Application of KAT5 inhibitor in medicine for treating cancer and medicine for treating endometrial cancer

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of a KAT5 inhibitor in a medicine for treating cancer and a medicine for treating endometrial cancer. According to the application of the KAT5 inhibitor in the medicine for treating the cancer, the KAT5 inhibitor is applied to the medicine for treating the cancer. According to the application, the KAT5 inhibitor is applied to a medicine for treating cancers, and the small-molecule KAT5 inhibitor can realize antitumor activity by inducing cell DNA damage accumulation. In addition, the KAT5 inhibitor can significantly inhibit the growth of cancer cells in vitro and in vivo. Through verification experiments, the anti-tumor effect of the KAT5 inhibitor is defined for the first time, and the KAT5 inhibitor has important medical development value and market benefits.

Description

Technical Field

[0001] The present application belongs to the field of biomedicine technology, and in particular relates to the use of a KAT5 inhibitor in a drug for treating cancer, and a drug for treating endometrial cancer. Background Art

[0002] Endometrial cancer accounts for 20% to 30% of female reproductive tract malignancies. There are approximately 142,000 new cases and 42,000 deaths worldwide each year. In recent years, the incidence rate in Asia has shown a significant increase and a trend of younger age. The clinical manifestations of endometrial cancer are mainly postmenopausal bleeding. The local symptoms of some advanced endometrial cancers are mainly abdominal distension, abdominal pain, urination and intestinal dysfunction. At present, the diagnosis of endometrial cancer mainly relies on histological examination of endometrial tissue samples, but this invasive examination is only suitable for patients with endometrial pathology or endometrial thickening on transvaginal ultrasound scans. For the vast majority of menopausal women, the positive rate and predictive rate of histological examinations are low, so most women still need additional examination methods to exclude significant cancer changes.

[0003] The treatment of endometrial cancer is a comprehensive treatment with surgery as the main treatment and chemotherapy as the auxiliary treatment. Although patients who receive adjuvant chemotherapy can achieve a higher survival rate, the side effects of chemotherapy seriously affect the quality of life of patients. In recent years, targeted therapy and precision medicine have provided new approaches for the treatment of endometrial cancer. For example, patients with p53 (phosphoprotein 53) abnormal tumors benefit from targeted therapy, while patients with MMRD (Mismatch Repair Deficient) are expected to benefit from treatments such as carboplatin and paclitaxel. However, these treatment options are still in the research stage.

[0004] Currently, there is still a lack of effective treatments for cancer, especially endometrial cancer. Summary of the invention

[0005] The purpose of the present application is to provide an application of a KAT5 inhibitor in a drug for treating cancer, and a drug for treating endometrial cancer, aiming to solve the problem of the lack of effective methods for existing cancer treatments.

[0006] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0007] In a first aspect, the present application provides a use of a KAT5 inhibitor in a drug for treating cancer, including applying the KAT5 inhibitor to a drug for treating cancer.

[0008] In some possible implementations, the KAT5 inhibitor includes Nu9056.

[0009] In some possible implementations, the cancer includes endometrial cancer.

[0010] In some possible implementations, the KAT5 inhibitor inhibits the growth of cancer cells by inducing accumulation of DNA damage in cancer cells.

[0011] In some possible implementations, the KAT5 inhibitor is used to regulate the levels of γ-H2AX and RAD51 proteins in endometrial cancer cells.

[0012] In some possible implementations, the KAT5 inhibitor is used to induce accumulation of γ-H2AX protein levels in endometrial cancer cells while inhibiting RAD51 protein expression.

[0013] In some possible implementations, the treatment of cancer with the KAT5 inhibitor includes in vitro treatment and in vivo treatment.

[0014] In some possible implementations, the KAT5 inhibitor has an inhibition rate of no less than 23% on endometrial cancer cells.

[0015] In a second aspect, an embodiment of the present application provides a drug for treating endometrial cancer, comprising a KAT5 inhibitor and an excipient.

[0016] In some possible implementations, the KAT5 inhibitor includes Nu9056.

[0017] In some possible implementations, in the case of in vitro treatment, the effective concentration of the KAT5 inhibitor in the drug for treating endometrial cancer is 40 μM to 50 μM.

[0018] In some possible implementations, in the case of in vivo treatment, the effective concentration of the KAT5 inhibitor in the drug for treating endometrial cancer is 4 mM to 10 mM.

[0019] In some possible implementations, the dosage form of the drug for treating endometrial cancer includes an injection.

[0020] In some possible implementations, the auxiliary material includes at least one solvent selected from the group consisting of dimethyl sulfoxide, phosphate buffer, Tween-80, and glucose injection.

[0021] The first aspect of the present application provides the use of KAT5 inhibitors in cancer treatment drugs. The present application has found through research that knocking down KAT5 in cancer cells will inhibit the growth of cancer cells, so KAT5 can be used as a therapeutic target for cancer. KAT5 inhibitors are applied to drugs for the treatment of cancer. The small molecule KAT5 inhibitor can achieve anti-tumor activity by inducing accumulation of cellular DNA damage. Moreover, the KAT5 inhibitor can significantly inhibit the growth of cancer cells both in vitro and in vivo. Through verification experiments, the present application has clarified for the first time the effect of KAT5 inhibitors in anti-tumor, which has important medical development value and market benefits.

