eds., Greene Publish. Assoc. & Wiley Interscience, Chapter 13, 1988; Glover, DNA Cloning, Vol. II, IRL Press, Wash., DC, Chapter 3, 1986; Bitter et al., in Methods in Enzymology 153:516-544 (1987); The Molecular Biology of the Yeast Saccharomyces, Strathern et al., eds., Cold Spring Harbor Press, Vols. I and II, 1982; and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, 1989.).

[0278] The present disclosure discloses a method for increasing the copy number of a nucleic acid template by transforming the nucleic acid into a suitable host cell (e.g., an Escherichia coli cell); selecting cells expressing a selectable marker encoded by a first expression unit; subculturing the selected cells to obtain a host cell population expressing the selectable marker; and propagating the selected host cell population to increase the copy number of the nucleic acid template.

[0279] In one aspect, the nucleic acid templates of the present disclosure comprise a sequence that is 90%, 95%, 98%, 99%, or 100% identical to SAM001 (SEQ ID NO: 35), SAM002 (SEQ ID NO: 36), SAM003 (SEQ ID NO: 37), SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), SAM006 (SEQ ID NO: 40), MOD001 (SEQ ID NO: 41), or T7-VEE-GFP (SEQ ID NO: 42). In addition, in some aspects, the "T" in any of SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42 is replaced with a "U." One skilled in the art will recognize that due to the degenerate nature of the genetic code, a given amino acid can be encoded using a variety of codons that differ in the nucleotide sequence. The specific nucleotide sequences encoding the polypeptides described herein are cited merely to illustrate one aspect of the disclosure, and the disclosure includes nucleic acids encoding any sequence of polypeptides comprising the same amino acid sequence as the polypeptides and proteins used in the methods of the disclosure. Similarly, polypeptides can generally tolerate one or more amino acid substitutions, deletions, and insertions in their amino acid sequences without losing or significantly losing the desired activity. The disclosure includes such polypeptides having alternative amino acid sequences, and the amino acid sequences encoded by the RNA or DNA sequences shown herein merely illustrate aspects of the disclosure.

[0280] In one aspect, SEQ ID NO: 35 provides a nucleic acid of the present disclosure. In another aspect, the "T" of the sequence of SEQ ID NO: 35 is replaced with "U". The nucleic acid comprises, from 5' to 3', a first linker (SEQ ID NO: 43); a first promoter sequence comprising an ampicillin resistance (AmpR) promoter; a selective marker comprising an ampicillin resistance gene (AmpR); a second linker (SEQ ID NO: 44); a second promoter sequence for in vitro transcription comprising a T7 promoter; a 5' untranslated region; a subgenomic promoter, alphavirus nonstructural proteins 1-4 (nsP1-4), which are derived from the TC-83 strain of Venezuelan equine encephalitis virus (VEE); a third linker (SEQ ID NO: 45); a subgenomic promoter; a gene of interest; a fourth linker (SEQ ID NO: 46); a 3' untranslated region; and a 3' polyadenylation tail (poly-A tail).

[0281] In one aspect, SEQ ID NO: 36 provides a nucleic acid of the present disclosure. In another aspect, the "T" of the sequence of SEQ ID NO: 36 is replaced with "U". The nucleic acid comprises, from 5' to 3', a first linker (SEQ ID NO: 43); a first promoter sequence comprising an AmpR promoter; a selective marker comprising AmpR; a second linker (SEQ ID NO: 44); a second promoter sequence for in vitro transcription comprising a T7 promoter; a 5' untranslated region; a subgenomic promoter; an alphavirus nsP1-4 derived from the TC-83 strain of VEE; a third linker (SEQ ID NO: 45); a subgenomic promoter; a gene of interest; a fourth linker (SEQ ID NO: 46); a 3' untranslated region; and a 3' polyadenylation tail (poly-A tail).

[0282] In one aspect, SEQ ID NO: 37 provides a nucleic acid of the present disclosure. In another aspect, the "T" of the sequence of SEQ ID NO: 37 is replaced with "U". The nucleic acid comprises, from 5' to 3', a first linker (SEQ ID NO: 43); a first promoter sequence comprising an AmpR promoter; a selective marker comprising AmpR; a second linker (SEQ ID NO: 44); a second promoter sequence for in vitro transcription comprising a T7 promoter; a 5' untranslated region; a subgenomic promoter; alphavirus nsP1-4, which is derived from the TC-83 strain of VEE; a third linker (SEQ ID NO: 45); a subgenomic promoter; a gene of interest; a fourth linker (SEQ ID NO: 46); a 3' untranslated region; and a 3' polyadenylation tail (poly-A tail).

[0283] In one aspect, SEQ ID NO: 38 provides a nucleic acid of the present disclosure. In another aspect, the "T" of the sequence of SEQ ID NO: 104 is replaced with "U". The nucleic acid comprises, from 5' to 3', a first linker (SEQ ID NO: 38); a first promoter sequence comprising an AmpR promoter; a selective marker comprising AmpR; a second linker (SEQ ID NO: 44); a second promoter sequence for in vitro transcription comprising a T7 promoter; a 5' untranslated region; a subgenomic promoter; alphavirus nsP1-4, which is derived from the TC-83 strain of VEE; a third linker (SEQ ID NO: 45); a subgenomic promoter; a gene of interest; a fourth linker (SEQ ID NO: 46); a 3' untranslated region; and a 3' polyadenylation tail (poly-A tail).

[0284] In one aspect, SEQ ID NO: 39 provides a nucleic acid of the present disclosure. In another aspect, the "T" of the sequence of SEQ ID NO: 105 is replaced with "U". The nucleic acid comprises, from 5' to 3', a first linker (SEQ ID NO: 39); a first promoter sequence comprising an AmpR promoter; a selectable marker comprising AmpR; a second linker (SEQ ID NO: 44); a second promoter sequence for in vitro transcription comprising a T7 promoter; a 5' untranslated region; a subgenomic promoter; alphavirus nsP1-4, which is derived from the TC-83 strain of VEE; a third linker (SEQ ID NO: 45); a subgenomic promoter; a gene of interest; a fourth linker (SEQ ID NO: 112); a 3' untranslated region; and a 3' polyadenylation tail (poly-A tail).

[0285] In one aspect, SEQ ID NO: 40 provides a nucleic acid of the present disclosure. In another aspect, the "T" of the sequence of SEQ ID NO: 40 is replaced with "U". The nucleic acid comprises, from 5' to 3', a first linker (SEQ ID NO: 43); a first promoter sequence comprising an AmpR promoter; a selective marker comprising AmpR; a second linker (SEQ ID NO: 44); a second promoter sequence for in vitro transcription comprising a T7 promoter; a 5' untranslated region; a subgenomic promoter; alphavirus nsP1-4, which is derived from the TC-83 strain of VEE; a third linker (SEQ ID NO: 45); a subgenomic promoter; a gene of interest; a fourth linker (SEQ ID NO: 46); a 3' untranslated region; and a 3' polyadenylation tail (poly-A tail).

[0286] In one aspect, SEQ ID NO: 41 provides a nucleic acid of the present disclosure. In another aspect, the "T" of the sequence of SEQ ID NO: 41 is replaced with "U". The nucleic acid comprises, from 5' to 3', a first linker (SEQ ID NO: 43); a first promoter sequence comprising an AmpR promoter; a selective marker comprising AmpR; a second linker (SEQ ID NO: 44); a second promoter sequence for in vitro transcription comprising a T7 promoter; a 5' untranslated region; a subgenomic promoter; alphavirus nsP1-4, which is derived from the TC-83 strain of VEE; a third linker (SEQ ID NO: 45); a subgenomic promoter; a gene of interest; a fourth linker (SEQ ID NO: 46); a 3' untranslated region; and a 3' polyadenylation tail (poly-A tail).

[0287] In one aspect, SEQ ID NO: 42 provides a nucleic acid of the present disclosure. In another aspect, the "T" of the sequence of SEQ ID NO: 42 is replaced with "U". The nucleic acid comprises, from 5' to 3', a first linker (SEQ ID NO: 43); a first promoter sequence comprising an AmpR promoter; a selective marker comprising AmpR; a second linker (SEQ ID NO: 44); a second promoter sequence for in vitro transcription comprising a T7 promoter; a 5' untranslated region; a subgenomic promoter; alphavirus nsP1-4, which is derived from the TC-83 strain of VEE; a third linker (SEQ ID NO: 45); a subgenomic promoter; a gene of interest comprising GFP; a fourth linker (SEQ ID NO: 46); a 3' untranslated region; and a 3' polyadenylation tail (poly-A tail).

[0288] In one aspect, the sa-mRNA disclosed herein can comprise one or more custom GOIs constructed by synthetic methods known in the art or cloned from cDNA or genomic libraries. The GOI is incorporated into a nucleic acid template along with a promoter, other regulatory elements, and optionally one or more linkers, an origin of replication, and a selectable marker. Nucleic acid templates of virtually any length and sequence can be produced in high yield in Escherichia coli. Sa-mRNAs of any desired sequence can be generated from nucleic acid templates by in vitro transcription.

[0289] In vitro transcription (IVT) methods allow for template-directed synthesis of RNA molecules of virtually any sequence, including self-amplifying mRNAs. RNA molecules that can be synthesized using IVT methods range in size from short oligonucleotides to long nucleic acid polymers of several thousand bases. IVT methods allow for the synthesis of large quantities of RNA transcripts (e.g., from micrograms to milligrams) (Beckert et al., Synthesis of RNA by in vitro transcription, Methods Mol Biol. 703: 29-41 (2011); Rio et al. RNA: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 2011, 205-220; Cooper, Geoffery M. The Cell: A Molecular Approach. 4th ed. Washington DC: ASM Press, 2007. 262-299). Generally, IVT utilizes a nucleic acid template characterized by a promoter sequence located upstream of the sequence of interest. The most common promoter sequence is a bacteriophage promoter (e.g., T7, T3, SP6, or T5 promoter sequence), but many other promoter sequences are also permitted (e.g., SV40, β-lactamase promoter, Escherichia coli galactose promoter, arabinose promoter, alkaline phosphatase promoter, trp promoter, lac promoter, lacUV5 promoter, trc promoter, and tac promoter) (including promoters designed from the beginning). Transcription of the DNA template is generally best achieved using an RNA polymerase corresponding to a specific promoter sequence. Exemplary RNA polymerases include, but are not limited to, T7 phage RNA polymerase, SP6 phage RNA polymerase, T3 phage RNA polymerase, T5 phage RNA polymerase, RNA polymerase III, RNA polymerase II, Taq polymerase, Vent polymerase, and the like, or mutants of these polymerases. IVT typically initiates from dsDNA, but can use RNA and / or be performed on a single strand.

[0290] Self-amplified mRNA library

[0291] One aspect of the present disclosure is a method for generating a sa-mRNA library. In one aspect, the present disclosure is a method for preparing a sa-mRNA library derived from a reference sa-mRNA, the method comprising: (i) performing directed evolution on the reference sa-mRNA sample, the directed evolution comprising the following steps:

[0292] (a) delivering a reference sa-mRNA sample encoding a selectable marker into a host cell,

[0293] (b) culturing the host cell under conditions and for a time and under conditions necessary for replication of the reference sa-mRNA sample and for a time and under conditions allowing expression of the selectable marker, wherein a mutation occurs in the replicated sa-mRNA compared to the reference sa-mRNA,

[0294] (c) selecting cells expressing the selectable marker;

[0295] (ii) extracting the replicated sa-mRNA from the host cells and sequencing the replicated sa-mRNA; thereby generating a library of sa-mRNA sequences.

[0296] In one aspect, the selectable marker is an antibiotic resistance gene. In one aspect, the selectable marker is a puromycin resistance gene. In one aspect, the reference sa-mRNA is delivered to the host cell using a delivery mechanism. In one aspect, the delivery system is a lipid nanoparticle. In one aspect, the reference sa-mRNA is selected from the group consisting of SEQ ID NOs: 1-8 and SEQ ID NOs: 35-42. In one aspect, the conditions required for the reference sa-mRNA sample to replicate and allow expression of the selectable marker are a culture environment containing an antibiotic. In one aspect, the concentration of the antibiotic affects the mutation rate of the reference sa-mRNA.

[0297] In one aspect, the present disclosure provides a method for evaluating replicated, self-amplifying mRNA for mutations, the method comprising: (i) obtaining a set of contig sequences comprising mutations compared to a reference sa-mRNA sample, (ii) sequencing the contig sequences, and (iii) determining the number of mutations in the contig sequences compared to the reference sa-mRNA. In one aspect, the contig sequences are fragments of the replicated sa-mRNA. In certain aspects, the set of contig sequences comprises SEQ ID NOs. 27-34.

[0298] Increased in vitro transcription

[0299] One aspect of the present disclosure is a nucleic acid containing a modified promoter and regulatory elements, such as a modified 5'UTR. Such nucleic acids exhibit unexpectedly increased transcription efficiency while reducing the amount of truncated single-stranded RNA (ssRNA) (e.g., sa-mRNA) transcripts produced during in vitro transcription (IVT) reactions. In a typical IVT reaction, greater than 50% (volume molarity) of the RNA transcripts produced are truncated, abortive products (referred to herein as truncated ssRNA transcripts). Only a small fraction (e.g., 0.2%-0.5%) of initiation events produce full-length "runoff" ssRNA transcripts, which is inefficient and costly for large-scale IVT RNA synthesis systems. In particular, sa-mRNA transcripts are longer than conventional mRNA (over 7 kilonucleotides long) and are particularly susceptible to truncated abortive products. Thus, in some aspects, use of the IVT methods of the present disclosure (which include, for example, nucleic acid constructs, modified promoters, and / or modified 5'UTRs) results in at least a 40% higher yield of sa-mRNA transcripts compared to the yield of sa-mRNA transcripts using IVT methods that do not use the modified regulatory elements of the present disclosure.

[0300] Preferably, the nucleic acid template of the present disclosure comprises a modified T7 promoter, which is operably linked to a nucleic acid comprising a sequence encoding a modified 5' untranslated region (UTR), multiple non-structural replicase domain sequences, one or more genes of interest (GOIs), a 3'UTR, and a poly-A tail, wherein the sequence encoding the T7 promoter and the sequence encoding the 5'UTR are modified to enhance the binding strength of the T7 polymerase to the T7 promoter to increase the transcript yield.

[0301] In some aspects, the modified T7 promoter comprises at least one insertion at the 5' end of the wild-type T7 promoter nucleotide sequence. For example, the modification can be the insertion of a single guanine (G) at the 5' end of the wild-type T7 promoter. In some aspects, the modified T7 promoter comprises SEQ ID NO: 47 (TAATACGACTCACTATAGG).

[0302] In some aspects, the modified 5'UTR comprises at least one insertion at position 3 relative to the 5' end of the wild-type 5'UTR nucleotide sequence. The modification can be, for example, the insertion of a single adenine (A) at position 3 of the wild-type 5'UTR of wild-type T7-VEE-GFP (SEQ ID NO: 42). In some aspects, the modified 5'UTR comprises ATAGG (repeating the last 5 nucleotides of the T7 promoter).

[0303] In one aspect, a nucleic acid of the present disclosure consists of a nucleotide sequence that is at least 90% identical to SEQ ID NO:36.

[0304] Preferably, the nucleic acid template containing the modified T7 promoter and 5'UTR of the present disclosure will cause the host cell to produce more self-amplifying mRNA, which will translate an increased amount of gene product relative to the amount of gene product produced by the same cell type containing the corresponding sa-mRNA (not containing the modified nucleotides). Methods for determining translation efficiency are well known in the art and include, for example, measuring the activity or amount of the encoded protein (e.g., luciferase and / or GFP), or measuring radioactive labels incorporated into the translated protein (see, for example, Ngosuwan J, Wang NM et al., J Biol Chem 2003; 278(9):7034-42).

[0305] Immune response regulation

[0306] One aspect of the present disclosure is a nucleic acid comprising a regulatory element, such as a modified 3' UTR. Such a nucleic acid can reduce the immunogenicity and / or immunostimulatory capacity (immune response) of the nucleic acid. In one aspect, the nucleic acid of the present disclosure is an sa-mRNA. In another aspect, the nucleic acid of the present disclosure is a nucleic acid template (e.g., a DNA or RNA template) encoding the sa-mRNA.

[0307] In general, exogenous nucleic acids (especially exogenous nucleic acids of viral origin) can induce innate immune response when introduced into cells, leading to the generation of interferon (IFN) and cell death. However, nucleic acid (for example, ribonucleic acid (RNA)) is delivered to cells in vivo or in vitro for therapeutic agents, diagnostic agents, reagents and bioassays of great significance, such as causing the production of intracellular translation and encoded protein of nucleic acid. The delivery and function of non-integrative nucleic acids (such as RNA) are particularly important, because the nucleic acids characterized by being integrated into target cells are generally inaccurate in their expression levels, can be harmfully transferred to progeny and adjacent cells and are subject to a greater risk of mutation. This article provides nucleic acids encoding useful gene products that can regulate cell function and / or activity, as well as methods for preparing and using these nucleic acids and gene products. As described herein, these nucleic acids can reduce the innate immune response of the cell mass they are introduced into, thereby improving the protein production efficiency of the cell mass.

[0308] The sa-mRNA of the present disclosure encodes at least one gene product by preferably increasing the adenine (A) content of the 3'UTR. In some aspects, use of the nucleic acid molecules of the present disclosure and modified regulatory elements (including, for example, nucleic acid constructs and / or modified 3'UTRs) results in an interferon response that is 2-fold, 3-fold, 4-fold, or 5-fold greater than the interferon response to sa-mRNA without the modified regulatory elements of the present disclosure one day after transfection.

