Application of Vitis amurensis gene VaWRKY65 in genetic improvement of plant cold resistance

By cloning and regulating the VaWRKY65 gene of Vitis amurensis, the problem of insufficient cold resistance of grapes was solved, efficient cold resistance improvement was achieved, new genetic resources were provided, and the sustainable development of grape breeding and agriculture was promoted.

CN119570836BActive Publication Date: 2025-09-30WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411454968.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-17
Publication Date
2025-09-30
Estimated Expiration
2044-10-17

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively improve the cold resistance of grapes. Traditional breeding methods are inefficient, costly, and time-consuming. In addition, Eurasian grapes are sensitive to cold stress, which limits the selection and breeding of new grape varieties and industrial development.

Method used

The Vitis amurensis gene VaWRKY65 was cloned and its expression was regulated in plants by overexpression, silencing or knocking out the gene. The CRISPR/Cas9 system was used for gene editing to improve or weaken the plant's cold resistance.

Benefits of technology

By regulating the expression of the VaWRKY65 gene, the cold resistance of plants can be significantly improved or weakened, providing new genetic resources, providing genetic resources for green agriculture and water-saving agriculture, reducing agricultural production costs, and enhancing the low temperature resistance of plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the field of plant genetic engineering and discloses a cold-resistant gene of wild grape VaWRKY65 Application in genetic improvement of plant cold resistance, VaWRKY65 The gene is from a very cold-resistant wild grape ( Vitis amurensis ) was isolated and cloned, and its sequence is shown in SEQ ID NO. 1. This gene was used to construct overexpression and interference vectors, and was introduced into Arabidopsis thaliana and Vitis amurensis respectively through Agrobacterium-mediated genetic transformation. The obtained transgenic plants were verified by biological function, indicating that the cloned gene of the present invention VaWRKY65 The gene has the function of improving plant cold resistance. The discovery of this gene provides a new genetic resource for molecular design and breeding of plant stress resistance, and provides a new genetic resource for the implementation of green agriculture and water-saving agriculture. The development and utilization of this genetic resource will help reduce agricultural production costs and achieve environmental friendliness.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering, and specifically relates to the application of the Vitis amurensis gene VaWRKY65 in genetic improvement of plant cold resistance. By overexpressing the gene in plants, the cold resistance of the obtained transgenic plants is significantly improved. By knocking out, inhibiting or silencing the gene in plants, the cold resistance of the obtained transgenic plants is significantly weakened. Background Art

[0002] Low temperature is a major abiotic stress limiting the production and distribution of some key economic crops. It can damage plant cell membranes, interfere with chlorophyll synthesis and photosynthesis, leading to decreased enzyme activity, increased reactive oxygen species (ROS), dysregulated cellular metabolism, and even plant death in extreme cases (Chinnusamy et al., 2007). Through long processes of natural selection and evolution, plants have developed a complex and sophisticated set of response mechanisms to cope with environmental fluctuations. When plants encounter environmental stimuli, they activate the expression of a range of defense and resistance genes through internal signaling pathways (Pankaj et al., 2016). Furthermore, these stress responses trigger an increase in antioxidant defense systems and induce changes in a range of metabolites, such as soluble sugars, fatty acids, proline, and betaine (Thomashow, 1999).

[0003] Cold-responsive genes can be broadly divided into two categories: regulatory genes and functional genes. Regulatory genes are responsible for regulating signal transduction and gene expression, while the products encoded by functional genes directly exert protective effects within the cell (Wang et al., 2003; Zhu, 2016). Transcription factors, as a type of regulatory gene, play a dual role of "sensor-response." They not only sense cold signals but also specifically bind to cis-acting elements in gene promoter regions, thereby regulating the expression of multiple cold-responsive genes and enhancing plant cold tolerance (Golldack et al., 2011; Nakashima et al., 2014). Therefore, the discovery and application of transcription factors is a highly effective strategy for improving plant stress tolerance.

[0004] The WRKY transcription factor family is one of the largest in higher plants. Accumulating evidence indicates that WRKY transcription factors can act as regulatory factors in transcriptional networks by binding to W-box (TGAC) sites in target gene promoters. They are involved in a range of biological processes, including development, secondary metabolite synthesis, carbohydrate synthesis, reactive oxygen species (ROS) homeostasis, hormone signaling, and aging (Wang et al., 2023; Jiang et al., 2017; Rushton et al., 2010). Furthermore, some studies have shown that WRKYs play important roles in coping with various abiotic stresses, particularly cold stress. For example, overexpression of OsWRKY71 and OsWRKY76 conferred cold stress resistance in rice (Yokotani et al., 2013; Kim et al., 2016). Overexpression of CdWRKY2 enhances cold tolerance in bermudagrass by promoting sucrose biosynthesis and CBF signaling pathways (Huang et al., 2022). However, existing technologies have not shown that WRKY transcription factors are involved in grape low temperature response.