[0022] The drug for treating endometrial cancer provided in the second aspect of the present application contains a KAT5 inhibitor, which can induce the accumulation of γ-H2AX protein levels in endometrial cancer cells, while inhibiting RAD51 protein expression, inducing continuous accumulation of DNA damage in endometrial cancer cells, achieving anti-tumor activity, and thus treating endometrial cancer. Therefore, the drug for treating endometrial cancer in the present application has an excellent therapeutic effect on endometrial cancer, and has a significant effect of inhibiting the growth of endometrial cancer both in vitro and in vivo, and has important medical value and market benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 is a spectrum of the lentiviral knockdown vector PLKO.1-puro involved in the examples of the present application;

[0025] Figure 2 This is a test diagram of the effect of KAT5 knockdown on the growth status of ishikawa, HEC-1B and KLE cells in Example 2 of the present application;

[0026] Figure 3 This is a test diagram of the effect of KAT5 knockdown on the levels of three key proteins designed for DNA damage and repair, γ-H2AX, RAD51 and 53BP1, in ishikawa, HEC-1B and KLE cells in Example 3 of the present application;

[0027] Figure 4 This is a test diagram of the effect of different concentrations of Nu9056 on the viability of ishikawa cells in Example 4 of the present application;

[0028] Figure 5This is a graph showing the cumulative changes in DNA damage detected by WB in the ishikawa human endometrial cancer cell line after being treated with NU9056 (50uM) for 48h in Example 4 of the present application;

[0029] Figure 6 This is a test diagram of the effect of Nu9056 on the growth volume change of endometrial cancer cell xenograft tumors in nude mice in Example 5 of the present application;

[0030] Figure 7 This is a test graph of the effect of Nu9056 on the tumor weight of endometrial cancer cell xenografts in nude mice in Example 5 of the present application. DETAILED DESCRIPTION

[0031] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0032] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0033] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b or c", or "at least one of a, b and c", can all represent: a, b, c, ab (i.e. a and b), ac, bc, or abc, where a, b, c can be single or multiple, respectively.

[0034] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0035] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "an" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0036] The weight of the relevant components mentioned in the embodiments of the present specification can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components in the embodiments of the present specification is proportionally enlarged or reduced, it is within the scope disclosed in the embodiments of the present specification. Specifically, the mass described in the embodiments of the present specification can be μg, mg, g, kg and other mass units known in the chemical industry.

[0037] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0038] A first aspect of an embodiment of the present application provides a use of a KAT5 inhibitor in a drug for treating cancer, wherein the KAT5 inhibitor is applied to a drug for treating cancer.

[0039] The first aspect of the present application provides an application of a KAT5 inhibitor in a drug for treating cancer. The present application has found through research that knocking down KAT5 in cancer cells will inhibit the growth of cancer cells, and thus KAT5 can be used as a therapeutic target for cancer. The KAT5 inhibitor is applied to drugs for treating cancer. The small molecule KAT5 inhibitor can achieve anti-tumor activity by inducing accumulation of cellular DNA damage. Moreover, the KAT5 inhibitor can significantly inhibit the growth of cancer cells both in vitro and in vivo. The present application embodiment has clarified the anti-tumor effect of the KAT5 inhibitor for the first time through verification experiments, which has important pharmaceutical development value and market benefits.

[0040] It should be noted that the present application embodiment KAT5, also known as Tip60 (Tat-interactive protein, 60kDa), is a histone acetyltransferase (HAT) that plays a vital role in eukaryotes. It belongs to the MYST family (MOZ, Ybf2 / Sas3, Sas2, and Tip60), and members of this family all have acetyltransferase activity. KAT5 plays a key role in a variety of cell processes, including but not limited to DNA damage repair, cell cycle regulation, gene transcription regulation, and maintaining genome stability. Among them, DNA damage repair: KAT5 participates in the repair process of DNA double-strand breaks (DSBs), particularly non-homologous end joining (NHEJ) and homologous recombination (HR) pathways. It can promote these repair processes by acetylation of histones and other repair proteins. Cell cycle regulation: KAT5 affects the progression of the cell cycle by acetylation of specific cell cycle regulatory proteins, such as p53 and Chk2. These acetylation effects can affect the stability and activity of these proteins, thereby regulating cell proliferation and apoptosis. Gene transcription regulation: As an acetyltransferase, KAT5 can acetylate the lysine residues of histones H3 and H4, which helps to change the structure of chromatin, making it more open, thereby facilitating the binding of transcription factors and gene transcription. In addition, KAT5 can also directly acetylate transcription factors and other regulatory proteins, affecting their activity and function. Maintaining genome stability: By participating in DNA damage repair and cell cycle regulation, KAT5 helps maintain genome stability and prevents the mistransmission of genetic information and cell carcinogenesis.

[0041] The DNA damage repair (DDR) pathway of the present application embodiment is intended to protect cells from certain acquired genomes and monitor exogenous or endogenous DNA damage. Cytotoxic drugs targeting the DDR pathway have been used as anticancer treatments. The use of DNA damaging agents in combination with immune checkpoint inhibitors can enhance genomic instability and immunotherapeutic activity. For example, when exposed to chemotherapy and / or radiotherapy, DDR signals are activated by DSB. Excessive DNA damage can cause cancer cells to die, induce the release of DAMPs, and cause an immune response. Therefore, the DDR pathway and its changes have broad application prospects in cancer treatment.

[0042] In some possible implementations, the KAT5 inhibitor includes Nu9056. The KAT5 inhibitor NU9056 in the present embodiment is a compound with multiple biological activities, alias: 5-(1,2-Thiazol-5-yldisulfanyl)-1,2-thiazole, and the compound structure is CAS: 1450644-28-6; Molecular weight: 232.37; Molecular formula: C6H4N2S4. NU9056 is an effective and selective Tip60 (KAT5) histone acetyltransferase inhibitor. NU9056 is more than 16 times more selective for Tip60 than PCAF, p300 and GCN5. NU9056 can inhibit protein acetylation in cancer cells, reduce cell proliferation, prevent DNA damage repair, and induce cell apoptosis through cysteine ​​protease activation. Moreover, the KAT5 inhibitor NU9056 in the embodiment of the present application is a small molecule drug. The structure of small molecule drugs has good spatial dispersibility, and its chemical properties determine its good drugability and pharmacokinetic properties. Generally, it can be taken orally, which is widely used and convenient.