[0309] In some aspects, the modified 3'UTR comprises at least one modification at any one of positions 6, -1, or -2 relative to the conserved 19 nucleotide sequence of SEQ ID NO: 49 (GGATTTTGTTTTTAATATTTC). In another aspect, the "T" of the sequence of SEQ ID NO: 49 is replaced with a "U". The modification can be, for example, a mutant 3'UTR of an alphavirus comprising a point mutation at position 6 relative to the conserved 19 nucleotide sequence of SEQ ID NO: 49 of the wild-type 3'UTR of an alphavirus. The modification can also be, for example, a mutant 3'UTR of an alphavirus comprising point mutations at positions -1 and -2 relative to the conserved 19 nucleotide sequence of SEQ ID NO: 49 of the wild-type 3'UTR of an alphavirus. The modification can also be, for example, a mutant 3'UTR of an alphavirus comprising point mutations at positions -1, -2, and 6 relative to the conserved 19 nucleotide sequence of SEQ ID NO: 49 of the wild-type 3'UTR of an alphavirus. In some aspects, the modified 3'UTR conserved sequence comprises GGATTTTATTTTTAATATTTC (SEQ ID NO: 50), AAATTTTGTTTTTAATATTTC (SEQ ID NO: 51), or AAATTTTATTTTTAATATTTC (SEQ ID NO: 52). In other aspects, the "T" of the sequences of SEQ ID NO: 50, SEQ ID NO: 51, and SEQ ID NO: 52 is replaced with "U."

[0310] The sa-mRNA disclosed herein may encode an antigen that can be tested for its ability to induce a humoral immune response, for example, by inducing B cells to produce antibodies specific for the antigen of interest. These assays can be performed using, for example, peripheral B lymphocytes from immunized individuals. Such assays are known to those skilled in the art. Other assays that can be used to characterize the sa-mRNA disclosed herein may involve detecting expression of the encoded antigen by target cells. For example, FACS can be used to detect antigen expression on the cell surface or within the cell. Another advantage of FACS selection is that it can be sorted by different expression levels; sometimes lower expression may be desirable. Other suitable methods for identifying cells expressing a specific antigen involve panning using monoclonal antibodies on plates or capture using magnetic beads coated with monoclonal antibodies.

[0311] Antigens of SARS-CoV2 Omicron variant BA.2

[0312] The present disclosure also relates to polypeptides encoding modified SARS-CoV2 antigens, wherein the polynucleotide encoding the modified antigen is truncated to nucleotides that do not contain the transmembrane domain and short cytoplasmic domain amino acids encoding the antigen. Since the first discovery of SARS coronavirus 2 (SARS-CoV2), as of May 25, 2022, 526,808,553 cases and 6,280,679 deaths have been reported worldwide (https: / / coronavirus.jhu.edu / map.html). Although the first generation of new crown vaccines (such as BNT162b2 (BioNTech-Pfizer), mRNA-1273 (Modern derna)) have been launched, and temporary variants of SARS-CoV-2 have shown gradual alleviation of the disease and reduced mortality, the global epidemic continues and has caused a serious social and economic crisis. Therefore, although many people around the world have received one or more doses of the first-generation COVID-19 vaccine, it is still necessary to develop a COVID-19 booster vaccine to address the shortcomings of the current COVID-19 vaccine: such as inducing hepatitis and myocarditis; reduced efficiency in responding to the rapid evolution of SARS-CoV-2; low efficiency in preventing infection; and rapid decline in antibody titers.

[0313] In some aspects, the polypeptides disclosed herein encode secreted forms of spike proteins. The first-generation mRNA COVID-19 vaccines BNT162b2 and mRNA-1273 contain 1273 amino acids, which include: S1 (RBD), S2, a transmembrane domain, and a short cytoplasmic domain. Because the transmembrane domain causes the spike antigen to be expressed on the cell surface of transfected cells, the transfected cells can be targeted by the immune system, which may cause some individuals vaccinated with BNT162b2 and mRNA-1273 to exhibit side effects of hepatitis and myocarditis. The polypeptides disclosed herein encode modified spike proteins that retain their native structure when secreted. This will prevent the spike antigen from being expressed on the cell surface. The secreted form of the modified spike antigen can trigger a humoral immune response and exhibits BA.2-specific IgG comparable to the transmembrane spike protein.

[0314] In some aspects, the polypeptides disclosed herein encode modified spike proteins having two proline mutations (S2P) at S2. The S2P mutation maintains the conformation of the spike protein, thereby inducing neutralizing antibodies to stabilize the structure of the spike for recognition by broadly neutralizing antibodies (bnAbs) SPD-M265 and hACE2-FITC ( Figure 18-20 ).

[0315] Pharmaceutical composition

[0316] The present disclosure also relates to pharmaceutical compositions comprising the sa-mRNA of the present disclosure (which optionally contains a modified 3'UTR of the present disclosure), a pharmaceutically acceptable carrier, and a suitable delivery system of the present disclosure (such as liposomes, lipid nanoparticles, nanoemulsions, PLG microparticles and nanoparticles, lipid complexes, chitosan microparticles and nanoparticles, and other polyplexes, as described herein). Other pharmaceutically acceptable components, such as excipients and adjuvants, may also be included, if desired.

[0317] Pharmaceutical composition

[0318] The present disclosure also relates to pharmaceutical compositions comprising self-amplifying mRNA (which optionally contains a modified 3'UTR of the present disclosure), a pharmaceutically acceptable carrier, and a suitable delivery system (as described herein, such as liposomes, nanoemulsions, PLG microparticles and nanoparticles, lipid complexes, chitosan microparticles and nanoparticles, and other polyplexes). Other pharmaceutically acceptable components, such as excipients and adjuvants, may also be included, if desired.

[0319] Nanoparticle compositions

[0320] Preferably, the sa-mRNA of the present disclosure is delivered using a nanoparticle composition comprising one or more cationic and / or ionizable lipids (e.g., lipids that can have a positive charge or a partial positive charge at physiological pH); one or more PEG or PEG-modified lipids (lipids modified with polyethylene glycol); one or more structural lipids (e.g., cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, α-tocopherol, and mixtures thereof); and one or more phospholipids (e.g., (poly)unsaturated lipids).

[0321] adjuvant

[0322] In some aspects, a pharmaceutical composition comprising one or more lipids described herein may further comprise one or more adjuvants, e.g., glucopyranosyl lipid adjuvant (GLA), CpG oligodeoxynucleotides (e.g., class A or class B), poly(I:C), aluminum hydroxide, and Pam3CSK4.

[0323] Medical uses

[0324] In some aspects, the sa-mRNA of the present disclosure optionally encodes messenger mRNA (mRNA), small interfering RNA (siRNA), microRNA (miRNA), guide RNA (gRNA), self-activating RNA (saRNA), transfer RNA (tRNA), long intergenic non-coding RNA (lincRNA), etc.

[0325] In certain aspects, the bioactive sa-mRNA disclosed herein encodes an mRNA. The mRNA can encode any polypeptide of interest, including any naturally occurring or non-naturally occurring polypeptide or modified polypeptide. The polypeptide encoded by the mRNA can be of any size and can have any secondary structure or activity. In some aspects, the polypeptide encoded by the mRNA can have a therapeutic effect when expressed in a cell. In some aspects, the polypeptide encoded by the mRNA is a modified spike antigen.

[0326] In other aspects, the bioactive sa-mRNA disclosed herein encodes siRNA or miRNA. siRNA or miRNA can selectively knock down or downregulate the expression of a target gene. For example, after administering a nanoparticle composition containing siRNA to a subject in need thereof, the siRNA can be selected to silence a gene associated with a specific disease, condition, or disorder. The siRNA can comprise a sequence complementary to the mRNA sequence encoding the target gene or protein. In some aspects, the siRNA can be an immunomodulatory siRNA.

[0327] preparation

[0328] Pharmaceutical compositions can include biologically active sa-mRNA and one or more additional components, such as a lipid component and one or more additional components. Nanoparticle compositions can be designed for one or more specific applications or targets. The components of a nanoparticle composition can be selected based on the specific application or target, and / or based on efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more components. Similarly, specific formulations of nanoparticle compositions can be selected for a specific application or target based on, for example, the efficacy and toxicity of a particular combination of components.

[0329] The sa-mRNA of the pharmaceutical composition can include, for example, a sa-mRNA comprising: an antigen selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273), and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208), SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208), SEQ ID NO: 8 (BA.2-1208-S2P); an immunomodulator selected from the group consisting of SEQ ID NO: 13 (IM1) and SEQ ID NO: 20 (IM2); SEQ ID NO: 9 (SGP1); SGP2 is SEQ ID NO: 11 (SGP2); and a nucleotide sequence encoding nsp1-4.

[0330] The amount of biologically active sa-mRNA can depend on the size, composition, desired target and / or application, or other properties of the therapeutic, diagnostic, and / or prophylactic agent. Generally, the size of sa-mRNA is always greater than 7000 nucleotides. The relative amounts of sa-mRNA and other elements (e.g., lipids) in a pharmaceutical composition can also vary. In some aspects, the wt / wt ratio of the lipid component to sa-mRNA in the nanoparticle composition can be from about 5:1 to about 60:1, such as 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt / wt ratio of the lipid component to sa-mRNA can be from about 1:1 to about 40:1. In some aspects, the wt / wt ratio is about 20: 1. The amount of therapeutic, diagnostic, and / or prophylactic agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (eg, UV-visible spectroscopy).

[0331] Pharmaceutical compositions can include one or more therapeutic agents (e.g., sa-mRNA) and a delivery system. Pharmaceutical compositions can also include one or more pharmaceutically acceptable excipients or adjuncts, such as those described herein. General guidance regarding formulation and the manufacture of pharmaceutical compositions and medicaments can be found, for example, in Remington's The Science and Practice of Pharmacy, 21st ed., A.R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Excipients and adjuncts can be used in any pharmaceutical composition, except where any excipient or adjunct is incompatible with one or more components of the sa-mRNA delivery system. An excipient or adjunct may be incompatible if its combination with the component(s) could result in any undesirable biological or other adverse effects.

[0332] In some respects, one or more excipients or attached components can account for more than 50% of the gross mass or cumulative volume of the pharmaceutical composition.For example, one or more excipients or attached components can account for 50%, 60%, 70%, 80%, 90% or more of the pharmaceutical composition.In some respects, the purity of pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%.In some respects, excipient is approved for the mankind and veterinary purposes.In some respects, excipient has obtained the approval of the U.S. Food and Drug Administration.In some respects, excipient is pharmaceutical grade.In some respects, excipient meets the standard of American Pharmacopoeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia and / or International Pharmacopoeia.

[0333] The relative amounts of the one or more delivery systems, one or more pharmaceutically acceptable excipients, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated, and will also depend on the route by which the composition is to be administered.

[0334] In certain aspects, the pharmaceutical compositions of the present disclosure are refrigerated or frozen for storage and / or transport (e.g., stored at 4°C or lower, such as at a temperature between about -150°C and about 0°C or at a temperature between about -80°C and about -20°C. For example, a pharmaceutical composition comprising the sa-mRNA of the present disclosure is a solution refrigerated for storage and / or transport at, for example, about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In certain aspects, The present disclosure also relates to a method of increasing the stability of a pharmaceutical composition comprising sa-mRNA and a delivery system by storing the pharmaceutical composition at a temperature of 4°C or lower, such as between about -150°C and about 0°C, or between about -80°C and about -20°C, for example, about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C. For example, the pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months at, for example, 4°C or lower (e.g., between about 4°C and -20°C). In one aspect, the formulation is stable for at least 4 weeks at about 4°C. In certain aspects, the pharmaceutical compositions disclosed herein comprise an sa-mRNA disclosed herein, a nanoparticle composition delivery system, and a pharmaceutically acceptable carrier selected from one or more of: Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), saline, PBS, and sucrose. In certain aspects, the pharmaceutical compositions of the present disclosure have a pH between about 5 and 8 (e.g., 5, 5.5, 6, 6.5, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8, or between 7 and 7.8). For example, a pharmaceutical composition of the present disclosure comprises a sa-mRNA disclosed herein, a nanoparticle composition delivery system, Tris, saline, and sucrose at a pH of about 7.5-8 and is suitable for storage and / or transport at, for example, about -20°C. For example, a pharmaceutical composition of the present disclosure comprises a sa-mRNA disclosed herein, a nanoparticle composition delivery system, and PBS at a pH of about 7-7.8 and is suitable for storage and / or transport at, for example, about 4°C or lower.In the context of the present disclosure, "stability," "stable," and "stable" refer to the resistance of the pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., degradation, particle size changes, aggregation, encapsulation changes, etc.) under given conditions of manufacture, preparation, transport, storage, and / or use, for example, when stresses such as shear forces, freeze / thaw stress, etc. are applied.

[0335] Pharmaceutical compositions of the present disclosure can be applied to any patient or subject, including those patients or subjects who can benefit from the therapeutic effect provided by delivering a bioactive agent to one or more specific cells, tissues, organs, or systems or their groups (such as renal systems). Although pharmaceutical compositions provided herein describe primarily compositions suitable for application to the mankind, it will be appreciated by those skilled in the art that such compositions are generally suitable for application to any other mammals. It is well known that the compositions suitable for application to the mankind are modified so that the compositions are suitable for application to various animals, and common veterinary pharmacologists only need to design and / or carry out such modifications by common experiments (if any). The subject of the composition envisioned for use includes but is not limited to the mankind, other primates and other mammals, including commercially relevant mammals, such as cattle, pigs, horses, sheep, cats, dogs, mice and / or rats.

[0336] The pharmaceutical compositions of the present disclosure can be prepared by any method known or hereafter developed in the art of pharmacology. Generally speaking, such preparation methods include mixing the active ingredient with an excipient and / or one or more other adjunct ingredients, and then, if necessary or desired, dividing, molding and / or packaging the product into desired single-dose units or multiple-dose units.

[0337] Pharmaceutical compositions according to the present disclosure can be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., sa-mRNA). The amount of the active ingredient is generally equal to the dose of the active ingredient administered to a subject and / or a convenient fraction of such a dose, such as one-half or one-third of such a dose.

[0338] Injection preparations can be prepared according to known technology using suitable dispersants, wetting agents and / or suspending agents, such as sterile aqueous or oily suspensions for injection. Sterile injection preparations can be sterile injection solutions, suspensions and / or emulsions dissolved in nontoxic parenteral acceptable diluents and / or solvents, such as solutions dissolved in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution, USP and isotonic sodium chloride solution. Sterile fixed oils can be used as solvents or suspension media. For this purpose, any gentle fixed oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids (such as oleic acid) can be used to prepare injections.

[0339] The injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter, and / or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0340] Methods for producing polypeptides in cells

[0341] The present disclosure provides methods for producing sa-mRNA of interest in mammalian cells. The methods for producing sa-mRNA in cells involve contacting the cells with sa-mRNA (either as naked RNA or in combination with a delivery system) encoding one or more genes of interest. Once the sa-mRNA contacts the cells, it is taken up by the cells and translated into a gene product.

[0342] In general, the step of contacting cells with sa-mRNA encoding one or more genes of interest can be performed in vivo, ex vivo, in culture, or in vitro. The amount of sa-mRNA can depend on the type of cells or tissue contacted, the mode of administration, the physicochemical characteristics of the sa-mRNA and the delivery system (e.g., size, charge, and chemical composition), and other factors. Generally, an effective amount of sa-mRNA will allow for efficient production of the polypeptide in the cell. Efficiency metrics can include polypeptide translation (expressed as polypeptide expression), sa-mRNA degradation levels, and indicators of immune response.

[0343] The step of contacting the sa-mRNA-containing nanoparticle composition with the cell can involve or result in transfection. The phospholipids included in the lipid component of the nanoparticle composition can facilitate transfection and / or increase transfection efficiency, for example, by interacting with and / or fusing with the cell membrane or intracellular membranes. Transfection can allow transcription and translation of the sa-mRNA within the cell.

[0344] Methods for delivering therapeutic agents to cells and organs

[0345] The present disclosure provides methods for delivering bioactive agents to cells or organs. Delivery of a bioactive agent to a cell involves administering a delivery system comprising the bioactive agent to a subject, wherein administration of the composition involves contacting the cell with the composition. In the case where the bioactive agent is sa-mRNA, once the translatable sa-mRNA contacts the cell, it can be translated in the cell to produce a polypeptide of interest. However, the sa-mRNA of the present disclosure can encode a substantially untranslatable gene product (e.g., a regulatory structure) and can also be delivered to a cell. The regulatory structure can be used as a vaccine and / or can sequester the translational components of a cell to reduce the expression of other species in the cell.

[0346] In some respects, delivery system (such as nanoparticle composition) can target the cell (for example, the cell of specific organ or its system) of specific type or classification.For example, the nanoparticle composition of sending purpose bioactivator can be specifically delivered to mammalian liver, kidney, spleen, femur or lung.To the specific delivery of cell, organ or system or their group of specific classification, mean, with respect to other positions, the therapeutic agent, diagnostic agent and / or preventive of higher ratio are delivered to destination position (for example, tissue).In some respects, with another position (for example, spleen), compare, specific delivery can make the amount of therapeutic agent and / or preventive of every 1g destination position tissue (for example, purpose tissue, such as liver) increase more than 2 times, 5 times, 10 times, 15 times or 20 times.In some respects, purpose tissue is selected from the group of being made up of the following: liver, kidney, lung, spleen, femur, eye tissue (for example, via intraocular injection, subretinal injection or intravitreal injection), vascular endothelium (for example, in coronary artery or femoral artery) or kidney and tumor tissue (for example, via intratumoral injection).

[0347] As another example of targeted or specific delivery, the sa-mRNA of the present disclosure can encode a protein binding partner (e.g., an antibody or a functional fragment thereof, a scaffold protein or peptide) or a receptor on the cell surface. The sa-mRNA can be used additionally or alternatively to direct the synthesis and extracellular localization of lipids, carbohydrates, or other biological moieties. Alternatively, other bioactive agents of the delivery system (e.g., lipids or ligands) can be selected based on the affinity of the bioactive agent for a specific receptor (e.g., a low-density lipoprotein receptor) so that the delivery system can more easily interact with the target cell population including the receptor. For example, ligands can include, but are not limited to, members of specific binding pairs, antibodies, monoclonal antibodies, Fv fragments, single-chain Fv (scFv) fragments, Fab' fragments, F(ab')2 fragments, single domain antibodies, camelized antibodies and fragments thereof, humanized antibodies and fragments thereof, and multivalent forms thereof; multivalent binding agents, including monospecific antibodies or bispecific antibodies, such as disulfide-stabilized Fv fragments, scFv tandems, diabodies, triabodies, or tetrabodies; and aptamers, receptors, and fusion proteins.