[0005] Grapes are a widely cultivated fruit crop with high economic value worldwide. Low temperatures and freezing damage are a major factor limiting the stable and sustainable development of the grape industry, adversely affecting its growth, development, fruit quality, and yield (Wan et al., 2008). Currently, the most commonly cultivated cultivars are derived from V. vinifera, which is extremely sensitive to cold stress (Fennell, 2004; Xu et al., 2014). Therefore, improving cold resistance has long been a major goal of grape breeding programs. However, grapes face challenges such as a long life cycle, severe inbreeding depression, and the complexity of genetic control of economic traits. Traditional breeding methods, due to their low efficiency, high costs, and long production cycles, have significantly limited the selection of new grape varieties and the rapid development of the industry. V. amurensis, a cold-resistant wild grape species that can tolerate temperatures as low as -40°C, has been widely used in traditional breeding to produce cold-resistant varieties (Fennell, 2004), making it an ideal candidate for discovering key cold-resistance genes. Therefore, cloning the cold-resistance-related genes of Vitis amurensis is the key and foundation of cold-resistance genetic engineering. Summary of the Invention

[0006] The present invention provides the use of the Vitis amurensis gene VaWRKY65 in genetically improving plant cold resistance. Overexpressing or silencing this gene in plants can yield plants with enhanced or weakened cold resistance. The protein encoded by this gene is shown in SEQ ID NO. 2, and the corresponding nucleotide sequence is shown in SEQ ID NO. 1.

[0007] In order to achieve the above purpose, the present invention adopts the following technical measures

[0008] Based on plant gene cloning technology, the applicant isolated and cloned a transcription factor from the extremely cold-resistant wild grape (Vitis amurensis). The applicant named it VaWRKY65, and its sequence is shown in SEQ ID NO.1, and its corresponding amino acid sequence is shown in the sequence listing SEQ ID NO.2; open reading frame (ORF) prediction found that the gene contains one ORF, is 837bp in length, and encodes a protein of 278 amino acids. The applicant used qRT-PCR technology to analyze the induction of the relative expression of the VaWRKY65 gene by low temperature stress. In addition, the phenotypes and related physiological indicators of the VaWRKY65 transgenic lines before and after low temperature treatment were analyzed. The results showed that compared with the wild-type and control plants, the VaWRKY65 overexpressing plants had stronger cold resistance. In addition, the survival rate, BAM activity and soluble sugar content were significantly higher, and the conductivity, MDA content, starch content, H2O2 content and O2 ·- However, the opposite was true in VaWRKY65 knockout and transient silencing plants, indicating that VaWRKY65 is a potential cold-resistance breeding gene.

[0009] The protection scope of the present invention includes:

[0010] Use of the protein represented by SEQ ID NO. 2 or the gene encoding the protein in regulating plant cold resistance;

[0011] The applications described above are specifically:

[0012] Increasing the expression of the protein shown in SEQ ID NO. 2 or the gene encoding the protein in a plant to improve the cold resistance of the plant, the application specifically comprising: introducing a substance that increases the expression of the protein shown in SEQ ID NO. 2 or the gene encoding the protein into the plant;

[0013] Inhibiting or reducing the expression of the protein represented by SEQ ID NO. 2 in Vitis amurensis to weaken the cold resistance of Vitis amurensis;

[0014] Knocking out, inhibiting or silencing the gene encoding the protein shown in SEQ ID NO. 2 to reduce the cold resistance of Vitis amurensis;

[0015] In the above-mentioned applications, preferably, the knockout, inhibition or silencing of the expression of the gene encoding the protein shown in SEQ ID NO. 2 is achieved by VIGS interference or CRISPR / Cas9 knockout system.

[0016] Use of the protein shown in SEQ ID NO. 2 or a gene encoding the protein in preparing a cold-resistant transgenic plant, wherein the use specifically comprises: introducing a substance that increases the expression level of the protein shown in SEQ ID NO. 2 or the expression level of the gene encoding the protein shown in SEQ ID NO. 2 into the plant;

[0017] In the above application, preferably, the substance is a nucleic acid molecule encoding the protein shown in SEQ ID NO. 2, or its expression cassette, recombinant vector, or recombinant microorganism;

[0018] In the above-mentioned applications, preferably, when it is necessary to increase the expression level of the protein shown in SEQ ID NO. 2 in plants or to increase the expression level of the gene encoding the protein shown in SEQ ID NO. 2 in plants, the expression vector carrying the gene encoding the protein shown in SEQ ID NO. 2 of the present invention is introduced into plant cells using conventional biotechnology methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition)).