[0043] In some possible implementations, cancer includes endometrial cancer. In this case, the KAT5 inhibitor NU9056 can be applied to drugs for endometrial cancer. The present application found that Nu9056 can inhibit the growth of endometrial cancer cells, and its specific action relationship with endometrial cancer cells is through inducing the accumulation of DNA damage in endometrial cancer cells. At the same time, the key genes RAD51 and 53BP1 involved in the relevant pathways of DNA damage repair were also detected, and it was found that Nu9056 inhibited the protein expression of RAD51, thereby damaging the HR repair (Homologous Recombination Repair) pathway, resulting in the accumulation of DNA damage in cancer cells. In addition, the present application embodiment found in animal experiments that a drug containing the KAT5 inhibitor NU9056 alone can have a certain therapeutic effect. Given that its mechanism is to induce DNA damage in cancer cells, it does not require the help of related immune inducers to kill cancer cells. The treatment method of single medication in clinical practice can reduce the side effects of patients after treatment to a certain extent. The effect of KAT5 inhibitor NU9056 is independent of ER (Estrogen Receptor) expression. Nu9056 shows a killing effect on endometrial cancer cells regardless of whether ER is highly expressed or low expressed in endometrial cancer.

[0044] In some possible implementations, KAT5 inhibitors inhibit cancer cell growth by inducing the accumulation of DNA damage in cancer cells. The KAT5 inhibitor NU9056 in the present application embodiment has been experimentally confirmed to inhibit cancer cell growth by inducing the accumulation of DNA damage in cancer cells, thereby playing a role in treating endometrial cancer. This is a new mechanism for treating endometrial cancer that has not yet been disclosed. By combining immune checkpoint inhibitors, multiple treatment mechanisms can be used to enhance the effect of drug treatment.

[0045] In some possible implementations, KAT5 inhibitors are used to regulate the levels of γ-H2AX and RAD51 proteins in endometrial cancer cells, thereby inducing the continuous accumulation of DNA damage in endometrial cancer cells, thereby treating endometrial cancer.

[0046] In some possible implementations, KAT5 inhibitors are used to induce accumulation of γ-H2AX protein levels in endometrial cancer cells while inhibiting RAD51 protein expression. The KAT5 inhibitors of the present application induce accumulation of γ-H2AX protein levels in endometrial cancer cells while inhibiting RAD51 protein expression, thereby inducing continuous accumulation of DNA damage in endometrial cancer cells, thereby treating endometrial cancer.

[0047] In some possible implementations, the treatment of cancer by KAT5 inhibitors includes in vitro treatment and in vivo treatment. The KAT5 inhibitors in the present application embodiment achieve anti-tumor activity by inducing accumulation of DNA damage in cancer cells, and can significantly inhibit the growth of endometrial cancer in vitro and in vivo, and have important medical value and market benefits.

[0048] In some embodiments, a method for inducing cellular DNA damage in endometrial cancer in vitro using the KAT5 inhibitor NU9056 comprises the steps of contacting endometrial cancer cells in vitro with an effective concentration of a KAT5-specific small molecule targeted inhibitor, wherein the KAT5-specific small molecule targeted inhibitor comprises Nu9056.

[0049] In some possible implementations, the inhibition rate of the KAT5 inhibitor on endometrial cancer cells is not less than 23%. In this case, the KAT5 inhibitor has a high inhibition rate on endometrial cancer cells, high anti-tumor activity, and a good therapeutic effect on endometrial cancer.

[0050] In some embodiments, when the effective concentration of Nu9056 is 5 μM, the KAT5 inhibitor has an inhibition rate of no less than 23% at 48 hours and no less than 35% at 72 hours on endometrial cancer cells.

[0051] In some embodiments, when the effective concentration of Nu9056 is 10 μM, the KAT5 inhibitor has an inhibition rate of no less than 38% on endometrial cancer cells at 48 hours and no less than 38% at 72 hours.

[0052] In some embodiments, when the effective concentration of Nu9056 is 20 μM, the KAT5 inhibitor has an inhibition rate of no less than 48% on endometrial cancer cells at 48 hours and no less than 55% at 72 hours.

[0053] In some embodiments, when the effective concentration of Nu9056 is 30 μM, the KAT5 inhibitor has an inhibition rate of no less than 68% on endometrial cancer cells at 48 hours and no less than 70% at 72 hours.

[0054] In some embodiments, when the effective concentration of Nu9056 is 40 μM, the KAT5 inhibitor has an inhibition rate of no less than 81% on endometrial cancer cells at 48 hours and no less than 84% at 72 hours.

[0055] In some embodiments, when the effective concentration of Nu9056 is 50 μM, the KAT5 inhibitor has an inhibition rate of no less than 89% on endometrial cancer cells at 48 hours and no less than 90% at 72 hours.

[0056] In a second aspect, an embodiment of the present application provides a drug for treating endometrial cancer, comprising a KAT5 inhibitor and an excipient.