[0348] In some aspects, the ligand can be a surface-bound antibody that can allow for the regulation of cell targeting specificity. This is particularly useful because highly specific antibodies can be generated for the desired epitope of the target site. In one aspect, multiple antibodies are expressed on the surface of the cell, and each antibody can have different specificities for the desired target. Such methods can increase the avidity and specificity of the targeted interaction.

[0349] In certain aspects, the compositions according to the present disclosure may be administered at a dose sufficient to deliver about 0.0001 mg / kg to about 10 mg / kg, about 0.001 mg / kg to about 10 mg / kg, about 0.005 mg / kg to about 10 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.05 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, about 1 mg / kg to about 10 mg / kg, about 2 mg / kg to about 10 mg / kg, about 5 mg / kg to about 10 mg / kg, about 0.0001 ... about 5 mg / kg, about 0.001 mg / kg to about 5 mg / kg, about 0.005 mg / kg to about 5 mg / kg, about 0.01 mg / kg to about 5 mg / kg, about 0.05 mg / kg to about 5 mg / kg, about 0.1 mg / kg to about 5 mg / kg, about 1 mg / kg to about 5 mg / kg, about 2 mg / kg to about 5 mg / kg, about 0.0001 mg / kg to about 2.5 mg / kg, about 0.001 mg / kg to about 2.5 mg / kg, about 0.005 mg / kg to about 2.5 mg / kg, about 0.01 mg / kg to about 5 mg / kg, about g / kg to about 2.5 mg / kg, about 0.05 mg / kg to about 2.5 mg / kg, about 0.1 mg / kg to about 2.5 mg / kg, about 1 mg / kg to about 2.5 mg / kg, about 2 mg / kg to about 2.5 mg / kg, about 0.0001 mg / kg to about 1 mg / kg, about 0.001 mg / kg to about 1 mg / kg, about 0.005 mg / kg to about 1 mg / kg, about 0.01 mg / kg to about 1 mg / kg, about 0.05 mg / kg to about 1 mg / kg, about 0.1 mg / kg to about 1 mg / kg, The dosage level of the therapeutic agent, diagnostic agent and / or preventive agent (for example, from amplification mRNA) of a given dose of about 0.0001mg / kg to about 0.25mg / kg, about 0.001mg / kg to about 0.25mg / kg, about 0.005mg / kg to about 0.25mg / kg, about 0.01mg / kg to about 0.25mg / kg, about 0.05mg / kg to about 0.25mg / kg or about 0.1mg / kg to about 0.25mg / kg is used, wherein the dosage of 1mg / kg (mpk) provides 1mg bioactivator / 1kg subject body weight. In some aspects, the bioactivator (for example, from amplification mRNA) of the dosage of about 0.001mg / kg to about 10mg / kg can be used. In other aspects, the bioactivator of the dosage of about 0.005mg / kg to about 2.5mg / kg can be used. In some aspects, the dosage of about 0.1mg / kg to about 1mg / kg can be used. In other aspects, a dose of about 0.05 mg / kg to about 0.25 mg / kg can be administered.Doses can be administered once or multiple times daily in the same or varying amounts to achieve the desired level of sa-mRNA expression and / or bioactive agent or imaging effect.

[0350] The desired dosage can be delivered, for example, three times a day, twice a day, once a day, every other day, every three days, once a week, every two weeks, every three weeks, or every four weeks. In some aspects, the desired dosage can be delivered using multiple administrations (e.g., twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times, eleven times, twelve times, thirteen times, fourteen times, or more administrations). In some aspects, a single dose can be administered, for example, before or after surgery, or in the case of an acute disease, condition, or illness.

[0351] The pharmaceutical composition comprising one or more bioactivators can be used in combination with one or more other bioactivators or imaging agents. So-called "in combination with..." does not mean that the medicaments must be used simultaneously and / or formulated to be delivered together, but these delivery methods are within the scope of the present disclosure. For example, one or more pharmaceutical compositions comprising one or more different bioactivators can be used in combination. The composition can be used simultaneously with, before or after one or more other desired therapeutic agents or medical procedures. Generally speaking, each medicament will be used according to the dosage and / or time schedule determined for the medicament. In some aspects, the present disclosure encompasses the delivery of a composition or its imaging, treatment, diagnosis or prevention composition in combination with an agent that improves bioavailability, reduces and / or changes metabolism, suppresses excretion and / or changes distribution in vivo.

[0352] It should also be understood that the bioactive agent or imaging agent used in combination can be administered together in a single composition or separately in different compositions. Generally speaking, it is expected that the level of the agent used in combination will not exceed the level at which it is used alone. In some aspects, the level used in combination may be lower than the level used alone.

[0353] The particular combination of therapies employed in a combination regimen will take into account the compatibility of the desired therapeutic, diagnostic, and / or prophylactic procedures with the desired biological effect to be achieved. It will also be understood that the therapies employed may achieve the desired effect on the same condition (e.g., a composition useful for treating cancer may be administered concurrently with a chemotherapeutic agent), or they may achieve different effects (e.g., to control any adverse reactions, such as infusion-related reactions).

[0354] This disclosure includes the following non-limiting items and any combination of any one or more items with any other one or more items:

[0355] 1. A method for increasing the copy number of a nucleic acid, comprising:

[0356] a) contacting a cell with a nucleic acid encoding two expression units, said nucleic acid comprising:

[0357] i) Origin of replication sequence (Ori);

[0358] ii) a first expression unit encoding a first nucleotide sequence operably linked to a first promoter; and

[0359] iii) a second expression unit encoding a second nucleotide sequence operably linked to a second promoter,

[0360] wherein the first expression unit encodes a selectable marker, and the second expression unit encodes a self-amplifying mRNA (sa-mRNA);

[0361] b) selecting cells expressing the selectable marker;

[0362] c) subculturing the selected cells to obtain a cell population expressing the selective marker; and

[0363] d) allowing the cell population to proliferate to increase the copy number of the nucleic acid.

[0364] 2. The method of claim 1, wherein the nucleic acid is a recombinant DNA molecule.

[0365] 3. The method of claim 2, wherein the recombinant DNA molecule is a plasmid.

[0366] 4. The method according to item 1, wherein the nucleic acid is a closed circular molecule or a linear molecule.

[0367] 5. The method according to any one of items 1 to 4, wherein the nucleic acid is suitable for in vitro transcription of RNA after linearization using the nucleic acid as a template.

[0368] 6. The method of any one of items 1 to 5, wherein the cell is a bacterium.

[0369] 7. The method according to item 6, wherein the bacterium is Escherichia coli.

[0370] 8. The method of any one of items 1 to 7, wherein the nucleic acid comprises SAM001 (SEQ ID NO:35), SAM002 (SEQ ID NO:36), SAM003 (SEQ ID NO:37), SAM004 (SEQ ID NO:38), SAM005 (SEQ ID NO:39), SAM006 (SEQ ID NO:40), MOD001 (SEQ ID NO:41) or T7-VEE-GFP (SEQ ID NO:42).

[0371] 9. The method of any one of items 1 to 8, wherein the nucleic acid sequence has at least 90% sequence identity with SAM001 (SEQ ID NO: 35), SAM002 (SEQ ID NO: 36), SAM003 (SEQ ID NO: 37), SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), SAM006 (SEQ ID NO: 40), MOD001 (SEQ ID NO: 41) or T7-VEE-GFP (SEQ ID NO: 42).

[0372] 10. The method of any one of items 1 to 9, wherein the first expression unit comprises the following operably linked nucleic acid sequences in the 5' to 3' direction or in the 3' to 5' direction:

[0373] Pr1-SM

[0374] in

[0375] Pr1 is the first promoter sequence, and

[0376] SM is the selectable marker.

[0377] 11. The method of any one of items 1 to 10, wherein the first promoter is an ampicillin resistance (AmpR) promoter, a kanamycin resistance (KanR) promoter, a chloramphenicol resistance (CamR) promoter, an erythromycin resistance (ErmR) promoter, and a tetracycline resistance (TetR) promoter.

[0378] 12. The method of any one of items 1 to 11, wherein the selective marker is AmpR, KanR, CamR, ErmR or TetR.

[0379] 13. The method of any one of items 1 to 12, wherein the second expression unit comprises, from 5' to 3', the following operably linked nucleic acid sequence:

[0380] Pr2-5'UTR-nsP-SGP-GOI-3'UTR-PolyA

[0381] in

[0382] Pr2 is the second promoter sequence for in vitro transcription,

[0383] 5'UTR is the 5' untranslated region.

[0384] nsP is a sequence of multiple nonstructural replicase domains.

[0385] SGP is a subgenomic promoter.

[0386] GOI is one or more target genes.

[0387] 3'UTR is the 3' untranslated region, and

[0388] Poly-A is a 3' polyadenylated tail (poly-A tail).

[0389] 14. The method of claim 13, wherein at least one gene of interest (GOI) encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, an antigen, or a non-coding gene encoding a regulatory structure.

[0390] 15. The method of any one of items 13 to 14, wherein the regulatory structure is selected from the group consisting of small interfering RNA (siRNA), micro RNA (miRNA), guide RNA (gRNA), self-activating RNA (saRNA), transfer RNA (tRNA) or long intergenic non-coding RNA (lincRNA).

[0391] 16. The method of any one of items 13 to 14, wherein at least one GOI encodes an infectious disease antigen, an allergy antigen or a tumor antigen.

[0392] 17. The method of item 13, wherein at least one GOI encodes a reporter gene.

[0393] 18. The method of item 17, wherein the reporter gene is green fluorescent protein (GFP).

[0394] 19. The method of any one of items 13 to 18, wherein the plurality of nonstructural replicase domain sequences are obtained from a Group IV positive-single-stranded RNA virus selected from the group consisting of: Picornaviridae, Togaviridae, Coronaviridae, Hepaciviridae, Caliciviridae, Flaviviridae, and Astroviridae.

[0395] 20. The method of any one of items 13 to 19, wherein the plurality of nonstructural replicase domain sequences are obtained from an alphavirus selected from the group consisting of Eastern equine encephalitis virus (EEE), Venezuelan equine encephalitis virus (VEE), Everglades virus, Mukambu virus, Pichunna virus, Western equine encephalitis virus (WEE), Sindbis virus, Semliki Forest virus, Middleburg virus, Chikungunya virus, Anyang-Nyang virus, Ross River virus, Bama Forest virus, Geta virus, Lushan virus, Bebaru virus, Mayaro virus, Una virus, Ora virus, Vodaro River virus, Babanken virus, Kuzilagachi virus, Highland J virus, Fort Morgan virus, Ndumau virus, and Bogi River virus.

[0396] 21. The method of any one of items 13 to 20, wherein the plurality of nonstructural replicase domain sequences are alphavirus nonstructural proteins 1-4 (nsP1-4).

[0397] 22. The method of any one of items 13 to 21, wherein the plurality of nonstructural replicase domain sequences are obtained from the TC-83 strain of Venezuelan equine encephalitis virus (VEE).

[0398] 23. A method as described in any one of items 1 to 22, wherein the second promoter is selected from the group consisting of: T7, T3, SV40, SP6, T5, β-lactamase promoter, Escherichia coli galactose promoter, arabinose promoter, alkaline phosphatase promoter, tryptophan (trp) promoter, lactose operator (lac) promoter, lacUV5 promoter, trc promoter and tac promoter.

[0399] 24. The method of any one of items 1 to 23, wherein the nucleic acid further comprises one or more linkers.

[0400] 25. The method of item 24, wherein the nucleic acid sequence comprises from 5' to 3':

[0401] a) Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA;

[0402] b)L1-Ori-SM-Pr1-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA

[0403] c)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-GOI-L4-3'UTR-PolyA;

[0404] d)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-3'UTR-PolyA; or

[0405] e)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-SGP-L3-GOI-L4-3'UTR-PolyA,

[0407] in

[0408] L1 is the first connector,

[0409] Ori is the replication origin sequence,

[0410] SM is a selective marker.

[0411] Pr1 is the first promoter sequence,

[0412] L2 is the second connector,

[0413] Pr2 is the second promoter sequence,

[0414] 5'UTR is the 5' untranslated region.

[0415] nsP is a sequence of multiple nonstructural replicase domains.

[0416] L3 is the third connector,

[0417] SGP is a subgenomic promoter.

[0418] GOI is one or more target genes.

[0419] L4 is the fourth connector,

[0420] 3'UTR is the 3' untranslated region, and

[0421] Poly-A is a 3' polyadenylated tail (poly-A tail).

[0422] 26. The method of item 25, wherein each of L1, L2, L3 and L4 is independently selected from the group consisting of

[0423] CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT (SEQ ID NO: 43),

[0424] CACATTTCCCCGAAAAGTGCCACCTGAGCTC (SEQ ID NO:44),

[0425] TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45) or

[0426] CATCGATGATATCGCGGCCGCATACAGCAGC (SEQ ID NO: 46), or

[0427] wherein L1 comprises SEQ ID NO:43

[0428] (CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT); L2 contains SEQ ID NO: 44 (CACATTTCCCCGAAAAGTGCCACCTGAGCTC); L3 contains SEQ ID NO: 45 (TTCGAAGGCGCGCCTCTAGAGCCACC); and L4 contains SEQ ID NO: 46 (CATCGATGATATCGCGGCCGCATACAGCAGC).

[0429] 27. A self-amplifying mRNA comprising the following nucleic acid sequence from 5' to 3':

[0430] a)5'UTR-nsP-L-GOI-L-3'UTR-PolyA

[0431] b)5'UTR-nsP-GOI-L-3'UTR-PolyA;

[0432] c) 5'UTR-nsP-L-GOI-3'UTR-PolyA; or

[0433] in

[0434] 5'UTR is the 5' untranslated region.

[0435] nsP is a sequence of multiple nonstructural replicase domains.

[0436] L is the connector,

[0437] SGP is a subgenomic promoter.

[0438] GOI is one or more target genes.

[0439] 3'UTR is the 3' untranslated region, and

[0440] Poly-A is a 3' polyadenylated tail (poly-A tail).

[0441] 28. The self-amplifying mRNA of item 27, wherein the GOI is an antigen or an antigen receptor.

[0442] 29. The self-amplifying mRNA of any one of items 27 to 28, wherein the GOI is a viral antigen.

[0443] 30. The self-amplifying mRNA of any one of items 27 to 29, wherein the GOI is a modified SARS-CoV-2 spike protein.

[0444] 31. The self-amplifying mRNA of any one of items 27 to 30, wherein the immunomodulator is a cytokine, chemokine or other immunostimulator or inhibitor.

[0445] 32. The self-amplifying mRNA according to any one of items 27 to 31, comprising a polynucleotide sequence selected from the group consisting of:

[0446] a) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 1 (BA.1-1273);

[0447] b) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 2 (BA.1-1273-S2P);

[0448] c) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 3 (BA.2-1273);

[0449] d) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 4 (BA.2-1273-S2P);

[0450] e) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 5 (BA.1-1208); or

[0451] f) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 6 (BA.1-1208-S2P);

[0452] g) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 7 (BA.2-1208); or

[0453] h) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 8 (BA.2-1208-S2P).

[0454] 33. A self-amplifying mRNA encoding two separate expression units, the self-amplifying mRNA comprising:

[0455] i) a first expression unit comprising a polynucleotide encoding a modified antigen, wherein the polynucleotide encoding the modified antigen is truncated to not include nucleotides encoding amino acids of the transmembrane domain and the short cytoplasmic domain of the antigen, the polynucleotide being operably linked to a first subgenomic promoter; and

[0456] ii) a second expression unit encoding an immune modulator (IM) operably linked to a second subgenomic promoter.

[0457] 34. The self-amplifying mRNA of item 33, wherein the polynucleotide sequence encoding the modified antigen comprises replacement of the transmembrane domain of the antigen with a secretory antigen.

[0458] 35. The self-amplifying mRNA of claim 33 or claim 34, wherein the antigen is a modified SARS-CoV-2 spike protein, wherein the polynucleotide has been truncated to not include nucleotides encoding amino acids for the SARS-CoV-2 transmembrane domain and short cytoplasmic domain.

[0459] 36. The self-amplifying mRNA of any one of items 33 to 35, wherein the polynucleotide sequence encoding the coronavirus spike protein truncated to not include nucleotides encoding the SARS-CoV-2 transmembrane domain and short cytoplasmic domain amino acids corresponding to amino acids 1209-1273 of the nucleotide sequence is SEQ ID NO: 1 (BA.1-1273) or SEQ ID NO: 3 (BA.2-1273).

[0460] 37. The self-amplifying mRNA of any one of items 33 to 36, wherein the sa-mRNA comprises, from 5′ to 3′, the following operably linked nucleic acid sequences:

[0461] nsP-SGP1-Ag-SGP2-IM

[0462] in

[0463] nsP is a sequence of multiple nonstructural replicase domains.

[0464] SGP1 is the first subgenomic promoter,

[0465] Ag is a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208) or SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208) or SEQ ID NO: 8 (BA.2-1208-S2P),

[0466] SGP2 is the second subgenomic promoter, and

[0467] IM is the immune modulator.

[0468] 38. The self-amplifying mRNA of any one of items 33 to 36, wherein the sa-mRNA comprises, from 5′ to 3′, the following operably linked nucleic acid sequences:

[0469] nsP-SGP1-IM-SGP2-AG

[0470] in

[0471] nsP is a sequence of multiple nonstructural replicase domains.

[0472] SGP1 is the first subgenomic promoter,

[0473] IM is the immune modulator,

[0474] SGP2 is the second subgenomic promoter, and

[0475] Ag is a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208) or SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208) or SEQ ID NO: 8 (BA.2-1208-S2P).

[0476] 39. The self-amplifying mRNA of any one of items 33 to 38, wherein the IM encodes one or more cytokines, chemokines, immune stimulators or inhibitors.