[0019] The nucleic acid molecule encoding the protein shown in SEQ ID NO.2 is shown in SEQ ID NO.1.

[0020] In the above application, preferably, the plant is Vitis amurensis or Arabidopsis thaliana.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] The discovery and identification of the VaWRKY65 gene provides new genetic resources for the design and breeding of plant stress resistance molecules, and provides new genetic resources for the implementation of green agriculture and water-saving agriculture. The development and utilization of this genetic resource is conducive to reducing agricultural production costs and achieving environmental friendliness. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is a technical flow chart of the present invention.

[0024] Figure 2 Schematic diagram of the expression pattern of VaWRKY65 in response to low temperature stress treatment of the present invention.

[0025] Figure 3 This is a schematic diagram of the subcellular localization of the VaWRKY65 gene of the present invention.

[0026] Figure 4 Schematic diagram of the analysis of the transcriptional activation activity of the VaWRKY65 gene of the present invention.

[0027] Wherein: A is a schematic diagram of the construction of the VaWRKY65 gene deletion fragment of the present invention; B is the detection of the transcriptional activation activity of the VaWRKY65 gene of the present invention.

[0028] Figure 5 This is a schematic diagram of the measurement of the low temperature treatment phenotype and physiological indicators of the VaWRKY65 gene-transgenic Arabidopsis thaliana;

[0029] Among them: A is the phenotype of transgenic Arabidopsis (#1, #3) and wild-type Arabidopsis after low temperature treatment; B is the relative expression level of VaWRKY65; C is the survival rate of Arabidopsis after treatment; D is the relative electrical conductivity of Arabidopsis after treatment; E is the MDA content of Arabidopsis after low temperature treatment; F is the BAM activity of Arabidopsis after low temperature treatment; G is the starch content of Arabidopsis after treatment; H is the soluble sugar content of Arabidopsis after treatment.

[0030] Figure 6 This is a schematic diagram of the measurement of phenotypes and physiological indicators of the root system of the transgenic grape overexpressing VaWRKY65 under low temperature treatment;

[0031] Wherein: A is the relative expression level of VaWRKY65 in the overexpression root system; B is the relative expression level of VaBAM3 in the overexpression root system; C is the relative conductivity of the overexpression root system before and after treatment; D is the MDA content of the overexpression root system before and after low temperature treatment; E is the DAB staining image of the overexpression root system after treatment; F is the NBT staining image of the overexpression root system after treatment; G is the BAM activity of the overexpression root system before and after treatment; H is the starch content of the overexpression root system before and after treatment; I is the soluble sugar content of the overexpression root system before and after treatment.

[0032] Figure 7 Schematic diagram of the measurement of root phenotypes and physiological indicators of VaWRKY65 knockout transgenic grapes subjected to low temperature treatment;

[0033] Where: A is the sequence of VaWRKY65 in the knockout root system; B is the relative expression level of VaBAM3 in the knockout root system; C is the relative conductivity of the knockout root system before and after treatment; D is the MDA content of the knockout root system before and after low temperature treatment; Figure 7 E in the middle is the DAB staining image after root knockout treatment; F is the NBT staining image after root knockout treatment; G is the BAM activity before and after root knockout treatment; H is the starch content before and after root knockout treatment; I is the soluble sugar content before and after root knockout treatment.

[0034] Figure 8 This is a schematic diagram of the identification and relative expression quantitative analysis of VIGS silencing materials of the present invention;

[0035] Among them: A is the identification of VaWRKY65 silenced materials (VaWRKY65-TRV2); B is the identification of the relative expression level of VaWRKY65 by randomly selecting 9 positive materials.

[0036] Figure 9 This is a schematic diagram of the cold resistance analysis of Vitis amurensis plants with silenced VaWRKY65 gene (abbreviated as TRV-VaWRKY65);

[0037] Among them: A is the phenotype of the unloaded TRV and the intervention plant TRV-VaWRKY65 before and after low temperature treatment; B is the relative conductivity of the intervention plant before and after low temperature treatment; C is the MDA content of the intervention plant before and after low temperature treatment; D is the BAM activity of the intervention plant before and after low temperature treatment; E is the starch content of the intervention plant before and after low temperature treatment; F is the soluble sugar content of the intervention plant before and after low temperature treatment; G is the DAB staining image of the intervention plant before and after low temperature treatment; H is the NBT staining image of the intervention plant before and after low temperature treatment. DETAILED DESCRIPTION

[0038] The present invention is described in detail below with reference to specific embodiments. Based on the following description and examples, those skilled in the art can ascertain the essential features of the present invention and, without departing from the spirit and scope of the present invention, can make various changes and modifications to the present invention to adapt it to various uses and conditions.