[0057] The drug for treating endometrial cancer provided in the embodiment of the present application contains a KAT5 inhibitor, which can induce the accumulation of γ-H2AX protein levels in endometrial cancer cells, while inhibiting the expression of RAD51 protein, inducing the continuous accumulation of DNA damage in endometrial cancer cells, achieving anti-tumor activity, and thus treating endometrial cancer. Therefore, the drug for treating endometrial cancer in the embodiment of the present application has an excellent therapeutic effect on endometrial cancer, and has a significant effect of inhibiting the growth of endometrial cancer both in vitro and in vivo, and has important medical value and market benefits.

[0058] In some possible implementations, the KAT5 inhibitor includes Nu9056. In this case, Nu9056 can effectively inhibit the growth of endometrial cancer cells by inducing the accumulation of DNA damage in endometrial cancer cells. Moreover, the use of drugs containing the KAT5 inhibitor NU9056 alone can have a certain therapeutic effect. Given that its mechanism is to induce DNA damage in cancer cells, it does not require the help of related immune inducers to kill cancer cells. Clinical single-drug treatment can reduce the side effects of patients after treatment to a certain extent. The effect of the KAT5 inhibitor NU9056 is independent of ER expression. Whether it is high or low expression of ER in endometrial cancer, Nu9056 shows a killing effect on endometrial cancer cells.

[0059] In some possible implementations, in the case of in vitro treatment, in the drug for treating endometrial cancer, the effective concentration of the KAT5 inhibitor is 40 μM to 50 μM. Exemplarily, the effective concentration of the KAT5 inhibitor in the drug can be 40 μM, 41 μM, 42 μM, 43 μM, 45 μM, 46 μM, 47 μM, 48 μM, 50 μM, etc., typical but non-limiting arbitrary point values ​​or the range between any two points. Under this effective concentration condition, the 48h growth inhibition rate of the KAT5 inhibitor for the treatment of endometrial cancer is not less than 80%, which can fully ensure the inhibitory effect of the KAT5 inhibitor on the growth of endometrial cancer, thereby ensuring the therapeutic effect on endometrial cancer.

[0060] In some possible implementations, in the case of in vivo treatment, in the drug for treating endometrial cancer, the effective concentration of the KAT5 inhibitor is 4mM to 10mM. Exemplarily, the effective concentration of the KAT5 inhibitor in the drug can be 4mM, 5mM, 6mM, 7mM, 8mM, 9mM, etc., typical but non-limiting arbitrary point values ​​or a range between any two points. Under this effective concentration condition, the growth inhibition rate of the KAT5 inhibitor on endometrial cancer is not less than 60%, which can fully ensure the inhibitory effect of the KAT5 inhibitor on the growth of endometrial cancer, thereby ensuring the therapeutic effect on endometrial cancer.

[0061] In some possible implementations, the dosage form of the drug for treating endometrial cancer includes an injection. In this case, the injection is usually dosed in milliliters or micrograms, so that the amount of the drug used can be accurate to the smallest unit, ensuring the accuracy of the medication. Compared with oral medications, injections can directly enter the blood circulation, avoiding the absorption and metabolism of oral medications in the gastrointestinal tract, and therefore take effect faster. In addition, the injection directly enters the blood circulation, which can avoid the first-pass effect (the first-pass effect refers to the phenomenon that the drug is partially metabolized or destroyed when passing through the intestinal mucosa and liver), thereby improving the bioavailability of the drug. And injections usually have better stability.

[0062] In some possible implementations, the excipients include at least one solvent selected from dimethyl sulfoxide (DMSO), phosphate buffer, Tween-80, and glucose injection. These solvents have a good dissolving effect on KAT5 inhibitors, and are convenient for making injections of specific concentrations according to actual application conditions, and are flexible and convenient to use. DMSO in the injection of the embodiment of the present application has solubility and permeability to many drugs, and it itself has anti-inflammatory, analgesic, blood circulation and wound healing effects, and has diuretic and antiseptic effects. It can increase drug absorption and improve efficacy. In addition, the local drug content in the lesion area can be increased to reduce the harm of other drugs in the body. Studies have found that the half-quantity LG50 value of DMSO is (22.4±1.4) g / kg, which is non-toxic and consistent with pathological anatomy. In animal experiments, the local drug concentration is 2 to 8 times higher than the concentration of other drugs, which can enhance the absorption capacity of drugs dissolved by DMSO. At the same time, DMSO has the ability to dissolve and penetrate the keratin of cancer tissue, improving the efficacy. The use of DMSO as a solvent in the injection of the present application example can increase the component content of the KAT5 inhibitor NU9056, thereby improving the efficacy.

[0063] In some embodiments, the solvent in the injection includes dimethyl sulfoxide, and when diluted for use, solvents such as phosphate buffer, Tween-80 (polysorbate 80 or polyoxyethylene sorbitan monooleate) and 5% glucose injection can be used.

[0064] In some embodiments, the original powder of KAT5 inhibitor NU9056 is fully dissolved in a solvent such as dimethyl sulfoxide and then divided for use. When used, it is diluted with PBS phosphate buffer or the like to a working solution of appropriate concentration to prepare an injection of a specific concentration.

[0065] In order to enable those skilled in the art to clearly understand the implementation details and operations of the present application, as well as to demonstrate the significant improvement in the performance of the KAT5 inhibitors in the examples of the present application in cancer treatment drugs and drugs for treating endometrial cancer, the above technical solutions are illustrated by multiple embodiments below.

[0066] The present invention studies the effect of knocking down KAT5 in endometrial cancer cells on inhibiting the growth of endometrial cancer cells, and verifies that KAT5 can be used as a therapeutic target for endometrial cancer. In addition, the anti-tumor activity of KAT5 inhibitor NU9056 on endometrial cancer in vivo and in vitro is verified. The details are as follows:

[0067] Example 1

[0068] The present application example is a method for constructing a PLKO.1-puro-KAT5-shRNA plasmid, taking a lentiviral knockdown vector and a packaged lentivirus as an example to illustrate the method for knocking down the KAT5 gene and protein in endometrial cancer. In the present application example, the PLKO.1-puro plasmid vector was purchased from addgene (https: / / www.addgene.org / ), and the spectrum is shown in Figure 1 .