[0477] 40. The self-amplifying mRNA of any one of items 33 to 39, wherein the IM is IL12 or IL21.

[0478] 41. The self-amplifying mRNA of any one of items 33 to 40, wherein the IM encodes one or more cytokines selected from the group consisting of SEQ ID NO: 22 (hIL12-P40), SEQ ID NO: 24 (hIL12-P35), SEQ ID NO: 26 (hL21), SEQ ID NO: 15 (mIL12P40), SEQ ID NO: 17 (mIL12-P35) and SEQ ID NO: 19 (mL21).

[0479] 42. The self-amplifying mRNA of any one of items 33 to 41, wherein SGP1 is SEQ ID NO: 9 (SGP1) (TAACCTGAATGGACTACGACATAGTC TAGTCCGCCAAG).

[0480] 43. The self-amplifying mRNA of any one of items 33 to 42, wherein SGP2 is SEQ ID NO: 11 (SGP2) (GAACTTCCATCATAGTTATGGCCATG ACTACTCTAGCTAGCAGTGTTAAATCATTCAGCTACCTGAGAGGGGCCCCTATAACTCTCTACGGC).

[0481] 44. The self-amplifying mRNA of any one of items 33 to 43, wherein IM is selected from SEQ ID NO: 13 (IM1) and SEQ ID NO: 20 (IM2).

[0482] 45. The self-amplifying mRNA according to any one of items 33 to 44, comprising from 5' to 3' the following operably linked nucleic acid sequence:

[0483] SP-IL12 P40-L1–IL12 P35-L2–IL21

[0484] in

[0485] SP is a signal peptide,

[0486] IL12-p40 is interleukin-12 containing the heavy chain p40.

[0487] L1 is connector 1,

[0488] IL12 P35 is interleukin-12 containing the light chain p35.

[0489] L2 is connector 2, and

[0490] IL21 is interleukin-21.

[0491] 46. ​​The self-amplifying mRNA of any one of items 33 to 45, wherein SP is selected from SEQ ID NO: 14

[0492] (MSP)

[0493] (ATGACCTCCCGGCTTGAGGGTACTGGCTGCTGCTATGCTGGT GGCTGCTGCTGTGAGTGTGGC) and SEQ ID NO: 21 (HSP)

[0494] (ATGGACTGGACCTGGCGAATACTGTTCTTGGTTGCCGCCG CTACAGGGACTCACGCA).

[0495] 47. The self-amplifying mRNA of any one of items 33 to 46, wherein IL12-P40 is selected from SEQ ID NO: 15 (mIL12-P40) and SEQ ID NO: 22 (hIL12-P40).

[0496] 48. The self-amplifying mRNA of any one of items 33 to 47, wherein L1 is selected from SEQ ID NO: 16 (L(a)) and SEQ ID NO: 23 (L(c)).

[0497] 49. The self-amplifying mRNA of any one of items 33 to 48, wherein IL12-P35 is selected from SEQ ID NO: 17 (mIL12-P35) and SEQ ID NO: 24 (hIL12-P35).

[0498] 50. The self-amplifying mRNA of any one of items 33 to 49, wherein L2 is selected from the group consisting of SEQ ID NO: 18 (L(b)) and SEQ ID NO: 25 (L(d)).

[0499] 51. The self-amplifying mRNA of any one of items 33 to 50, wherein IL12-P40 is selected from SEQ ID NO: 19 (mIL21) and SEQ ID NO: 26 (hIL21).

[0500] 52. The self-amplifying mRNA of any one of items 33 to 51, wherein the plurality of nonstructural replicase domain sequences are obtained from a Group IV RNA virus selected from the family Picornaviridae, Togaviridae, Coronaviridae, Hepaciviridae, Caliciviridae, Flaviviridae, or Astroviridae.

[0501] 53. The self-amplifying mRNA of any one of items 33 to 52, wherein the plurality of nonstructural replicase domain sequences are obtained from an alphavirus selected from the group consisting of Eastern equine encephalitis virus (EEE), Venezuelan equine encephalitis virus (VEE), Everglades virus, Mukambu virus, Pichunna virus, Western equine encephalitis virus (WEE), Sindbis virus, Semliki Forest virus, Middleburg virus, Chikungunya virus, Anyang-Nyang virus, Ross River virus, Bama Forest virus, Geta virus, Lushan virus, Bebaru virus, Mayaro virus, Una virus, Ora virus, Vodaro River virus, Babanken virus, Kuzilagachi virus, Highland J virus, Fort Morgan virus, Ndumau virus, or Bogi River virus.

[0502] 54. The self-amplifying mRNA of any one of items 33 to 53, wherein the plurality of nonstructural replicase domain sequences are alphavirus nonstructural proteins 1-4 (nsP1-4).

[0503] 55. The self-amplifying mRNA of any one of items 33 to 54, wherein the plurality of non-structural replicase domain sequences are obtained from the TC-83 strain of Venezuelan equine encephalitis virus (VEE).

[0504] 56. The self-amplifying mRNA of any one of items 33 to 55, wherein SGP1 is a viral promoter recognized by a viral RNA-dependent RNA polymerase.

[0505] 57. The self-amplifying mRNA of any one of items 33 to 56, wherein SGP2 is a viral promoter recognized by a viral RNA-dependent RNA polymerase.

[0506] 58. The self-amplifying mRNA of any one of items 33 to 57, wherein SGP1 and SGP2 are different subgenomic promoters.

[0507] 59. The self-amplifying mRNA of any one of items 33 to 58, wherein the sa-mRNA further comprises one or more linkers.

[0508] 60. The self-amplifying mRNA of any one of items 33 to 59, wherein the linker is selected from the group consisting of SEQ ID NO: 16 (L(a)), SEQ ID NO: 18 (L(b)), SEQ ID NO: 23 (L(c)) and SEQ ID NO: 25 (L(d)).

[0509] 61. A composition comprising the self-amplifying mRNA of any one of items 33 to 60 and a pharmaceutically acceptable carrier.

[0510] 62. The composition of claim 61 , further comprising a self-amplifying mRNA delivery system.

[0511] 63. A composition as described in claim 62, wherein the self-amplifying mRNA delivery system is a lipid nanoparticle.

[0512] 64. A method of expressing a gene in a cell, comprising delivering the self-amplifying mRNA of any one of items 33 to 60 to the cell, and maintaining the cell under conditions suitable for expression of the gene encoded by the GOI.

[0513] 65. The method of claim 64, wherein the cell is an animal cell.

[0514] 66. A method for producing self-amplifying mRNA, the method comprising:

[0515] a) performing an in vitro transcription reaction using an initial amount of the nucleic acid produced by the method of any one of items 1 to 27; and

[0516] b) generating self-amplifying mRNA by in vitro transcription using said nucleic acid as a template.

[0517] 67. A method of inducing an immune response in an individual, comprising administering to the individual sa-mRNA produced by the method of claim 66.

[0518] 68. A nucleic acid encoding a self-amplifying mRNA, comprising a mutant T7 promoter comprising the nucleotide sequence of SEQ ID NO: 47 (TAATACGACTCACTATAGG), operably linked to a 5' UTR, multiple nonstructural replicase domain sequences, one or more genes of interest (GOIs), a 3' UTR, and a poly-A tail.

[0519] 69. The nucleic acid of item 68, wherein the 5'UTR comprises the nucleotide sequence ATAGG.

[0520] 70. The nucleic acid of any one of items 68 to 69, comprising SAM002 (SEQ ID NO: 36).

[0521] 71. The nucleic acid of any one of items 68 to 70, wherein the nucleic acid further comprises one or more linkers.

[0522] 72. The nucleic acid according to any one of items 68 to 71, comprising the following nucleic acid sequence from 5' to 3':

[0523] a) Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA;

[0524] b)L1-Ori-SM-Pr1-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA

[0525] c)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-GOI-L4-3'UTR-PolyA;

[0526] d)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-3'UTR-PolyA; or

[0527] e)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-SGP-L3-GOI-L4-3'UTR-PolyA,

[0528] in

[0529] L1 is the first connector,

[0530] Ori is the replication origin sequence,

[0531] SM is a selective marker.

[0532] Pr1 is the first promoter sequence,

[0533] L2 is the second connector,

[0534] T7' is a mutant T7 promoter of SEQ ID NO: 47 (TAATACGACTCACTATAGG),

[0535] The 5'UTR' is a mutant 5' untranslated region of ATAGG,

[0536] nsP is a sequence of multiple nonstructural replicase domains.

[0537] L3 is the first connector,

[0538] SGP is a subgenomic promoter.

[0539] GOI is one or more target genes.

[0540] L4 is the second connector,

[0541] 3'UTR is the 3' untranslated region, and

[0542] Poly-A is a 3' polyadenylated tail (poly-A tail).

[0543] 73. The nucleic acid of any one of items 68 to 72, wherein each of L1, L2, L3 and L4 is independently selected from a nucleic acid sequence comprising CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT (SEQ ID NO: 43), CACATTTCCCCGAAAAGTGCCACCTGAGCTC (SEQ ID NO: 44), TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45) or CATCGATGATATCGCGGCCGCATACAGCAGC (SEQ ID NO: 46), or wherein L1 comprises SEQ ID NO: 43 (CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT); L2 comprises SEQ ID NO: 44 (CACATTTCCCCGAAAAGTGCCACCTGAGCTC); L3 comprises SEQ ID NO: 45 NO:45 (TTCGAAGGCGCGCCTCTAGAGCCACC); and L4 comprises SEQ ID NO:46 (CATCGATGATATCGCGGCCGCATACAGCAGC).

[0544] 74. The nucleic acid of any one of items 68 to 73, wherein the first promoter is an ampicillin resistance (AmpR) promoter, a kanamycin resistance (KanR) promoter, a chloramphenicol resistance (CamR) promoter, an erythromycin resistance (ErmR) promoter, or a tetracycline resistance (TetR) promoter.

[0545] 75. The nucleic acid of any one of items 68 to 74, wherein the selectable marker is AmpR, KanR, CamR, ErmR or TetR.

[0546] 76. The nucleic acid of any one of items 68 to 75, wherein at least one gene of interest (GOI) encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, an antigen, an antigen receptor, or a non-coding gene encoding a regulatory structure.

[0547] 77. The nucleic acid of claim 76, wherein the regulatory structure is selected from the group consisting of small interfering RNA (siRNA), microRNA (miRNA), self-activating RNA (saRNA), transfer RNA (tRNA), and long intergenic non-coding RNA (lincRNA).

[0548] 78. The nucleic acid of any one of items 68 to 77, wherein at least one GOI encodes an infectious disease antigen, an allergy antigen or a tumor antigen.

[0549] 79. The nucleic acid of any one of items 68 to 78, wherein at least one GOI encodes a reporter gene.

[0550] 80. The nucleic acid of item 79, wherein the reporter gene is green fluorescent protein (GFP).

[0551] 81. The nucleic acid of any one of items 68 to 80, wherein the plurality of nonstructural replicase domain sequences are obtained from a Group IV RNA virus selected from the group consisting of: Picornaviridae, Togaviridae, Coronaviridae, Hepaciviridae, Caliciviridae, Flaviviridae, and Astroviridae.

[0552] 82. The nucleic acid of any one of items 68 to 81, wherein the plurality of nonstructural replicase domain sequences are obtained from an alphavirus selected from the group consisting of Eastern equine encephalitis virus (EEE), Venezuelan equine encephalitis virus (VEE), Everglades virus, Mukambu virus, Pichunna virus, Western equine encephalitis virus (WEE), Sindbis virus, Semliki Forest virus, Middleburg virus, Chikungunya virus, Anyang-Nyang virus, Ross River virus, Bama Forest virus, Geta virus, Lushan virus, Bebaru virus, Mayaro virus, Una virus, Ora virus, Vodaro River virus, Babanken virus, Kuzilagachi virus, Highland J virus, Fort Morgan virus, Ndumau virus, and Boji River virus.

[0553] 83. The nucleic acid of any one of items 68 to 82, wherein the plurality of nonstructural replicase domain sequences are alphavirus nonstructural proteins 1-4 (nsP1-4).

[0554] 84. The nucleic acid of any one of items 68 to 83, wherein the plurality of nonstructural replicase domain sequences are obtained from the TC-83 strain of Venezuelan equine encephalitis virus (VEE).

[0555] 85. A method for producing self-amplifying mRNA, the method comprising:

[0556] a) performing an in vitro transcription reaction using an initial amount of a nucleic acid according to any one of items 68 to 84; and

[0557] b) generating self-amplifying mRNA by in vitro transcription using said nucleic acid as a template.

[0558] 86. The method of claim 85, wherein the amount of self-amplifying mRNA produced by the mutant T7 promoter containing SEQ ID NO: 47 (TAATACGACTCACTATAGG) and the mutant 5' untranslated region of ATAGG is increased by at least 40% compared to the amount of self-amplifying mRNA produced from a nucleic acid template having a wild-type T7 promoter and 5'UTR.

[0559] 87. A composition comprising the self-amplifying mRNA produced by the method of item 85 and a pharmaceutically acceptable carrier.

[0560] 88. The composition of claim 87, further comprising a self-amplifying mRNA delivery system.

[0561] 89. A composition as described in claim 88, wherein the self-amplifying mRNA delivery system is a nanoparticle composition.

[0562] 90. A method of expressing a gene encoded by a GOI in a cell, comprising delivering the self-amplifying mRNA produced by the method of item 85 or item 86 to a cell, and allowing the cell to express the gene encoded by the GOI.

[0563] 91. The method of claim 90, wherein the cell is an animal cell.

[0564] 92. A method of inducing an immune response in an individual comprising administering to the individual self-amplifying mRNA produced by the method of item 85 or item 86.

[0565] 93. A nucleic acid encoding a self-amplifying mRNA comprising:

[0566] a) a mutant 3'UTR of an alphavirus comprising a point mutation at position 6 relative to the conserved 19-nucleotide sequence GGATTTTGTTTTTAATATTTC (SEQ ID NO: 49) of the wild-type 3'UTR of the alphavirus;

[0567] b) a mutant 3'UTR of an alphavirus comprising point mutations at positions -1 and -2 relative to the conserved 19-nucleotide sequence GGATTTTGTTTTTAATATTTC (SEQ ID NO: 49) of the wild-type 3'UTR of the alphavirus;

[0568] c) a mutant 3'UTR of an alphavirus comprising point mutations at positions -1, -2, and 6 relative to the conserved 19-nucleotide sequence GGATTTTGTTTTTAATATTTC (SEQ ID NO: 49) of the wild-type 3'UTR of the alphavirus;

[0569] d) a mutant 3'UTR of an alphavirus comprising a sequence selected from the group consisting of GGATTTTATTTTTAATATTTC (SEQ ID NO: 50), AAATTTTGTTTTTAATATTTC (SEQ ID NO: 51), or AAATTTTATTTTTAATATTTC (SEQ ID NO: 52); or

[0570] e) a promoter operably linked to a 5'UTR, a plurality of nonstructural replicase domain sequences, one or more genes of interest (GOIs), the mutant 3'UTR of any one of SEQ ID NOs: 49-52, and a poly-A tail.

[0571] 94. The nucleic acid of item 93, comprising a sequence selected from the group consisting of: SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), SAM006 (SEQ ID NO: 40).

[0572] 95. The nucleic acid of claim 94, wherein the nucleic acid further comprises one or more linkers.

[0573] 96. The nucleic acid of any one of items 93 to 95, wherein the nucleic acid sequence comprises from 5' to 3':

[0574] a) Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA;

[0575] b)L1-Ori-SM-Pr1-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA

[0576] c)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-GOI-L4-3'UTR-PolyA;

[0577] d)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-3'UTR-PolyA; or

[0578] e)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-SGP-L3-GOI-L4-3'UTR-PolyA,

[0580] in,

[0581] L1 is the first connector,

[0582] Ori is the replication origin sequence,

[0583] SM is a selective marker.

[0584] Pr1 is the first promoter sequence,

[0585] L2 is the second connector,

[0586] Pr2 is the second promoter sequence,

[0587] 5'UTR is the 5' untranslated region.

[0588] nsP is a sequence of multiple nonstructural replicase domains.

[0589] SGP is a subgenomic promoter.

[0590] L3 is the first connector,

[0591] GOI is one or more target genes.

[0592] L4 is the second connector,

[0593] 3'UTR' is a mutant 3' untranslated region, and

[0594] Poly-A is a 3' polyadenylated tail (poly-A tail),

[0595] wherein the 3'UTR' is:

[0596] a) a mutant 3'UTR of an alphavirus comprising GGATTTTATTTTTAATATTTC (SEQ ID NO: 50);

[0597] b) a mutant 3'UTR of an alphavirus comprising AAATTTTGTTTTTAATATTTC (SEQ ID NO: 51); or

[0598] c) A mutant 3'UTR of an alphavirus comprising AAATTTTATTTTTAATATTTC (SEQ ID NO: 52).

[0599] 97. The nucleic acid of item 96, wherein each of L1, L2, L3 and L4 is independently selected from a nucleic acid sequence comprising CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT (SEQ ID NO: 43), CACATTTCCCCGAAAAGTGCCACCTGAGCTC (SEQ ID NO: 44), TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45) or CATCGATGATATCGCGGCCGCATACAGCAGC (SEQ ID NO: 46), or wherein L1 comprises SEQ ID NO: 43 (CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT); L2 comprises SEQ ID NO: 44 (CACATTTCCCCGAAAAGTGCCACCTGAGCTC); L3 comprises SEQ ID NO: 45 NO:45 (TTCGAAGGCGCGCCTCTAGAGCCACC); and L4 comprises SEQ ID NO:46 (CATCGATGATATCGCGGCCGCATACAGCAGC).

[0600] 98. The nucleic acid of any one of items 96 to 97, wherein the first promoter is an ampicillin resistance (AmpR) promoter, a kanamycin resistance (KanR) promoter, a chloramphenicol resistance (CamR) promoter, an erythromycin resistance (ErmR) promoter, and a tetracycline resistance (TetR) promoter.