[0069] In this embodiment, the method for constructing a viral knockdown vector containing the KAT5 gene comprises the following steps:

[0070] 1. Design of KAT5-shRNA sequence:

[0071] Referring to the shRNA design website (https: / / www.sigmaaldrich.cn / CN / zh / semi-configurators / shrna?activeLink=reviewAndConfirm), according to the target gene KAT5 and the species, the target sequence was determined to be CGTCCATTACATTGACTTCAA, i.e., the sense sequence, in the verified target sequence, and the antisense sequence (antisense sequence refers to the RNA sequence complementary to the target mRNA sequence) was inferred from it. AgeI and EcoRI were selected as the restriction sites of the PLKO.1-puro vector. According to the characteristics of constructing shRNA and the restriction sites of the vector, the template sequence was finally determined: 5'-CCGGCGTCCATTACATTGACTTCAATTCAAGAGATTGAAGTCAATGTAATGGACGTTTTTTGGTACC-3'; 3'-GCAGGTAATGTAACTGAAGTTAAGTTCTCTAACTTCAGTTACTAATGGAGCAAAAAACCATGGTTAA-5'. The above two oligos (oligonucleotides) were annealed after synthesis. Annealing step: the two oligos in equal molar ratio were mixed in annealing buffer (10mM Tris-HCl (pH7.5), 50mM NaCl and 1mM EDTA), heated to 100°C for 5 minutes, and then slowly cooled to room temperature 25°C to obtain a KAT5-shRNA double-stranded structure, followed by vector double enzyme digestion and ligation steps.

[0072] 2. Double digestion of lentiviral vector with AgeI and EcoRI:

[0073] AgeI restriction site: The AgeI restriction site is ACCGGT (or the reverse complementary sequence CCGGTT), which is a 6-base pair recognition sequence.

[0074] EcoRI restriction site: The EcoRI restriction site is GAATTC (or the reverse complementary sequence CTTA AG), which is also a 6-base pair recognition sequence.

[0075] Double enzyme digestion reaction system: 2ug (volume 2ul) vector, 1ul single endonuclease, 2ul 10×Fast Digest buffer (digestion buffer), 14ul deionized water, total volume 20ul;

[0076] Double enzyme digestion reaction program: 37°C, 20 minutes, add 1ul CIP (2-chloro-1,3-dimethylimidazolium hexafluorophosphate), 37°C, continue for 10 minutes. After the end of the enzyme digestion, the enzyme digestion product was purified using a PCR purification kit.

[0077] 3. Ligation of the digestion product and the target fragment:

[0078] Ligation reaction system: 10 μl buffer, 1 μl vector, 3-6 μl PCR product, 1 μl quic kligase (NEB, Cat: M2200), add deionized water to a total volume of 20 μl, and place at room temperature for 15 minutes to obtain a ligation product.

[0079] 4. Transformation of ligation products:

[0080] In the embodiment of the present application, after the connection, the connection product is preferably transformed into an Escherichia coli competent state to obtain a lentiviral knockdown vector connected to the KAT5 gene. The transformation method is carried out by a 42°C heat shock method. The screening culture is preferably carried out on an agarose plate of LB containing 100 μg / ml ampicillin antibiotics, and the screening culture temperature is preferably 36-38°C, more preferably 37°C, and the screening culture time is preferably 8-16h, more preferably 12h. After screening and culture, a single colony was picked for sequencing, and the sequencing results were analyzed: the comparison results showed that the PLKO.1-Puro-KAT5-shRNA sequencing results were consistent with the designed sequence.

[0081] 5. Lentivirus packaging:

[0082] In the examples of the present application, the method for packaging a lentivirus containing a KAT5-shRNA vector preferably comprises the following steps:

[0083] A. 293-T cells were trypsinized one day before transfection to obtain single-cell 293-T cells for further culture.

[0084] B. When the density of single-cell 293-T cells grows to 70% to 80%, a mixture of a lentiviral knockdown vector containing the KAT5-sh RNA gene, a lentiviral packaging vector (PPAX2, PMD2.G), a transfection reagent Lipofectamine 2000 Transfection Reagent (Thermo Scientific, USA) and Opti-MEM medium reduced serum medium was added for transfection; the lentiviral packaging process of the blank vector control was the same as above.

[0085] C8h after transfection, replace DMEM high-glucose complete medium (DMEM+10% FBS+1% P / S) and continue to culture. 48-72h after transfection, collect the culture medium, centrifuge at 500×g for 10min, collect the supernatant to obtain the lentiviral solution containing KAT5-shRNA gene. Dispense into 1.5ml EP tubes according to the amount of virus used each time and store at -80℃. The lentiviral treatment process of the blank vector control is the same as above.

[0086] 6. Construction of stable cell lines:

[0087] In the examples of the present application, the method for constructing a stably transfected cell line containing a KAT5-shRNA vector preferably comprises the following steps:

[0088] A. Resuscitate Ishikawa, HEC-1B and KLE cells, and subculture the cells when the cells grow to 80% to 90% density, and subculture them 2 to 3 times in a row.

[0089] B. Culture Ishikawa, HEC-1B and KLE cells, and digest and count the cells when the cells grow to 80% to 90%. 5 The cells were seeded into 6-well plates at a density of 10 cells / well.