[0601] 99. The nucleic acid of any one of items 96 to 98, wherein the selectable marker is AmpR, KanR, CamR, ErmR or TetR.

[0602] 100. The nucleic acid of any one of items 96 to 99, wherein at least one gene of interest (GOI) encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, an antigen, or a non-coding gene encoding a regulatory structure.

[0603] 101. The nucleic acid of claim 100, wherein the regulatory structure is selected from the group consisting of small interfering RNA (siRNA), microRNA (miRNA), self-activating RNA (saRNA), transfer RNA (tRNA), and long intergenic non-coding RNA (lincRNA).

[0604] 102. The nucleic acid of item 101, wherein at least one GOI encodes an infectious disease antigen, an allergy antigen, or a tumor antigen.

[0605] 103. The nucleic acid of any one of items 96 to 102, wherein at least one GOI encodes a reporter gene.

[0606] 104. The nucleic acid of item 103, wherein the reporter gene is green fluorescent protein (GFP).

[0607] 105. A nucleic acid as described in any of items 96 to 104, wherein the multiple non-structural replicase domain sequences are obtained from a Group IV RNA virus, and the Group IV RNA virus is selected from the group consisting of: Picornaviridae, Togaviridae, Coronaviridae, Hepaciviridae, Caliciviridae, Flaviviridae and Astroviridae.

[0608] 106. The nucleic acid of any one of items 96 to 105, wherein the plurality of nonstructural replicase domain sequences are obtained from an alphavirus selected from the group consisting of Eastern equine encephalitis virus (EEE), Venezuelan equine encephalitis virus (VEE), Everglades virus, Mukambu virus, Pichunna virus, Western equine encephalitis virus (WEE), Sindbis virus, Semliki Forest virus, Middleburg virus, Chikungunya virus, Anyang-Nyang virus, Ross River virus, Bama Forest virus, Geta virus, Lushan virus, Bebaru virus, Mayaro virus, Una virus, Ora virus, Vodaro River virus, Babanken virus, Kuzilagachi virus, Highland J virus, Fort Morgan virus, Ndumau virus, and Boji River virus.

[0609] 107. The nucleic acid of any one of items 96 to 106, wherein the plurality of nonstructural replicase domain sequences are alphavirus nonstructural proteins 1-4 (nsP1-4).

[0610] 108. The nucleic acid of any one of items 96 to 107, wherein the plurality of nonstructural replicase domain sequences are obtained from the TC-83 strain of Venezuelan equine encephalitis virus (VEE).

[0611] 109. A method for producing self-amplifying mRNA, the method comprising:

[0612] a) performing an in vitro transcription reaction using an initial amount of a nucleic acid according to any one of items 96 to 108; and

[0613] b) generating self-amplifying mRNA by in vitro transcription using said nucleic acid as a template.

[0614] 110. A composition comprising the self-amplifying mRNA produced by the method of item 109 and a pharmaceutically acceptable carrier.

[0615] 111. The composition of item 110, further comprising a self-amplifying mRNA delivery system.

[0616] 112. A composition as described in item 111, wherein the self-amplifying mRNA delivery system is a lipid nanoparticle.

[0617] 113. A method of expressing a gene encoded by a GOI in a cell, comprising delivering a self-amplifying mRNA produced by the method of item 109, and maintaining the cell under conditions suitable for expression of the gene encoded by the GOI.

[0618] 114. The method of item 113, wherein the cell is an animal cell.

[0619] 115. A method of inducing an immune response in an individual comprising administering to the individual self-amplifying mRNA produced by the method of item 109.

[0620] 116. A method of reducing the interferon response of a host cell compared to the interferon response of a host cell introduced with a self-amplifying mRNA comprising a wild-type 3'UTR of an alphavirus, comprising introducing into the host cell the self-amplifying mRNA produced by the method of item 109.

[0621] 117. The method of claim 116, wherein the interferon response of the host cell is 1 / 2, 1 / 3, 1 / 4, 1 / 5 or 1 / 6 the amount of the interferon response of the host cell to the introduction of a self-amplifying mRNA containing the wild-type 3'UTR of an alphavirus.

[0622] 118. A method for de novo synthesis of a construct for preparing a self-amplifying nucleic acid, comprising:

[0623] a) contacting an Escherichia coli cell with a nucleic acid encoding two expression units, said nucleic acid comprising:

[0624] i) Origin of replication sequence (Ori);

[0625] ii) a first expression unit encoding a first nucleotide sequence operably linked to a first promoter for expressing a selectable marker; and

[0626] iii) a second expression unit encoding a second nucleotide sequence operably linked to a second promoter for in vitro transcription of the self-amplified nucleic acid,

[0627] wherein the first expression unit encodes a selectable marker and the second expression unit encodes a self-amplifying nucleic acid;

[0628] b) selecting Escherichia coli cells expressing the selectable marker; and

[0629] c) subculturing the selected Escherichia coli cells to obtain an Escherichia coli cell population expressing the selective marker;

[0630] d) allowing the cell population to proliferate; and

[0631] e) performing in vitro transcription on the second expression unit to produce the self-amplifying nucleic acid.

[0632] 119. A polynucleotide encoding:

[0633] a) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 1 (BA.1-1273);

[0634] b) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 2 (BA.1-1273-S2P);

[0635] c) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 3 (BA.2-1273);

[0636] d) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 4 (BA.2-1273-S2P);

[0637] e) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 5 (BA.1-1208);

[0638] f) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 6 (BA.1-1208-S2P);

[0639] g) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 7 (BA.2-1208); or

[0640] h) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 8 (BA.2-1208-S2P).

[0641] 120. A method for preparing a library of self-amplified mRNAs derived from a reference self-amplified mRNA, comprising:

[0642] (i) performing directed evolution of a reference self-amplified mRNA sample, comprising the following steps:

[0643] (a) delivering a reference self-amplified mRNA sample encoding a selectable marker into a host cell,

[0644] (b) culturing the host cell for a period of time and under conditions requiring replication of the reference self-amplified mRNA sample and allowing expression of the selectable marker, wherein a mutation occurs in the replicated self-amplified mRNA compared to the reference self-amplified mRNA,

[0645] (c) selecting cells expressing the selectable marker; and

[0646] (ii) extracting the replicated self-amplifying mRNA from the host cell, and sequencing the replicated self-amplifying mRNA;

[0647] A library of self-amplified mRNA sequences is thereby generated.

[0648] 121. A method as described in item 120, wherein the selectable marker is an antibiotic resistance gene.

[0649] 122. The method of any one of items 120 to 121, wherein the selectable marker is a puromycin resistance gene.

[0650] 123. The method of any one of items 120 to 122, wherein the reference self-amplifying mRNA is delivered into the host cell using a delivery mechanism.

[0651] 124. The method of claim 123, wherein the delivery system is a lipid nanoparticle.

[0652] 125. The method of any one of items 120 to 124, wherein the reference self-amplifying mRNA is selected from the group consisting of SEQ ID NOs. 1-8 and SEQ ID NOs. 35-42.

[0653] 126. The method of any one of items 120 to 125, wherein the conditions requiring replication of the reference self-amplifying mRNA sample and allowing expression of the selectable marker are an antibiotic-containing culture environment.

[0654] 127. The method of any one of items 120 to 126, wherein the concentration of the antibiotic affects the mutation rate of the reference self-amplifying mRNA.

[0655] 128. A method for evaluating mutations in a replicated self-amplifying mRNA produced by the method of any one of items 120 to 127, the method comprising:

[0656] (i) obtaining a set of contig sequences comprising mutations compared to a reference self-amplified mRNA sample;

[0657] (ii) sequencing the contig sequences; and

[0658] (iii) determining the number of mutations in the contig sequence compared to the reference self-amplified mRNA.

[0659] 129. A method as described in item 128, wherein the overlapping group sequence is a fragment of the replicated self-amplifying mRNA.

[0660] 130. The method of claim 128, wherein the contig sequence is SEQ ID NO: 27.

[0661] 131. The method of claim 128, wherein the overlapping group sequence is SEQ ID NO: 28.

[0662] 132. The method of claim 128, wherein the overlapping group sequence is SEQ ID NO: 29.

[0663] 133. The method of claim 128, wherein the overlapping group sequence is SEQ ID NO: 30.

[0664] 134. The method of claim 128, wherein the overlapping group sequence is SEQ ID NO: 31.

[0665] 135. The method of claim 128, wherein the overlapping group sequence is SEQ ID NO: 32.

[0666] 136. The method of claim 128, wherein the overlapping group sequence is SEQ ID NO: 33.

[0667] 137. The method of claim 128, wherein the overlapping group sequence is SEQ ID NO: 34.

[0668] 138. A method of identifying a self-amplifying mRNA with reduced cytotoxic effects as part of a therapeutic product, comprising:

[0669] (i) obtaining a panel comprising a plurality of self-amplifying mRNAs;

[0670] (ii) quantifying the relative gene product expression of each self-amplified mRNA over a period of time; and

[0671] (iii) identifying a self-amplifying mRNA that exhibits stable gene product expression over the period of time compared to other self-amplifying mRNAs in the set;

[0672] Wherein the self-amplifying mRNA exhibiting sustained gene product expression over the period of time exhibits reduced cytotoxic effects as part of a therapeutic product compared to other self-amplifying mRNAs of the panel.

[0673] 139. The method of claim 138, wherein the period of time is between 12 hours and 10 days.

[0674] 140. The method of any one of items 138 to 139, wherein the period of time is 1 day.

[0675] 141. The method of any one of items 138 to 140, wherein the self-amplifying mRNA that exhibits sustained gene product expression over the period of time exhibits less than a 20-fold change in expression.

[0676] 142. A therapeutic product comprising SAM002 (SEQ ID NO: 36), wherein the therapeutic product exhibits reduced cytotoxic effects as part of the therapeutic product compared to a therapeutic product comprising SAM001 (SEQ ID NO: 35).

[0677] Example

[0678] The bioactive agents of the present disclosure can be delivered using nanoparticle compositions comprising an ionizable lipid; one or more PEG lipids; one or more structural lipids (e.g., cholesterol, coprolol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, α-tocopherol, and mixtures thereof); and one or more phospholipids.

[0679] Example 1: LNP delivery system

[0680] One suitable system for delivering the sa-mRNA of the present disclosure is to use a lipid nanoparticle (LNP) delivery system. A method for improving transfection efficiency and reducing the cytotoxicity of LNP formulations is to use the novel ionizable lipids described in PCT patent application PCT / US2023 / 017777 (which patent application is incorporated herein in its entirety). The ionizable lipids in the LNP formulation play a key role in the uptake of LNP by cells and the release of LNP from endosomes. Formula E6 (1,1',1"-(1,3,5-triazinane-1,3,5-triyl)tris(3-(ditridecylamino)propan-1-one)) is a novel ionizable lipid described in PCT patent application PCT / US2023 / 017777, as shown below:

[0681]

[0682] E6

[0683] The structure of E6 was confirmed by 1H NMR spectroscopy and mass spectrometry. 1 H_NMR (400MHz, CDCl3, δ) 0.88 (t, J = 0.8Hz, 18H), 1.23-1.32 (m, 132H), 1.42-1.44 (m, 12H), 2.43 (s, 12H), 2.67 (s, 6H), 2.81 (s, 6H), 5.26 (s, 6H). MS(m / z):C 90 H 182 Calculation of N6O3[M+2H] 2+ , 697.7; measurement, 697.9.

[0684] E2 (1,1′,1″-(1,3,5-triazinane-1,3,5-triyl)tris(3-(dinonylamino)propan-1-one)) and P6 (N-(2-(cyclohex-1-en-1-ylamino)-1-(1-ethylpiperidin-4-yl)-2-oxoethyl)-N-(heptadecan-9-yl)palmitamide) are novel ionizable lipids described in PCT patent application PCT / US2023 / 017777, as shown below:

[0685]

[0686] E2

[0687]

[0688] P6

[0689] The structure of E2 was confirmed by 1H NMR spectroscopy and mass spectrometry. 1H-NMR (400MHz, CDCl3, δ) 5.26 (s, 6H), 2.79 (t, J = 8Hz, 6H), 2.65 (t, J = 8Hz, 6H), 2.41 (t, J = 8Hz, 12H), 1.42-1.26 (m, 84H), 0.88 (t, J = 8Hz, 18H). MS(ESI)m / z 529.6[M+2H] 2+ .

[0690] The structure of P6 was confirmed by 1H NMR spectroscopy and mass spectrometry. 1 H-NMR (400MHz, Me-OD, δ) 6.05 (t, J = 8Hz, 1H), 4.26 (s, 1H), 3.26-3.17 (m, 3H), 2.49-2.42 (m,5H),2.19-2.01(m,6H),1.67-1.57(m,14H),1.31-1.16(m,48H),0.92-0.87(m,12H). MS(APCI)m / z 742.7[M+H] + .

[0691] The nucleic acid of the present disclosure can be delivered using an LNP delivery system, wherein the LNP is formulated with ionizable lipids, auxiliary lipids, cholesterol, and PEG-lipids. In one aspect, the LNP of the present disclosure has a molar ratio of about 2%-60% ionizable lipids, about 5%-40% auxiliary lipids, about 30%-80% cholesterol, and about 0.5%-30% PEG-lipids. In one aspect, the LNP of the present disclosure has a molar ratio of about 2%-10% ionizable lipids, about 5%-15% auxiliary lipids, about 40%-80% cholesterol, and about 0.5%-3% PEG-lipids. In one aspect of the present disclosure, the ionizable lipid is E6. In one aspect of the present disclosure, the auxiliary lipid is independently selected from DOPE (2-dioleoyl-sn-glycero-3-phosphoethanolamine), DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), and POPE (1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine). In one aspect, the nucleic acids of the present disclosure can be delivered using an LNP delivery system, wherein the ionizable lipid is E6, the helper lipid is DOPE, and the PEG-lipid is DMG-PEG2000. In one aspect of the present disclosure, the LNP is composed of E6, DOPE, cholesterol, and DMG-PEG-2000. In one aspect, the LNP has a molar ratio of 50% ionizable lipid, 10% helper lipid, 38.5% cholesterol, and 1.5% PEG-lipid. In another aspect, the LNP has a molar ratio of 7.5% ionizable lipid, 15% helper lipid, 75% cholesterol, and 2.5% PEG-lipid. In another aspect, the LNP of the present disclosure has a molar ratio of 5% ionizable lipid, 10% helper lipid, 50% cholesterol, and 1.5% PEG-lipid. In some aspects, the ionizable lipid may include E6, the helper lipid may include DOPE, and the PEG-lipid may include DMG-PEG2000.

[0692] E6 was synthesized using DOPE, cholesterol, and DMG-PEG2000 and formulated into LNPs. The transfection efficacy and cytotoxicity of the LNPs were determined in 293T cells using a self-amplifying mRNA encoding GFP. The disclosed LNPs were found to effectively transfect each cell type in vitro and demonstrated increased encapsulation efficiency and comparable or reduced cytotoxicity between the secreted form of the modified spike protein disclosed herein and the spike protein encoded by the currently FDA-approved mRNA.

[0693] Example 2: Self-amplification of mRNA

[0694] The sa-mRNA of the present disclosure is synthesized using the TC-83 strain of the alphavirus subtype VEE, wherein the sa-mRNA of the present disclosure is derived from a wild-type TC-83 replicon that does not contain alphavirus structural proteins; SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273), SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208), SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208), and SEQ ID NO: 8 (BA.2-1208-S2P) are as follows. Figure 16-17 Modified variants of the spike antigen shown; SEQ ID NO: 13 (IM1) and SEQ ID NO: 20 (IM2) encode the immune regulators SEQ ID NO: 15 (mIL12 P40), SEQ ID NO: 17. (mIL12-P35) and SEQ ID NO: 19 (mIL21); SEQ ID NO: 9 encodes subgenomic promoter 1; and SEQ ID NO: 11 encodes subgenomic promoter 2, as shown Figure 23-24 shown.

[0695] The modified spike protein encoded by the sa-mRNA of the present disclosure forms the correct conformation of the spike protein for vaccination and can be recognized by broadly neutralizing antibodies when transfected into 293T cells using lipofectamine, such as Figure 18-19 The data show that 293T cells transfected with SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273), and SEQ ID NO: 4 (BA.2-1273-S2P) can be recognized by the broadly neutralizing antibody (bnAb) SPD-M265 and hACE2-FITC, as shown by the GFP on the X-axis ( Figure 18 ) or ACE2( Figure 19 ) expression as measured by FACS plots and live-dead dye staining of 7-AAD on the Y-axis. The modified spike protein encoded by the sa-mRNA of the present disclosure can trigger a humoral immune response.

[0696] Example 3: sa-mRNA encoding modified spike protein

[0697] like Figure 20As shown, sa-mRNA encoding a modified spike protein containing an S2P modification stabilizes the structure of the secreted spike. In this study, 293T cells were transfected with sa-mRNA containing and not containing an S2P modification, and the absorbance measured using SPD-M265bnAb was on the Y-axis and the dilution factor measured was on the X-axis. In addition, the secreted form of the modified spike antigen (SEQ ID NO: 6 (BA.1-1208-S2P)) showed BA.2-specific IgG equivalent to SEQ ID NO: 1 (BA.1-1273) and SEQ ID NO: 2 (BA.1-1273-S2P), which is more similar to the transmembrane spike protein encoded by the mRNA of the first-generation new crown vaccine, such as Figure 22 As shown. Sera from mice injected with sa-mRNA encoding SEQ ID NO: 3 (BA.2-1273), SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 7 (BA.2-1208), and SEQ ID NO: 8 (BA.2-1208-S2P) delivered using LNPs of the present disclosure were collected on day 0, day 14 (2WP1, 2 weeks after the first injection), and day 28 (2WP2, 2 weeks after the second injection), and antigen-specific IgG titers were determined. Figure 21-22 As shown, the data demonstrate that there is a comparable immune response between the secreted form of the modified spike protein of the present disclosure and the spike protein encoded by the current FDA-approved mRNA.

[0698] Example 4: Characterization of sa-mRNA of the present disclosure

[0699] A study was conducted to compare the cytotoxicity of different sa-mRNA constructs of the present disclosure (SAM001, SAM002, and SAM003, as well as modified mRNA from MOD001) in HEK293 cells. Although sa-mRNA is advantageous for producing greater numbers of mRNA transcripts and / or more highly expressed gene products, these characteristics may have cytotoxic effects on the host cell or organism. Therefore, it is important for therapeutic sa-mRNA constructs to maintain an increase in intracellular mRNA transcripts compared to conventional mRNA without increasing the expression levels of transcripts and gene products to avoid damaging the host cell. Sustained intracellular mRNA transcript levels allow for higher initial delivery of therapeutic sa-mRNA payloads and produce less cytopathic effects because the expression levels of transcripts and gene products do not increase dramatically or decay rapidly over time. The results of this study indicate that SAM001 is a cytopathic construct and SAM002 is a non-cytopathic construct.

[0700] like Figure 2As shown, SAM002 showed the most stable reporter gene expression compared to the other sa-mRNA constructs tested, suggesting that it is more suitable for vaccination or gene replacement therapy against infectious diseases. In contrast, SAM001 showed a sharp decrease in reporter gene expression, suggesting that it is more suitable for cancer therapies that require increased release of tumor-associated antigens.

[0701] A study was also conducted to characterize the replication rate of each sa-mRNA construct of the present disclosure (SAM001, SAM002, and SAM003, as well as the modified mRNA from MOD001). Figure 25 As shown, the relative expression of nsP3 and eGFP represents the copies of sa-mRNA and subgenomic transcripts, respectively. SAM002 showed approximately one-third the number of transcript copies of both nsP3 and eGFP compared to SAM001. This result indicates that SAM001 has higher sa-mRNA replication rates and higher transcription rates of the subgenomic eGFP reporter gene than SAM002, suggesting an increased decay rate of SAM001 and its transcripts.

[0702] like Figure 26 As shown, when each construct was delivered intramuscularly using the P6-LNP delivery method, expression of SAM001 encoding luciferase consistently showed much lower in vivo expression than SAM002. This result suggests that SAM002 is more suitable for delivering therapeutic payloads at higher levels with less cytopathic effect than the SAM001 construct. Figure 2 and 26 In the present study, SAM001 with higher cytopathicity showed shorter and lower expression of the payload gene, but these cytopathic effects may help to increase the therapeutic efficacy of cancer therapies that function by releasing tumor-associated antigens, such as Figure 27 Therefore, each of SAM001 and SAM002 has utility due to its unique biological activity.

[0703] Example 5: Directed evolution of sa-mRNA

[0704] A study was conducted to generate sa-mRNA constructs. Directed evolution of sa-mRNA for SAM002 was performed in C2C12 cells with different concentrations of puromycin (1 μg / ml or 10 μg / ml) for 60 days. RNA-dependent RNA polymerases are known to have a high error rate, which would cause mutants of SAM002 to appear over time. Figure 28a The SAM002 constructs shown were divided into 8 contigs, which were Figure 28aThe 8 overlapping contigs are labeled 1-8 and contain SEQ ID NOs. 27-34. The 8 overlapping contigs are convenient for cloning into a vector format suitable for Sanger DNA sequencing. Figure 28b As shown, at 1 μg / ml puromycin, only one mutation was found in nsP4. In contrast, at 10 μg / ml puromycin, six mutations were found in nsP2, nsP3, and nsP4. These six mutations occurred in contigs 2, 3, 4, and 5, respectively. The six mutations in SAM002 are numbered alleles 2, 4, 2, and 2, respectively, and they can form 32 variants, as shown in Table 2-13 below:

[0705] Table 1

[0706]

[0707]

[0708] Table 2

[0709]

[0710]

[0711] Table 3

[0712]

[0713] Table 4

[0714]

[0715]

[0716] Table 5

[0717]

[0718] Table 6

[0719]

[0720] Table 7

[0721]

[0722]

[0723] Table 8

[0724]

[0725] Table 9

[0726]

[0727]

[0728] Table 10

[0729]

[0730] Table 11

[0731]

[0732]

[0733] Table 12

[0734]

[0735] Table 1-12 shows the characterization of 66 sa-mRNA mutants. To generate these mutants, C2C12 cells were transfected with SAM002 encoding puromycin via P6-LNP. The transfected cells were cultured for 2 months at 1 μg / ml or 10 μg / ml puromycin. Two months after transfection, total RNA from selected cells was extracted and reverse transcribed. Specific primers covering contigs 1 to 6 were used for amplification and subcloning. For each contig, 8 clones were cultured and isolated using a miniprep procedure to isolate small plasmid DNA from bacteria while preventing protein contamination and using genomic DNA for Sanger sequencing. The contig sequences include SEQ ID NOs. 27-34, corresponding to contigs 1-8, respectively. The identified mutations can form 66 combinations and are further engineered into SAM001 or SAM002 at the specified position of each mutation. Thus, this study identified 67 cytopathic and non-cytopathic sa-mRNA constructs that included mutations in the presence of 1 μg / ml puromycin and the 66 mutants shown in Tables 1-12.

[0736] A characterization study was conducted to investigate the expression levels of 66 sa-mRNA variants identified using the methods described above. The 66 sa-mRNA variants were transcribed in vitro and transfected into C2C12 cells using LNPs containing the ionizable lipid P6, as defined in PCT patent application PCT / US2023 / 017777 (incorporated herein in their entirety) (P6-LNP). The transfected cells were analyzed by fluorescence-activated cell sorting (FACS) on days 1 and 3 after transfection. The percentage of GFP and mean fluorescence intensity (MFI) representing the expression of the gene product of each variant were analyzed. The GFP percentage and MFI on day 3 were normalized compared to the data on day 1. Total RNA from the transfected cells was extracted and reverse transcribed into complementary DNA, and quantitative polymerase chain reaction (qPCR) was performed using specific probes nsP3 and eGFP.

[0737] To characterize the variants identified over time, variants were transfected into mouse myoblast C2C12 cells using P6-LNP and analyzed by flow cytometry on days 1 and 3 post-transfection. The number of transcripts for each sa-mRNA construct was quantified using an nsP3-specific probe. Subgenomic transcripts were quantified using a GFP-specific probe. A wide range of GFP-reduced cells and GFP intensity was observed among the tested variants.

[0738] Thus, the present disclosure encompasses sa-mRNA libraries that can be used for various specific indications, such as mRNA drugs targeting infectious diseases, cancer, autoimmune diseases, and rare diseases.

[0739] Example 4: Characterization of the de novo synthesized sa-mRNA of the present disclosure

[0740] The nucleic acids disclosed herein were synthesized using the TC-83 strain of the alphavirus subtype VEE, wherein SAM001 (SEQ ID NO: 35) was derived from a wild-type TC-83 replicon lacking alphavirus structural proteins, and SAM002 (SEQ ID NO: 36), SAM003 (SEQ ID NO: 37), SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), SAM006 (SEQ ID NO: 40), and MOD001 (SEQ ID NO: 41) were modified according to the disclosure. T7-VEE-GFP (SEQ ID NO: 42) was derived from a wild-type TC-83 replicon and contained a wild-type T7 promoter and a GOI encoding GFP. The efficacy of in vitro transcription of the nucleic acid templates into sa-mRNA and the immune response to the sa-mRNA were determined in Raw-ISG-Lucia and 293T cells. It was found that the nucleic acid templates disclosed herein were efficiently transcribed into sa-mRNA. Data showed that in vitro transcription yields were better or comparable to those of currently FDA-approved therapeutic mRNAs and resulted in reduced immune responses.

[0741] The DNA fragment of sa-mRNA (sa-mRNA) was synthesized de novo using the TC-83 strain of Venezuelan equine encephalitis (VEE) virus (an alphavirus subtype in which genes encoding structural proteins are deleted). As shown in Figure 1, the DNA fragment was assembled under the T7 promoter. Other components include linker 1, replication origin sequence (Ori), ampicillin resistance gene (SM), SM promoter (SM-Pro), linker 2, 5'UTR, nsp1-4, linker 3, reporter gene or target gene (GOI), linker 4, 3'UTR, polyadenine (polyA). Based on the wild-type form SAM001, mutations in the non-cytopathic forms of SAM002 (C5830T, Pro mutated to Ser) and SAM003 (A5729T, Gln mutated to Leu) were engineered.

[0742] like Figure 2 As shown in the figure, the stability of different sa-mRNA forms SAM001, SAM002, and SAM003, as well as the modified mRNA of MOD001, was compared, and the results showed that SAM002 was more stable than the other sa-mRNAs tested, including modified mRNAs. These data suggest that SAM002 is more suitable for vaccination against infectious diseases or gene replacement by gene editing.

[0743] like Figure 2 As shown, the expression of SAM001 decreased dramatically over time, indicating that SAM001 is suitable for transient expression or cancer immunotherapy and therapeutic cancer vaccines.

[0744] Different forms of sa-mRNA and modified mRNA were compared. 293T cells were transfected with different sa-mRNAs (sa-mRNAs) SAM001, SAM002, SAM003, and modified mRNA from MOD001 encoding GFP via lipofectamine. Cells were analyzed by flow cytometry on days 1, 3, and 5. The reduction in GFP expression was normalized to the percentage of GFP on day 1. Statistical analysis was performed by one-way ANOVA. Figure 2 As shown, the modified sa-mRNA of the present disclosure showed better GFP expression over time compared to SAM001 (SEQ ID NO: 35).

[0745] Since the size of sa-mRNA is always greater than 7000 nucleotides, it is challenging to produce mRNA by in vitro transcription within a limited time. Figure 4 As shown, SAM002 (TAATACGACTCACTATAGG ATAGG) (SEQ ID NO: 53) has a unique repeating sequence of ATAGG. Figure 5 As shown, the mRNA production of SAM002 increased by 46% compared with T7-VEE-GFP. Therefore, the sa-mRNA disclosed in the present invention has enhanced transcription ability and higher yield, and is suitable for large-scale transcription of mRNA and production of large amounts of mRNA. Figure 4 The modified sa-mRNA of the modified T7 and 5'UTR (SAM002 (SEQ ID NO: 36)) showed a higher yield at 30 minutes of in vitro transcription compared to the control (T7-VEE-GFP), as shown in FIG. Figure 5 shown.

[0746] The interferon response is an innate host cell response to exogenous RNA and substances, as well as pathogens. It significantly limits the half-life of mRNA in cells and produces side effects such as fever. Using mRNA to manipulate the interferon response is a medical challenge. Sequencing and functional analysis have shown that a conserved 19-nucleotide segment in the 3' UTR of alphaviruses is critical for alphavirus repair. Figure 6 The structure prediction of the 3'UTR of wild-type VEE is shown, and the probability of the structure is indicated according to the scale. The modified 3'UTRs of the present disclosure (SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), and SAM006 (SEQ ID NO: 40)) showed reduced or equivalent interferon response compared to self-amplified mRNA transcribed from nucleic acid templates containing the 3'UTR of wild-type VEE (SAM002 (SEQ ID NO: 36) and MOD001 (SEQ ID NO: 41)). Figure 6 In the model shown, the G at position 6 and the C at position 19 form a G:C pair to lock a ring, and the two GGs at positions -1 and 2 form a GG:CC pair to form a stem. Figure 7 As shown, mutation of G at position 6 to A, mutation of GG at position -1 and position 2 to AA, or simultaneous occurrence of these two mutations can generate SAM004, SAM005 and SAM006 based on SAM002.

[0747] The sa-mRNAs from SAM004, SAM005, and SAM006 and the modified mRNA from MOD001 were transfected into Raw-ISG-Lucia cells (interferon reporter cells developed by Invivogen). Figure 8As shown, on day 1 after transfection, the interferon responses of SAM002 and modified mRNA MOD001 were 5.1-fold and 2.1-fold greater than that exhibited by SAM004 in the interferon mimic assay.

[0748] Figure 8 Reporter gene assays are shown for five separate self-amplifying mRNAs generated from GFP-expressing nucleic acid templates SAM002 (SEQ ID NO: 36), SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), SAM006 (SEQ ID NO: 40), and MOD001 (SEQ ID NO: 41) in Raw-ISG-Lucia cells on day 1 post-transfection. The modified 3'UTRs of the present disclosure (SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), and SAM006 (SEQ ID NO: 40)) exhibited reduced or comparable interferon responses compared to self-amplifying mRNAs transcribed from nucleic acid templates containing the 3'UTR of wild-type VEE (SAM002 (SEQ ID NO: 36) and MOD001 (SEQ ID NO: 41)).

[0749] Figure 9 Shown are reporter gene assays of four individual sa-mRNAs produced from GFP-expressing nucleic acid templates SAM002 (SEQ ID NO: 36), SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), and SAM006 (SEQ ID NO: 40) in Raw-ISG-Lucia cells on day 1 post-transfection, where GFP expression was normalized using nsP3 compared to SAM002. Among the GFP mRNA transcripts of SAM004, SAM005, SAM006, and SAM002, the GFP level in SAM004 was 1 / 2-fold higher than that in SAM002, while the GFP level in SAM005 was 1.8-fold higher than that in SAM002.

[0750] Nucleic acid sequence

[0751] In the following exemplary sequences, the representative exemplary GOI can be replaced with any other GOI. Those skilled in the art will recognize that these sequences are exemplary and not limiting of the disclosure, and they support and serve as proof of concept disclosed and claimed herein.

[0752] Table 13

[0753]

[0754]

[0755]

[0756]

[0757] SARS-CoV-2, AOMIKURU BA.1-1273 (SEQ ID NO: 1)

[0758]

[0759]

[0760] SARS-CoV-2, AOMIKURU BA.2-1273 (SEQ ID NO: 3)

[0761]

[0762] SARS-CoV-2, Omicron BA.2-1273-S2P (SEQ ID NO:4)

[0763]

[0764] SARS-CoV-2, AOMIKUROKUBA.1-1208 (SEQ ID NO: 5)

[0765]

[0766] SARS-CoV-2, Omicron BA.1-1208-S2P (SEQ ID NO:6)

[0767]

[0768] SARS-CoV-2, AOMIKURU BA.2-1208 (SEQ ID NO: 7)

[0769]

[0770] SARS-CoV-2, Omicron BA.2-1208-S2P (SEQ ID NO:8)

[0771]

[0772] Immunomodulator (IM1) (murine signal peptide-mIL12 P40-linker-mIL12-P35-linker-mIl21) (SEQ ID NO 13)

[0773]

[0774] Immunomodulator (IM2) (human signal peptide-huIL12 P40-linker-huIL12-P35-linker-huIl21) (SEQ ID NO: 20)

[0775]

[0776] SAM001(SEQ ID NO:35)

[0777]

[0778] SAM002(SEQ ID NO:36)

[0779]

[0780]

[0781]

[0782] SAM005(SEQ ID NO:39)

[0783]

[0784] SAM006(SEQ ID NO:40)

[0785]

[0786] MOD001(SEQ ID NO:41)

[0787]

[0788] T7-VEE-GFP(SEQ ID NO:42)

[0789]

[0790] Contig 1 (SEQ ID NO: 27)

[0791]

[0792] Contig 2 (SEQ ID NO: 28)

[0793]

[0794] Contig 3 (SEQ ID NO: 29)

[0795]

[0796] Contig 4 (SEQ ID NO: 30)

[0797]

[0798] Contig 5 (SEQ ID NO: 31)

[0799]

[0800] Contig 6 (SEQ ID NO: 32)

[0801]

[0802] Contig 7 (SEQ ID NO: 33)

[0803]

[0804] Contig 8 (SEQ ID NO: 34)

[0805] CACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTG GCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGC GCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGTCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGACATCG ATGATATCGCGGCCGCATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTATTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTCAAAAAAAAAAAAAAA

[0806] Furthermore, it should be understood that any particular aspect of the present disclosure that is prior art may be explicitly excluded from any one or more of the claims. Since these aspects are considered an integral part of the present disclosure, any portion of the entire disclosure may be excluded even if not explicitly stated to be excluded herein.

[0807] It should be understood that although the present disclosure has been described in conjunction with specific embodiments, the foregoing description is intended to illustrate rather than limit the scope of the present disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. A method for increasing the copy number of a nucleic acid, comprising: a) contacting a cell with a nucleic acid encoding two expression units, said nucleic acid comprising: i) Origin of replication sequence (Ori); ii) a first expression unit encoding a first nucleotide sequence operably linked to a first promoter; and iii) a second expression unit encoding a second nucleotide sequence operably linked to a second promoter, wherein the first expression unit encodes a selectable marker, and the second expression unit encodes a self-amplifying mRNA (sa-mRNA); b) selecting cells expressing the selectable marker; c) subculturing the selected cells to obtain a cell population expressing the selective marker; as well as d) allowing said cell population to proliferate to increase said copy number of said nucleic acid.

2. The method of claim 1, wherein the nucleic acid is a recombinant DNA molecule.

3. The method of claim 2, wherein the recombinant DNA molecule is a plasmid. The method of claim 1 , wherein the nucleic acid is a closed circular molecule or a linear molecule.

5. The method according to any one of claims 1 to 4, wherein the nucleic acid is suitable for in vitro transcription of RNA after linearization using the nucleic acid as template.

6. The method of any one of claims 1 to 5, wherein the cell is a bacterium.

7. The method of claim 6, wherein the bacterium is Escherichia coli.

8. The method of any one of claims 1 to 7, wherein the nucleic acid comprises SAM001 (SEQ ID NO: 35), SAM002 (SEQ ID NO: 36), SAM003 (SEQ ID NO: 37), SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), SAM006 (SEQ ID NO: 40), MOD001 (SEQ ID NO: 41) or T7-VEE-GFP (SEQ ID NO: 42).

9. The method of any one of claims 1 to 8, wherein the nucleic acid sequence has at least 90% sequence identity to SAM001 (SEQ ID NO: 35), SAM002 (SEQ ID NO: 36), SAM003 (SEQ ID NO: 37), SAM004 (SEQ ID NO: 38), SAM005 (SEQID NO: 39), SAM006 (SEQ ID NO: 40), MOD001 (SEQ ID NO: 41) or T7-VEE-GFP (SEQ ID NO: 42).