[0090] C. After the cells adhered to the wall the next day, the lentivirus constructed in Example 1 and the blank vector control virus were added at an MOI of 50 (the lentivirus addition dose was 10 μl / 10 5 cell); and continue culturing in a 37°C, 5% CO2 incubator overnight.

[0091] D. 24 hours after the addition of virus, replace the medium with MEM (minimum essential medium) + 10% FBS (fetal bovine serum) + 1% P / S (penicillin / streptomycin) + 1% NEAA non-essential amino acids (ishikwa / HEC-1B) and DME M + 10% FBS + 1% P / S (KLE) complete medium.

[0092] 48 hours after the addition of virus E, puromycin was added at a final concentration of 2 μg / ml for drug screening for 48 to 72 hours.

[0093] F. When the drug screening of cells in the blank control group is complete, a KAT5 knockdown stable cell line is obtained.

[0094] Example 2

[0095] The present application example explores the in vitro anti-tumor activity of KAT5 knockdown stable transfection cell lines:

[0096] 1. Experimental method: Prestoblue method:

[0097] Human endometrial cancer cells Ishikawa and HEC-1B were cultured with MEM medium (containing 10% FBS, 1% P / S and 1% NEAA), and KLE (human endometrial cancer cells) were cultured with DMEM medium (containing 10% FBS, 1% P / S) at 5% CO2 and 37°C. Cells (ishikawa, HEC-1B and KLE) that had completed lentiviral infection were collected, the concentration of the cell suspension was adjusted, and the cell suspension was inoculated in a 96-well plate. The cells to be tested were plated to a density of about 1000 / well, 100 μL of cell suspension per well, and incubated at 5% CO2 and 37°C for 6 to 8 hours. Cell adhesion growth was observed under a microscope. Finally, the blank vector infection group was used as a blank control. The culture plate was continued to be placed in a 5% CO2, 37°C constant temperature incubator for culture. After 48 hours, the culture plate was removed, 10 μl of prestoblue (10×) solution was added to each well, and the culture was continued for 30 minutes to terminate the culture. Place in a 4°C low-temperature centrifuge and centrifuge at 5000 rpm for 10 min to completely eliminate the bubbles. Detect the absorbance of each well at 535-560 nm using an automatic microplate reader.

[0098] 2. Experimental results are as attached Figure 2 As shown, attached Figure 2 This is a test chart of the effect of KAT5 knockdown on the growth status of ishikawa, HEC-1B and KLE cells, where shKAT5 is the knockdown of KAT5, shCtrl is the control group without knockdown of KAT5, and the ordinate OD value is the optical density, corresponding to the cell concentration. The test results show that knockdown of KAT5 significantly inhibits the growth of ishikawa, HEC-1B and KLE human endometrial cancer cells.

[0099] Example 3

[0100] The present application example further explores the anti-tumor mechanism of knocking down KAT5:

[0101] Western blotting or immunoblotting analysis: After knocking down KAT5 in ishikawa, HEC-1B and KLE cells, proteins were extracted from the cells using RIPA buffer (Beyotime / Biyuntian) containing 1% PMSF (phenylmethylsulfonyl fluoride) and 1% protease and phosphatase inhibitor cocktail. The protein sample was repeatedly scraped with a cell brush and placed on ice for 10 minutes, shaken once every 5 minutes, and then centrifuged at 4°C and 12000 rpm for 10 minutes to collect the supernatant. Then, Pierce TM Protein concentration was quantified using Rapid Gold BCA Protein Assay Kit (Thermo Scientific, Waltham, MA, USA). 30 μg of protein was separated by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) at 120 V for 50 min and transferred to a 0.2 μm Immunoprecipitate plate. PVDF (polyvinylidene fluoride) membrane (Bio-Rad, Hercules, CA, USA). Then blocked with TBST (Tris-buffered saline with Tween 20) solution containing 5% skim milk at room temperature for 60 minutes. The PVDF membrane was incubated with primary antibody (1:1000) at 4°C overnight. After that, the membrane was washed 3 times with TBST for 10 minutes each time, and incubated with secondary antibody (1:10000) at room temperature on a low-speed shaker for 60 minutes. After that, protein expression was exposed using ECL ultrasensitive detection reagent (GE Healthcare, Buckinghamshire, UK) and ChemiDoc TM Images were captured using the MP imaging system and Image Lab 5.1 software (Bio-Rad, Hercules, CA, USA).

[0102] The experimental results are as attached Figure 3 As shown, attached Figure 3 This is a test chart showing the effect of KAT5 knockdown on the levels of three key proteins designed for DNA damage and repair, namely γ-H2AX, RAD51 and 53BP1, in ishikawa, HEC-1B and KLE cells. From the test results, we can see that after knocking down KAT5 in endometrial cancer cells, the level of γ-H2AX protein increased, the level of RAD51 protein decreased, and the level of 53BP1 protein did not change significantly. It can be seen that knocking down KAT5 induces the continuous accumulation of γ-H2AX in endometrial cancer cells, and this process is achieved by inhibiting the key HR repair protein RAD51, thereby inducing the accumulation of DNA damage in endometrial cancer cells, thereby inhibiting the proliferation of endometrial cancer cells.

[0103] Example 4

[0104] The examples of this application explore the in vitro anti-tumor activity of KAT5 inhibitor Nu9056:

[0105] 1. Prepare Nu9056, a specific small molecule targeted inhibitor of KAT5, with the structure of the compound CAS: 1450644-28-6.

[0106] 2. Dissolve Nu9056 in DMSO to prepare a stock solution for storage. Dilute it with PBS phosphate buffer to a working solution of appropriate concentration when using.