10. The method according to any one of claims 1 to 9, wherein the first expression unit comprises the following operably linked nucleic acid sequences in the 5' to 3' direction or in the 3' to 5' direction: Pr1-SM in Pr1 is the first promoter sequence, and SM is the selectable marker.

11. The method of any one of claims 1 to 10, wherein the first promoter is an ampicillin resistance (AmpR) promoter, a kanamycin resistance (KanR) promoter, a chloramphenicol resistance (CamR) promoter, an erythromycin resistance (ErmR) promoter, and a tetracycline resistance (TetR) promoter.

12. The method of any one of claims 1 to 11, wherein the selectable marker is AmpR, KanR, CamR, ErmR or TetR.

13. The method according to any one of claims 1 to 12, wherein the second expression unit comprises from 5' to 3' the following operably linked nucleic acid sequences: Pr2-5'UTR-nsP-SGP-GOI-3'UTR-PolyA in Pr2 is a second promoter sequence used for in vitro transcription, 5'UTR is the 5' untranslated region. nsP is a sequence of multiple nonstructural replicase domains. SGP is a subgenomic promoter. GOI is one or more target genes. 3′UTR is the 3′ untranslated region, and Poly-A is the 3' polyadenylation tail (poly-A tail).

14. The method of claim 13, wherein at least one gene of interest (GOI) encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, an antigen, or a non-coding gene encoding a regulatory structure.

15. The method of any one of claims 13 to 14, wherein the regulatory structure is selected from the group consisting of small interfering RNA (siRNA), micro RNA (miRNA), guide RNA (gRNA), self-activating RNA (saRNA), transfer RNA (tRNA) or long intergenic non-coding RNA (lincRNA).

16. The method of any one of claims 13 to 14, wherein at least one GOI encodes an infectious disease antigen, an allergy antigen or a tumor antigen.

17. The method of claim 13, wherein at least one GOI encodes a reporter gene.

18. The method of claim 17, wherein the reporter gene is green fluorescent protein (GFP).

19. The method of any one of claims 13 to 18, wherein the plurality of nonstructural replicase domain sequences are obtained from a Group 1V positive single-stranded RNA virus selected from the group consisting of Picornaviridae, Togaviridae, Coronaviridae, Hepaciviridae, Caliciviridae, Flaviviridae, and Astroviridae.

20. The method of any one of claims 13 to 19, wherein the plurality of nonstructural replicase domain sequences are obtained from an alphavirus selected from the group consisting of Eastern Equine Encephalitis Virus (EEE), Venezuelan Equine Encephalitis Virus (VEE), Everglades Virus, Mukambu Virus, Pichuna Virus, Western Equine Encephalitis Virus (WEE), Sindbis Virus, Semliki Forest Virus, Middleburg Virus, Chikungunya Virus, Anyang-Nyang Virus, Ross River Virus, Bama Forest Virus, Geta Virus, Lushan Virus, Bebaru Virus, Mayaro Virus, Una Virus, Ora Virus, Vodaro River Virus, Babanken Virus, Kuzilagachi Virus, Highland J Virus, Fort Morgan Virus, Ndumau Virus, and Boji River Virus.

21. The method of any one of claims 13 to 20, wherein the plurality of nonstructural replicase domain sequences are alphavirus nonstructural proteins 1-4 (nsP1-4).

22. The method of any one of claims 13 to 21, wherein the plurality of nonstructural replicase domain sequences are obtained from the TC-83 strain of Venezuelan equine encephalitis virus (VEE).

23. The method of any one of claims 1 to 22, wherein the second promoter is selected from the group consisting of T7, T3, SV40, SP6, T5, β-lactamase promoter, Escherichia coli galactose promoter, arabinose promoter, alkaline phosphatase promoter, tryptophan (trp) promoter, lactose operator (lac) promoter, lacUV5 promoter, trc promoter and tac promoter.

24. The method of any one of claims 1 to 23, wherein the nucleic acid further comprises one or more linkers.

25. The method of claim 24, wherein the nucleic acid sequence comprises from 5' to 3': a) Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA; b)L1-Ori-SM-Pr1-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA c)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-GOI-L4-3'UTR-PolyA; d)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-3'UTR-PolyA; or e) L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-SGP-L3-GOI-L4-3'UTR-PolyA, in L1 is the first connector. Ori is the replication origin sequence, SM is a selective marker. Pr1 is the first promoter sequence, L2 is the second connector. Pr2 is the second promoter sequence, 5′UTR is the 5′ untranslated region. nsP is a sequence of multiple nonstructural replicase domains. L3 is the third connector. SGP is a subgenomic promoter. GOI is one or more target genes. L4 is the fourth connector, 3′UTR is the 3′ untranslated region, and Poly-A is the 3' polyadenylation tail (poly-A tail).

26. The method of claim 25, wherein each of L1, L2, L3 and L4 is independently selected from the group consisting of CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT (SEQ ID NO: 43), CACATTTCCCCGAAAAGTGCCACCTGAGCTC (SEQ ID NO: 44), TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45) or CATCGATGATATCGCGGCCGCATACAGCAGC (SEQ ID NO: 46), or Wherein L1 comprises SEQ ID NO: 43 (CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCC AGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGT T); L2 contains SEQ ID NO: 44 (CACATTTCCCCGAAAAGTGCCACC TGAGCTC); L3 contains SEQ ID NO: 45 (TTCGAAGGCGCGCCTCTA GAGCCACC); and L4 contains SEQ ID NO: 46 (CATCGATGATATCGCGGCCGCATACAGCAGC).

27. A self-amplifying mRNA comprising the following nucleic acid sequence from 5′ to 3′: a)5'UTR-nsP-L-GOI-L-3'UTR-PolyA b)5'UTR-nsP-GOI-L-3'UTR-PolyA; c) 5'UTR-nsP-L-GOI-3'UTR-PolyA; or in 5'UTR is the 5' untranslated region. nsP is a sequence of multiple nonstructural replicase domains. L is the connector. SGP is a subgenomic promoter. GOI is one or more target genes. 3′UTR is the 3′ untranslated region, and Poly-A is the 3' polyadenylation tail (poly-A tail).

28. The self-amplifying mRNA of claim 27, wherein the GOI is an antigen or an antigen receptor.

29. The self-amplifying mRNA of any one of claims 27 to 28, wherein the GOI is a viral antigen.

30. The self-amplifying mRNA of any one of claims 27 to 29, wherein the GOI is a modified SARS-CoV-2 spike protein.

31. The self-amplifying mRNA of any one of claims 27 to 30, wherein the immunomodulator is a cytokine, chemokine or other immunostimulator or inhibitor.

32. The self-amplifying mRNA of any one of claims 27 to 31, comprising a polynucleotide sequence selected from the group consisting of: a) a polynucleotide encoding a modified SARS-CoV-2 spike protein, comprising the nucleic acid sequence shown in SEQ ID NO: 1 (BA.1-1273); b) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 2 (BA.1-1273-S2P); c) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 3 (BA.2-1273); d) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 4 (BA.2-1273-S2P); e) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 5 (BA.1-1208); or f) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 6 (BA.1-1208-S2P); g) a polynucleotide encoding a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 7 (BA.2-1208); or h) A polynucleotide encoding a modified SARS-CoV-2 spike protein, comprising the nucleic acid sequence shown in SEQ ID NO: 8 (BA.2-1208-S2P).

33. A self-amplifying mRNA encoding two separate expression units, the self-amplifying mRNA comprising: i) a first expression unit comprising a polynucleotide encoding a modified antigen, wherein the polynucleotide encoding the modified antigen is truncated to not include nucleotides encoding amino acids of the transmembrane domain and the short cytoplasmic domain of the antigen, the polynucleotide being operably linked to a first subgenomic promoter; and ii) a second expression unit encoding an immune modulator (IM) operably linked to a second subgenomic promoter.

34. The self-amplifying mRNA of claim 33, wherein the polynucleotide sequence encoding the modified antigen comprises replacement of the transmembrane domain of the antigen with a secretory antigen.

35. The self-amplifying mRNA of claim 33 or claim 34, wherein the antigen is a modified SARS-CoV-2 spike protein, wherein the polynucleotide has been truncated to not include nucleotides encoding amino acids for the SARS-CoV-2 transmembrane domain and the short cytoplasmic domain.

36. The self-amplifying mRNA of any one of claims 33 to 35, wherein the polynucleotide sequence encoding the coronavirus spike protein truncated to not include nucleotides encoding the SARS-CoV-2 transmembrane domain and short cytoplasmic domain amino acids corresponding to amino acids 1209-1273 of the nucleotide sequence is SEQ ID NO: 1 (BA.1-1273) or SEQ ID NO: 3 (BA.2-1273).

37. The self-amplifying mRNA of any one of claims 33 to 36, wherein the sa-mRNA comprises the following operably linked nucleic acid sequence from 5′ to 3′: nsP-SGP1-Ag-SGP2-IM in nsP is a sequence of multiple nonstructural replicase domains. SGP1 is the first subgenomic promoter, Ag is a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208) or SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208) or SEQ ID NO: 8 (BA.2-1208-S2P), SGP2 is the second subgenomic promoter, and IM is the immune modulator.

38. The self-amplifying mRNA of any one of claims 33 to 36, wherein the sa-mRNA comprises the following operably linked nucleic acid sequence from 5′ to 3′: nsP-SGP1-IM-SGP2-AG in nsP is a sequence of multiple nonstructural replicase domains. SGP 1 is the first subgenomic promoter, IM is the immune modulator, SGP2 is the second subgenomic promoter, and Ag is a nucleotide sequence selected from the following: SEQ ID NO: 1 (BA.1-1273), SEQ ID NO: 2 (BA.1-1273-S2P), SEQ ID NO: 3 (BA.2-1273) and SEQ ID NO: 4 (BA.2-1273-S2P), SEQ ID NO: 5 (BA.1-1208) or SEQ ID NO: 6 (BA.1-1208-S2P), SEQ ID NO: 7 (BA.2-1208) or SEQ ID NO: 8 (BA.2-1208-S2P).

39. The self-amplifying mRNA of any one of claims 33 to 38, wherein the IM encodes one or more cytokines, chemokines, immune stimulators or inhibitors.

40. The self-amplifying mRNA of any one of claims 33 to 39, wherein the IM is IL12 or IL21.

41. The self-amplifying mRNA of any one of claims 33 to 40, wherein the IM encodes one or more cytokines selected from the group consisting of SEQ ID NO: 22 (hIL12-P40), SEQ ID NO: 24 (hIL12-P35), SEQ ID NO: 26 (hL21), SEQ ID NO: 15 (mIL12P40), SEQ ID NO: 17 (mIL12-P35) and SEQ ID NO: 19 (mL21).

42. The self-amplifying mRNA of any one of claims 33 to 41, wherein SGP 1 is SEQ ID NO: 9 (SGP 1) (TAACCTGAATGGACTACGACATAGTCTAGTCCGCCAAG).

43. The self-amplifying mRNA of any one of claims 33 to 42, wherein SGP2 is SEQ ID NO: 11 (SGP2) 44. The self-amplifying mRNA of any one of claims 33 to 43, wherein IM is selected from SEQ ID NO: 13 (IM1) and SEQ ID NO: 20 (IM2).

45. The self-amplifying mRNA of any one of claims 33 to 44, comprising from 5′ to 3′ the following operably linked nucleic acid sequence: SP-IL12 P40-L1-IL12 P35-L2-IL21 in SP is a signal peptide. IL12-P40 is interleukin-12 containing the heavy chain p40. L1 is connector 1, IL12 P35 is interleukin-12 containing the light chain p35. L2 is connector 2, and IL21 is interleukin-21.

46. ​​The self-amplifying mRNA of any one of claims 33 to 45, wherein SP is selected from SEQ ID NO: 14 (MSP) (ATGACCTCCCGGCTTGTGAGGGTACTGGCTGCTGCTATGCTGGTGGCTGCTGCTGTGAGTGTGGC) and SEQ ID NO: 21 (HSP) 47. The self-amplifying mRNA of any one of claims 33 to 46, wherein IL12-P40 is selected from the group consisting of SEQ ID NO: 15 (mIL12-P40) and SEQ ID NO: 22 (hIL12-P40).

48. The self-amplifying mRNA of any one of claims 33 to 47, wherein L1 is selected from SEQ ID NO: 16 (L(a)) and SEQ ID NO: 23 (L(c)).

49. The self-amplifying mRNA of any one of claims 33 to 48, wherein IL12-P35 is selected from the group consisting of SEQ ID NO: 17 (mIL12-P35) and SEQ ID NO: 24 (hIL12-P35).

50. The self-amplifying mRNA of any one of claims 33 to 49, wherein L2 is selected from SEQ ID NO: 18 (L(b)) and SEQ ID NO: 25 (L(d)).

51. The self-amplifying mRNA of any one of claims 33 to 50, wherein IL12-P40 is selected from SEQ ID NO: 19 (mIL21) and SEQ ID NO: 26 (hIL21).

52. The self-amplifying mRNA of any one of claims 33 to 51, wherein the plurality of non-structural replicase domain sequences are obtained from a Group IV RNA virus selected from the family Picornaviridae, Togaviridae, Coronaviridae, Hepaciviridae, Caliciviridae, Flaviviridae, or Astroviridae.

53. The self-amplifying mRNA of any one of claims 33 to 52, wherein the plurality of nonstructural replicase domain sequences are obtained from an alphavirus selected from the group consisting of Eastern Equine Encephalitis Virus (EEE), Venezuelan Equine Encephalitis Virus (VEE), Everglades Virus, Mukambu Virus, Pichuna Virus, Western Equine Encephalitis Virus (WEE), Sindbis Virus, Semliki Forest Virus, Middleburg Virus, Chikungunya Virus, Anyang-Nyang Virus, Ross River Virus, Bama Forest Virus, Geta Virus, Lushan Virus, Bebaru Virus, Mayaro Virus, Una Virus, Ora Virus, Vodaro River Virus, Babanken Virus, Kuzilagachi Virus, Highland J Virus, Fort Morgan Virus, Ndumau Virus, or Boji River Virus.

54. The self-amplifying mRNA of any one of claims 33 to 53, wherein the plurality of non-structural replicase domain sequences are alphavirus non-structural proteins 1-4 (nsP 1-4).

55. The self-amplifying mRNA of any one of claims 33 to 54, wherein the plurality of non-structural replicase domain sequences are obtained from the TC-83 strain of Venezuelan equine encephalitis virus (VEE).

56. The self-amplifying mRNA of any one of claims 33 to 55, wherein SGP 1 is a viral promoter recognized by a viral RNA-dependent RNA polymerase.

57. The self-amplifying mRNA of any one of claims 33 to 56, wherein SGP2 is a viral promoter recognized by a viral RNA-dependent RNA polymerase.

58. The self-amplifying mRNA of any one of claims 33 to 57, wherein SGP1 and SGP2 are different subgenomic promoters.

59. The self-amplifying mRNA of any one of claims 33 to 58, wherein the sa-mRNA further comprises one or more linkers.

60. The self-amplifying mRNA of any one of claims 33 to 59, wherein the linker is selected from the group consisting of SEQ ID NO: 16 (L(a)), SEQ ID NO: 18 (L(b)), SEQ ID NO: 23 (L(c)) and SEQ ID NO: 25 (L(d)).

61. A composition comprising the self-amplifying mRNA of any one of claims 33 to 60 and a pharmaceutically acceptable carrier.

62. The composition of claim 61, further comprising a self-amplifying mRNA delivery system.

63. The composition of claim 62, wherein the self-amplifying mRNA delivery system is a lipid nanoparticle.

64. A method of expressing a gene in a cell, comprising delivering the self-amplifying mRNA of any one of claims 33 to 60 to the cell, and maintaining the cell under conditions suitable for expression of the gene encoded by the GOI.

65. The method of claim 64, wherein the cell is in an animal cell.

66. A method for producing self-amplifying mRNA, the method comprising: a) using an initial amount of the nucleic acid produced by the method of any one of claims 1 to 27 to carry out an in vitro transcription reaction; as well as b) generating self-amplifying mRNA by in vitro transcription using said nucleic acid as template.

67. A method of inducing an immune response in an individual, comprising administering to the individual the sa-mRNA produced by the method of claim 66.

68. A nucleic acid encoding a self-amplifying mRNA, comprising a mutant T7 promoter, wherein the mutant T7 promoter comprises the nucleotide sequence of SEQ ID NO: 47 (TAATACGACTCACTATAGG), wherein the nucleotide sequence is operably linked to a 5′UTR, multiple non-structural replicase domain sequences, one or more target genes (GOI), a 3′UTR and a poly-A tail.

69. The nucleic acid of claim 68, wherein the 5'UTR comprises the nucleotide sequence ATAGG.

70. The nucleic acid of any one of claims 68 to 69, comprising SAM002 (SEQ ID NO: 36).

71. A nucleic acid as described in any one of claims 68 to 70, wherein the nucleic acid further comprises one or more linkers.

72. A nucleic acid as described in any one of claims 68 to 71, which comprises the following nucleic acid sequence from 5' to 3': a) Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA; b)L1-Ori-SM-Pr1-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA c)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-GOI-L4-3'UTR-PolyA; d)L1-Ori-SM-Prl-L2-Pr2-5'UTR-nsP-L3-GOI-3'UTR-PolyA; or e)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-SGP-L3-GOI-L4-3'UTR-PolyA, in L1 is the first connector. Ori is the replication origin sequence, SM is a selective marker. Pr1 is the first promoter sequence, L2 is the second connector. T7′ is a mutant T7 promoter of SEQ ID NO: 47 (TAATACGACTCACTATAGG), The 5′UTR′ is a mutant 5′ untranslated region of ATAGG. nsP is a sequence of multiple nonstructural replicase domains. L3 is the first connector. SGP is a subgenomic promoter. GOI is one or more target genes. L4 is the second connector. 3′UTR is the 3′ untranslated region, and Poly-A is the 3' polyadenylation tail (poly-A tail).