[0107] 3. Using Prestoblue method:

[0108] Human endometrial cancer cells Ishikawa were cultured in MEM medium (containing 10% FBS, 1% P / S + 1% NEAA) at 5% CO2 and 37°C.

[0109] The Nu9056 stock solution was diluted with PBS to form working solutions with gradient concentrations.

[0110] Collect cells growing in the logarithmic phase, adjust the concentration of the cell suspension, inoculate the cell suspension in a 96-well plate, and plate the cells to be tested to a density of about 1000 / well. 100 μL of cell suspension is added to each well. Incubate at 5% CO2 and 37°C for 6-8 hours. Observe the cell adhesion growth under a microscope. Add 10 μL of Nu9056 to the culture plate, where the effective concentrations of Nu9056 are 5 μM, 10 μM, 20 μM, 30 μM, 40 μM, and 50 μM, respectively. Finally, add PBS as a blank control. Place the culture plate in a 5% CO2, 37°C constant temperature incubator for culture. After culturing for 48 hours and 72 hours, take out the culture plate, add 10 μL of prestoblue (10×) solution to each well, continue culturing for 30 minutes, and terminate the culture. Place in a 4°C low-temperature centrifuge and centrifuge at 3000 rpm for 10 minutes to completely eliminate the bubbles. The absorbance of each well was detected at 535-560 nm using an automatic microplate reader.

[0111] 4. Experimental results are as attached Figures 4-5 As shown in Table 1 below:

[0112] Among them, Figure 4 This is a test graph of the effect of different concentrations of Nu9056 on the viability of Ishikawa cells at 48h and 72h. The horizontal axis is the concentration of Nu9056, and the vertical axis OD value is the optical density, corresponding to the cell concentration. Control is the control group.

[0113] Table 1 shows the inhibition rate (%) of different concentrations of Nu9056 on the growth of Ishikawa cells after culturing for 48h and 72h, respectively. The calculation formula is as follows:

[0114] Growth inhibition rate = (average absorbance of blank group - average absorbance of treatment group) / corresponding average absorbance of blank group × 100%.

[0115] Table 1

[0116]

[0117] From the test data in Table 1, it can be seen that as the concentration of Nu9056 increases, the average absorbance of the cells in the treatment group gradually decreases, indicating that the cell growth rate decreases and the number of cells decreases. This shows that increasing the effective concentration of the KAT5 inhibitor Nu9056 can more significantly inhibit the growth of cancer cells and show a stronger inhibitory effect on cancer cells. In addition, in the case of in vitro treatment, when the effective concentration of Nu9056 is 40μM to 50μM, the inhibitory effect on cancer cells is stronger, and the 48h inhibition rate can reach more than 89%, and the 72h inhibition rate can reach more than 90%.

[0118] From the attached Figure 4 The test results showed that Nu9056 showed inhibitory activity against ishikawa human endometrial cancer cells at gradient concentrations.

[0119] Attached Figure 5 This is a figure showing the cumulative changes in DNA damage detected by WB (Western Blotting) after the ishikawa human endometrial cancer cell line was treated with NU9056 (50uM, maximum dose) for 48 hours. Among them, H2AZac is a classic downstream substrate of KAT5, and the mechanism of action of NU9056 is to inhibit the expression of KAT5 downstream substrate proteins without directly acting on KAT5, thereby inhibiting its acetylation function. As can be seen from the test chart, it is proved that NU9056 can induce the accumulation of DNA damage in cancer cells. It should be noted that because it has been proven that knocking down KAT5 does not affect 53BP1, 53BP1 is no longer detected here.

[0120] Example 5

[0121] The present application example explores the in vivo anti-tumor activity of KAT5 inhibitor Nu9056:

[0122] 1. Test animals: BALB / c (nu / nu) nude mice, weighing 15-19g, 5 weeks old, female, bred in the SPF-grade breeding environment room of our experimental animals, with the indoor temperature controlled at 23±2℃, free food and water intake. A total of 12 animals. Adaptive breeding for 7 days before inoculation.

[0123] 2. Drugs and reagents: After Nu9056 was dissolved in DMSO, it was diluted with Tween-80 and 5% glucose injection in turn. The groups and dosing regimens are as follows. Blank control group: intraperitoneal injection of 0.1 mL 5% glucose injection once a week for 4 consecutive weeks. Nu9056-1 group (5 mg / kg): intraperitoneal injection of 0.1 mL Nu9056 (5 mg / kg) once a week for 4 consecutive weeks. Nu9056-2 group (10 mg / kg): intraperitoneal injection of 0.1 mL Nu9056 (10 mg / kg) once a week for 4 consecutive weeks. Converted to molar concentration, according to the calculation formula: mass (g) = concentration (mol / L) * volume (L) * molecular weight (g / mol), assuming that the weight of the mouse is 20g / mouse, the molecular weight of Nu9056 is known to be 232, and the injection volume is 0.1mL, the molar concentration of the Nu9056-1 group (5mg / kg) is calculated to be 4.3103mM, and the molar concentration of the Nu9056-2 group (10mg / kg) is 8.6206mM. That is, in the case of in vivo treatment, the effective concentration of Nu9056 is preferably 4.3103mM to 8.6206mM.

[0124] 3. Experimental method: Take Ishikawa cells in logarithmic growth phase and prepare a cell suspension with a concentration of 8×10 6 Cells / mL, 0.1mL / mouse was inoculated into the right abdominal cavity of nude mice to establish the Ishikawa nude mouse xenograft model. The diameter of the transplanted tumor was measured with a vernier caliper. After the tumor grew to a certain size, the animals were randomly divided into groups. The anti-tumor effect of Nu9056 was dynamically observed by measuring the tumor diameter. The tumor diameter was measured once every 3 days, and the mouse weight was checked every 3 days. The tumor volume exceeded 150mm 3 Mice with tumors need to be killed with CO2 in time. After 4 weeks, all mice were killed with CO2, and laparotomy was performed to observe, remove the tumor, carefully remove irrelevant tissues, wash with PBS solution 2 to 3 times, wash away the blood, drain the water and store in liquid nitrogen, and weigh and measure the volume at the same time. The calculation formula of tumor volume (TV) is: TV = 1 / 2 × a × b 2 , where a is the longest length of the tumor and b is the shortest length of the tumor.

[0125] 4. Calculate the relative tumor volume (RTV) based on the measurement results. The calculation formula is: RTV = V t / V0, where V0 is the tumor volume measured when the mice were initially dosed (i.e., d0), and V t The tumor volume at a single measurement. Evaluation index of drug anti-tumor activity: relative tumor proliferation rate T / C (%), calculated as follows:

[0126]

[0127] Among them, T RTV : Treatment group R TV ; C RTV : Blank group RTV.

[0128] Another evaluation index of anti-tumor activity: tumor growth inhibition rate (%), calculated as follows:

[0129] Tumor growth inhibition rate = (average tumor weight of blank group - average tumor weight of treatment group) / corresponding average tumor weight of blank group × 100%

[0130] The results of the inhibitory effect of Nu9056 on the growth of endometrial cancer cell ishikawa nude mouse xenograft tumors are shown in Table 2 (test data table of the inhibitory effect of different concentrations of Nu9056 on the growth of endometrial cancer cell ishikawa nude mouse xenograft tumors) and attached Figure 6 (Test chart of the effect of different concentrations of Nu9056 on the growth volume change of endometrial cancer cell xenograft tumor in nude mice, where the horizontal axis is the number of days, corresponding to 1 to 7 days, and the vertical axis is the tumor volume) and Figure 7 (The effect of different concentrations of Nu9056 on the tumor weight of endometrial cancer cell xenografts in nude mice, where the ordinate is the tumor weight and control is the blank control group).

[0131] Table 1

[0132] Group Relative tumor proliferation rate T / C (%) Tumor growth inhibition rate (%) Blank control group / / Nu9056-1 34.79 61.5 Nu9056-2 22.55 75.86

[0133] The experimental test results show that KAT5 inhibitor NU9056 can inhibit the growth of endometrial cancer in vivo. Compared with Nu9056-1 group (5 mg / kg), Nu9056-2 group (10 mg / kg) has a better inhibitory effect on the growth of endometrial cancer, a lower relative tumor proliferation rate, and a higher inhibition rate on tumor growth.

[0134] In addition, the KAT5 inhibitor NU9056 in the embodiment of the present application has achieved certain therapeutic effects when used alone in animal experiments. Given that its mechanism is to induce DNA damage in cancer cells, it can kill cancer cells without the help of related immune inducers. The treatment method of using a single drug in clinical practice can reduce the side effects of patients after treatment to a certain extent.

[0135] Furthermore, animal experiments showed that mice treated with Nu9056 had a reduced tumor burden, a survival period of more than 28 days, and a good growth state after long-term use, indicating that the KAT5 inhibitor NU9056 in the present application example has little side effects and will not suppress the immune function of animals after long-term use.

[0136] The above contents are further detailed descriptions of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as falling within the protection scope of the present invention.

Claims

1. Use of a KAT5 inhibitor in a drug for treating cancer, characterized in that: Including the application of KAT5 inhibitors in cancer treatment drugs.

2. Use of the KAT5 inhibitor according to claim 1 in a drug for treating cancer, characterized in that: The KAT5 inhibitors include Nu9056.

3. Use of the KAT5 inhibitor according to claim 2 in a drug for treating cancer, characterized in that: The cancer includes endometrial cancer.

4. Use of the KAT5 inhibitor according to any one of claims 1 to 3 in a drug for treating cancer, characterized in that: The KAT5 inhibitor inhibits cancer cell growth by inducing the accumulation of DNA damage in cancer cells.

5. Use of the KAT5 inhibitor according to claim 4 in a drug for treating cancer, characterized in that: The KAT5 inhibitor is used to regulate the levels of γ-H2AX and RAD51 proteins in endometrial cancer cells.

6. Use of the KAT5 inhibitor in a drug for treating cancer according to claim 5, characterized in that: The KAT5 inhibitor is used to induce the accumulation of γ-H2AX protein levels in endometrial cancer cells and inhibit RAD51 protein expression.

7. Use of the KAT5 inhibitor in a drug for treating cancer according to claim 6, characterized in that: The KAT5 inhibitors for treating cancer include in vitro treatment and in vivo treatment; And / or, the inhibition rate of the KAT5 inhibitor on endometrial cancer cells is not less than 23%.

8. A drug for treating endometrial cancer, characterized in that: Comprising KAT5 inhibitors and excipients.

9. The drug for treating endometrial cancer according to claim 8, characterized in that: The KAT5 inhibitor includes Nu9056; and / or, in the case of in vitro treatment, the effective concentration of the KAT5 inhibitor in the drug for treating endometrial cancer is 40 μM to 50 μM; And / or, in the case of in vivo treatment, the effective concentration of the KAT5 inhibitor in the drug for treating endometrial cancer is 4 mM to 10 mM.

10. The drug for treating endometrial cancer according to claim 9, characterized in that: The dosage form of the drug for treating endometrial cancer includes injection; And / or, the auxiliary material includes at least one solvent selected from the group consisting of dimethyl sulfoxide, phosphate buffer, Tween-80, and glucose injection.

Images