73. A nucleic acid as described in any one of claims 68 to 72, wherein each of L1, L2, L3 and L4 is independently selected from a nucleic acid sequence comprising CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT (SEQ ID NO: 43), CACATTTCCCCGAAAAGTGCCACCTGAGCTC (SEQ ID NO: 44), TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45) or CATCGATGATATCGCGGCCGCATACAGCAGC (SEQ ID NO: 46), or wherein L1 comprises SEQ ID NO: 43 (CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT); L2 comprises SEQ ID NO: 44 (CACATTTCCCCGAAAAGTGCCACCTGAGCTC); L3 comprises SEQ ID NO:45 (TTCGAAGGCGCGCCTCTAGAGCCACC); and L4 comprises SEQ ID NO:46 (CATCGATGATATCGCGGCCGCATACAGCAGC).

74. A nucleic acid as described in any one of claims 68 to 73, wherein the first promoter is an ampicillin resistance (AmpR) promoter, a kanamycin resistance (KanR) promoter, a chloramphenicol resistance (CamR) promoter, an erythromycin resistance (ErmR) promoter, or a tetracycline resistance (TetR) promoter.

75. The nucleic acid of any one of claims 68 to 74, wherein the selectable marker is AmpR, KanR, CamR, ErmR or TetR.

76. The nucleic acid of any one of claims 68 to 75, wherein at least one gene of interest (GOI) encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, an antigen, an antigen receptor, or a non-coding gene encoding a regulatory structure.

77. The nucleic acid of claim 76, wherein the regulatory structure is selected from the group consisting of small interfering RNA (siRNA), micro RNA (miRNA), self-activating RNA (saRNA), transfer RNA (tRNA), long intergenic non-coding RNA (lincRNA).

78. The nucleic acid of any one of claims 68 to 77, wherein at least one GOI encodes an infectious disease antigen, an allergy antigen, or a tumor antigen.

79. The nucleic acid of any one of claims 68 to 78, wherein at least one GOI encodes a reporter gene.

80. The nucleic acid of claim 79, wherein the reporter gene is green fluorescent protein (GFP).

81. The nucleic acid of any one of claims 68 to 80, wherein the plurality of nonstructural replicase domain sequences are obtained from a Group IV RNA virus selected from the group consisting of Picornaviridae, Togaviridae, Coronaviridae, Hepaciviridae, Caliciviridae, Flaviviridae, and Astroviridae.

82. The nucleic acid of any one of claims 68 to 81, wherein the plurality of nonstructural replicase domain sequences are obtained from an alphavirus selected from the group consisting of Eastern Equine Encephalitis Virus (EEE), Venezuelan Equine Encephalitis Virus (VEE), Everglades Virus, Mukambu Virus, Pichuna Virus, Western Equine Encephalitis Virus (WEE), Sindbis Virus, Semliki Forest Virus, Middleburg Virus, Chikungunya Virus, Anyang-Nyang Virus, Ross River Virus, Bama Forest Virus, Geta Virus, Lushan Virus, Bebaru Virus, Mayaro Virus, Una Virus, Ora Virus, Vodaro River Virus, Babanken Virus, Kuzilagachi Virus, Highland J Virus, Fort Morgan Virus, Ndumau Virus, and Boji River Virus.

83. The nucleic acid of any one of claims 68 to 82, wherein the plurality of nonstructural replicase domain sequences are alphavirus nonstructural proteins 1-4 (nsP1-4).

84. The nucleic acid of any one of claims 68 to 83, wherein the plurality of nonstructural replicase domain sequences are obtained from the TC-83 strain of Venezuelan equine encephalitis virus (VEE).

85. A method for producing self-amplifying mRNA, the method comprising: a) using an initial amount of a nucleic acid as claimed in any one of claims 68 to 84 to carry out an in vitro transcription reaction; as well as b) generating self-amplifying mRNA by in vitro transcription using said nucleic acid as template.

86. The method of claim 85, wherein the amount of self-amplifying mRNA produced by a mutant T7 promoter containing SEQ ID NO: 47 (TAATACGACTCACTATAGG) and a mutant 5' untranslated region of ATAGG is increased by at least 40% compared to the amount of self-amplifying mRNA produced from a nucleic acid template having a wild-type T7 promoter and 5'UTR.

87. A composition comprising the self-amplifying mRNA produced by the method of claim 85 and a pharmaceutically acceptable carrier.

88. The composition of claim 87, further comprising a self-amplifying mRNA delivery system.

89. The composition of claim 88, wherein the self-amplifying mRNA delivery system is a nanoparticle composition.

90. A method of expressing a gene encoded by a GOI in a cell, comprising delivering the self-amplifying mRNA produced by the method of claim 85 or claim 86 to a cell, and allowing the cell to express the gene encoded by the GOI.

91. The method of claim 90, wherein the cell is in an animal cell.

92. A method of inducing an immune response in an individual comprising administering to the individual self-amplifying mRNA produced by the method of claim 85 or claim 86.

93. A nucleic acid encoding a self-amplifying mRNA, comprising: a) a mutant 3'UTR of an alphavirus, comprising a point mutation at position 6 of a conserved 19-nucleotide sequence GGATTTTGTTTTTAATATTTC (SEQ ID NO: 49) relative to a wild-type 3'UTR of an alphavirus; c) a mutant 3'UTR of an alphavirus comprising point mutations at positions -1 and -2 of a conserved 19-nucleotide sequence GGATTTTGTTTTTAATATTTC (SEQ ID NO: 49) relative to the wild-type 3'UTR of the alphavirus; c) a mutant 3'UTR of an alphavirus comprising point mutations at positions -1, -2 and 6 of a conserved 19-nucleotide sequence GGATTTTGTTTTTAATATTTC (SEQ ID NO: 49) relative to the wild-type 3'UTR of the alphavirus; d) a mutant 3'UTR of an alphavirus comprising a sequence selected from the group consisting of GGATTTTATTTTTAATATTTC (SEQ ID NO: 50), AAATTTTGTTTTTAATATTTC (SEQ ID NO: 51), or AAATTTTATTTTTAATATTTC (SEQ ID NO: 52); or e) a promoter operably linked to a 5'UTR, a plurality of nonstructural replicase domain sequences, one or more genes of interest (GOI), the mutant 3'UTR of any one of SEQ ID NOs: 49-52, and a poly-A tail.

94. The nucleic acid of claim 93, comprising a sequence selected from the group consisting of SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), SAM006 (SEQ ID NO: 40).

95. The nucleic acid of claim 94, wherein the nucleic acid further comprises one or more linkers.

96. A nucleic acid as described in any one of claims 93 to 95, wherein the nucleic acid sequence comprises from 5' to 3': a) Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA; b)L1-Ori-SM-Prl-Pr2-5'UTR-nsP-L3-GOI-L4-3'UTR-PolyA c)L1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-GOI-L4-3'UTR-PolyA; d)L 1-Ori-SM-Prl-L2-Pr2-5'UTR-nsP-L3-GOI-3'UTR-PolyA; or e) L 1-Ori-SM-Pr1-L2-Pr2-5'UTR-nsP-SGP-L3-GOI-L4-3'UTR-PolyA, in, L1 is the first connector. Ori is the replication origin sequence, SM is a selective marker. Pr1 is the first promoter sequence, L2 is the second connector. Pr2 is the second promoter sequence, 5'UTR is the 5' untranslated region. nsP is a sequence of multiple nonstructural replicase domains. SGP is a subgenomic promoter. L3 is the first connector. GOI is one or more target genes. L4 is the second connector. 3′UTR′ is a mutant 3′ untranslated region, and Poly-A is the 3′ polyadenylation tail (poly-A tail), wherein the 3′UTR′ is: a) a mutant 3′UTR of an alphavirus comprising GGATTTTATTTTTAATATTTC (SEQ ID NO: 50); b) a mutant 3′UTR of an alphavirus comprising AAATTTTGTTTTTAATATTTC (SEQ ID NO: 51); or c) A mutant 3'UTR of an alphavirus comprising AAATTTTATTTTTAATATTTC (SEQ ID NO: 52).

97. The nucleic acid of claim 96, wherein each of L1, L2, L3 and L4 is independently selected from a nucleic acid sequence comprising CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT (SEQ ID NO: 43), CACATTTCCCCGAAAAGTGCCACCTGAGCTC (SEQ ID NO: 44), TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45) or CATCGATGATATCGCGGCCGCATACAGCAGC (SEQ ID NO: 46), or wherein L1 comprises SEQ ID NO: 43 (CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT); L2 comprises SEQ ID NO: 44 (CACATTTCCCCGAAAAGTGCCACCTGAGCTC); L3 comprises SEQ ID NO: 45 NO:45 (TTCGAAGGCGCGCCTCTAGAGCCACC); and L4 comprises SEQ ID NO:46 (CATCGATGATATCGCGGCCGCATACAGCAGC).

98. A nucleic acid as described in any one of claims 96 to 97, wherein the first promoter is an ampicillin resistance (AmpR) promoter, a kanamycin resistance (KanR) promoter, a chloramphenicol resistance (CamR) promoter, an erythromycin resistance (ErmmR) promoter, and a tetracycline resistance (TetR) promoter.

99. The nucleic acid of any one of claims 96 to 98, wherein the selectable marker is AmpR, KanR, CamR, ErmR or TetR.

100. The nucleic acid of any one of claims 96 to 99, wherein at least one gene of interest (GOI) encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, an antigen, or a non-coding gene encoding a regulatory structure.

101. The nucleic acid of claim 100, wherein the regulatory structure is selected from the group consisting of small interfering RNA (siRNA), micro RNA (miRNA), self-activating RNA (saRNA), transfer RNA (tRNA), long intergenic noncoding RNA (lincRNA).

102. The nucleic acid of claim 101, wherein at least one GOI encodes an infectious disease antigen, an allergy antigen, or a tumor antigen.

103. The nucleic acid of any one of claims 96 to 102, wherein at least one GOI encodes a reporter gene.

104. The nucleic acid of claim 103, wherein the reporter gene is green fluorescent protein (GFP).

105. The nucleic acid of any one of claims 96 to 104, wherein the plurality of nonstructural replicase domain sequences are obtained from a Group IV RNA virus selected from the group consisting of Picornaviridae, Togaviridae, Coronaviridae, Hepaciviridae, Caliciviridae, Flaviviridae, and Astroviridae.

106. The nucleic acid of any one of claims 96 to 105, wherein the plurality of nonstructural replicase domain sequences are obtained from an alphavirus selected from the group consisting of Eastern Equine Encephalitis Virus (EEE), Venezuelan Equine Encephalitis Virus (VEE), Everglades Virus, Mukambu Virus, Pichuna Virus, Western Equine Encephalitis Virus (WEE), Sindbis Virus, Semliki Forest Virus, Middleburg Virus, Chikungunya Virus, Anyang-Nyang Virus, Ross River Virus, Bama Forest Virus, Geta Virus, Lushan Virus, Bebaru Virus, Mayaro Virus, Una Virus, Ora Virus, Vodaro River Virus, Babanken Virus, Kuzilagachi Virus, Highland J Virus, Fort Morgan Virus, Ndumau Virus, and Boji River Virus.

107. The nucleic acid of any one of claims 96 to 106, wherein the plurality of nonstructural replicase domain sequences are alphavirus nonstructural proteins 1-4 (nsP 1-4).

108. The nucleic acid of any one of claims 96 to 107, wherein the plurality of nonstructural replicase domain sequences are obtained from the TC-83 strain of Venezuelan equine encephalitis virus (VEE).

109. A method for producing self-amplifying mRNA, the method comprising: a) using an initial amount of a nucleic acid as claimed in any one of claims 96 to 108 to carry out an in vitro transcription reaction; as well as b) generating self-amplifying mRNA by in vitro transcription using said nucleic acid as template.

110. A composition comprising the self-amplifying mRNA produced by the method of claim 109 and a pharmaceutically acceptable carrier.

111. The composition of claim 110, further comprising a self-amplifying mRNA delivery system.

112. The composition of claim 111, wherein the self-amplifying mRNA delivery system is a lipid nanoparticle.

113. A method of expressing a gene encoded by a GOI in a cell, comprising delivering a self-amplifying mRNA produced by the method of claim 109, and maintaining the cell under conditions suitable for expression of the gene encoded by the GOI.

114. The method of claim 113, wherein the cell is an animal cell.

115. A method of inducing an immune response in an individual comprising administering to the individual the self-amplifying mRNA produced by the method of claim 109.

116. A method of reducing the interferon response of a host cell compared to the interferon response of a host cell introduced with a self-amplifying mRNA comprising a wild-type 3'UTR of an alphavirus, comprising introducing into the host cell the self-amplifying mRNA produced by the method of claim 109.

117. The method of claim 116, wherein the interferon response of the host cell is 1 / 2, 1 / 3, 1 / 4, 1 / 5 or 1 / 6 times the amount of the interferon response of the host cell to the introduction of a self-amplifying mRNA containing a wild-type 3'UTR of an alphavirus.

118. A method for de novo synthesis of a construct for preparing a self-amplifying nucleic acid, comprising: a) contacting an Escherichia coli cell with a nucleic acid encoding two expression units, said nucleic acid comprising: i) Origin of replication sequence (Ori); ii) a first expression unit encoding a first nucleotide sequence operably linked to a first promoter for expressing a selectable marker; as well as iii) a second expression unit encoding a second nucleotide sequence operably linked to a second promoter for in vitro transcription of the self-amplifying nucleic acid, wherein the first expression unit encodes a selectable marker, and the second expression unit encodes a self-amplifying nucleic acid; b) selecting Escherichia coli cells expressing the selectable marker; as well as c) subculturing the selected Escherichia coli cells to obtain an Escherichia coli cell population expressing the selective marker; d) allowing the cell population to proliferate; as well as e) performing in vitro transcription on the second expression unit to produce the self-amplifying nucleic acid.

119. A polynucleotide encoding: i) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 1 (BA.1-1273); j) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 2 (BA.1-1273-S2P); k) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 3 (BA.2-1273); 1) A modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 4 (BA.2-1273-S2P); m) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 5 (BA.1-1208); n) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 6 (BA.1-1208-S2P); o) a modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 7 (BA.2-1208); or p) A modified SARS-CoV-2 spike protein comprising the nucleic acid sequence shown in SEQ ID NO: 8 (BA.2-1208-S2P).

120. A method for preparing a library of self-amplified mRNAs derived from reference self-amplified mRNAs, comprising: (i) performing directed evolution of a reference self-amplified mRNA sample, comprising the following steps: (a) delivering a reference self-amplified mRNA sample encoding a selectable marker into a host cell, (b) culturing the host cell for a period of time and under conditions requiring replication of the reference self-amplifying mRNA sample and allowing expression of the selectable marker, wherein a mutation occurs in the replicated self-amplifying mRNA compared to the reference self-amplifying mRNA, (c) selecting cells expressing the selectable marker; and (ii) extracting the replicated self-amplifying mRNA from the host cell, and sequencing the replicated self-amplifying mRNA; A library of self-amplified mRNA sequences is thereby generated.

121. The method of claim 120, wherein the selectable marker is an antibiotic resistance gene.

122. The method of any one of claims 120 to 121, wherein the selectable marker is a puromycin resistance gene.

123. The method of any one of claims 120 to 122, wherein the reference self-amplifying mRNA is delivered into a host cell using a delivery mechanism.

124. The method of claim 123, wherein the delivery system is a lipid nanoparticle.

125. The method of any one of claims 120 to 124, wherein the reference self-amplified mRNA is selected from the group consisting of: SEQ ID NOs. 1-8 and SEQ ID NOs. 35-42.

126. The method of any one of claims 120 to 125, wherein the conditions requiring replication of the reference self-amplified mRNA sample and allowing expression of the selectable marker are an antibiotic-containing culture environment.

127. The method of any one of claims 120 to 126, wherein the concentration of the antibiotic affects the mutation rate of the reference self-amplifying mRNA.

128. A method for evaluating mutations in a replicated self-amplifying mRNA produced by the method of any one of claims 120 to 127, the method comprising: (i) obtaining a set of contig sequences comprising mutations compared to a reference self-amplified mRNA sample; (ii) sequencing the contig sequences; as well as (iii) determining the number of mutations in the contig sequence compared to the reference self-amplified mRNA.

129. The method of claim 128, wherein the contig sequences are fragments of the replicated self-amplifying mRNA.

130. The method of claim 128, wherein the contig sequence is SEQ ID NO:

27.

131. The method of claim 128, wherein the contig sequence is SEQ ID NO:

28.

132. The method of claim 128, wherein the contig sequence is SEQ ID NO:

29.

133. The method of claim 128, wherein the contig sequence is SEQ ID NO:

30.

134. The method of claim 128, wherein the contig sequence is SEQ ID NO:

31.

135. The method of claim 128, wherein the contig sequence is SEQ ID NO:

32.

136. The method of claim 128, wherein the contig sequence is SEQ ID NO:

33.

137. The method of claim 128, wherein the contig sequence is SEQ ID NO:

34.

138. A method of identifying a self-amplifying mRNA with reduced cytotoxic effects as part of a therapeutic product, comprising: (i) obtaining a panel comprising a plurality of self-amplifying mRNAs; (ii) quantifying the relative gene product expression of each self-amplified mRNA over a period of time; as well as (iii) identifying a self-amplifying mRNA that exhibits stable gene product expression over the period of time compared to other self-amplifying mRNAs in the set; Wherein the self-amplifying mRNA showing sustained gene product expression over the period of time shows reduced cytotoxic effects as part of a therapeutic product compared to other self-amplifying mRNAs of the panel.

139. The method of claim 138, wherein the period of time is between 12 hours and 10 days.

140. The method of any one of claims 138 to 139, wherein the period of time is 1 day.

141. The method of any one of claims 138 to 140, wherein the self-amplifying mRNA that exhibits sustained gene product expression over the period of time exhibits less than a 20-fold change in expression.

142. A therapeutic product comprising SAM002 (SEQ ID NO: 36), wherein the therapeutic product exhibits reduced cytotoxic effects as a portion of the therapeutic product compared to a therapeutic product comprising SAM001 (SEQ ID NO: 35).

Images