[0039] Example 1:

[0040] Cloning of the full-length cDNA of VaWRKY65 gene from Vitis amurensis and construction of the overexpression vector pBI121

[0041] The cDNA of V. amurensis was used as a template and a high-fidelity enzyme was used for amplification. The primers used were the pSAK277-WRKY65 overexpression primers: F: 5'-GACACTAGTGGATCCAAAGAATTCATGGACGGCAGATTCAACAGTAA-3' and R: 5'-TCCCTCGAGAAGCTTTTTGAATTCGCTTGTGGTCCCACACATGGG-3'.

[0042] The amplified product was purified and recovered using the AxyPrep-96 DNA Gel Extraction Kit (Axygene, USA). Using seamless DNA cloning, the purified product was ligated into the linearized overexpression vector pSAK277. The ligated product was then transformed into DH5α competent cells, plated, and shaken for positive identification. Positive clones were obtained and sent to Sangon Biotech for sequencing. The full-length cDNA sequence of the VaWRKY65 gene was obtained based on the sequencing results. The protein encoded by the VaWRKY 65 gene is shown in SEQ ID NO. 2, and the corresponding polynucleotide is shown in SEQ ID NO. 1.

[0043] The plasmid was extracted from Escherichia coli with the correct sequencing results using AxyPrep plasmid DNA miniprep reagent (Axygen, USA), and the plasmid was named pSAK277-VaWRKY65. The constructed pSAK277-VaWRKY65 recombinant vector with the correct sequencing results was transformed into Agrobacterium competent cells (GV3101) for later use.

[0044] Example 2:

[0045] Expression analysis of VaWRKY65 gene under different stress conditions

[0046] One-month-old wild-type Vitis amurensis seedlings with the same growth vigor were cultured and subjected to low-temperature treatment (4°C). Sampling was performed at 0h, 2h, 4h, 8h, 24h, and 48h. The leaves were sampled for cDNA extraction.

[0047] The expression pattern of VaWRKY65 gene was analyzed by real-time fluorescence quantitative PCR (qRT-PCR). AceQ qPCR SYBR Green Master Mix (Novagen, Germany) was used for real-time fluorescence quantitative PCR. The method was referred to the instructions. The prepared reaction system was reacted using QuantStudio 7Flex system (Applied Biosystems, USA) fluorescence quantitative analyzer. The relative expression level of the gene was determined by 2 -ΔΔCTThe calculation was performed using the method, using grape Actin as the internal reference gene (forward primer: 5'-CTTGCATCCCTCAGCACCTT-3'; reverse primer: 5'-TCCTGTGGACAATGGATGGA-3') and VaWRKY65 real-time quantitative primers (forward primer: 5'-TCGCTGATCACAA CCGAAG-3'; reverse primer: 5'-ATCGGCGAACAGCGATTCA-3'). The results of this experiment showed that the expression level of the VaWRKY 65 gene was continuously induced by low temperature, reaching the highest expression level at 48 hours, which increased by about 50 times compared with the level before treatment ( Figure 2 ).

[0048] Example 3:

[0049] Genetic transformation and positive identification of Arabidopsis thaliana

[0050] 1) Use an inoculating loop to streak a small amount of Agrobacterium culture onto LB + Spec (50 mg / L) medium. Incubate at 28°C for approximately 48 hours. Isolate a single colony in 5 mL of LB + Spec (50 mg / L) liquid medium at 220 rpm, 28°C, and incubate overnight.

[0051] 2) Add 5 mL of bacterial culture to 50 mL of LB+Spec (50 mg / L) liquid medium and incubate at 28°C, 220-250 rpm, until the OD600 value of the bacterial culture reaches approximately 2.

[0052] 3) Transfer the bacterial suspension to a 50 mL centrifuge tube and centrifuge at 4000 rpm for 5 minutes. Discard the supernatant and resuspend the cells in 5% sucrose solution to an OD600 of approximately 0.8. Add 0.02-0.03% of the active agent Silwet-77 and mix thoroughly.

[0053] 4) Soak the Arabidopsis flower buds in the infection solution for 30 seconds, incubate the infected Arabidopsis in the dark at room temperature for 24 hours, grow the infected Arabidopsis in a growth chamber, and collect transgenic Arabidopsis seeds;

[0054] 5) Place the collected T0 generation seeds in a 1.5 mL centrifuge tube, add 1 mL of disinfectant (20% NaClO + 0.1% Triton 100-X), and mix thoroughly by vortexing for 5 minutes. Rinse 4-5 times with sterile water. Spread the seeds evenly on MS solid medium containing 40 mg / L hygromycin, allow to air-dry, and seal with film. Wrap the culture dish with tin foil and place in the dark at 4°C for 3 days of vernalization. Then, grow in a growth chamber for approximately 10 days. Transplant positive seedlings with green cotyledons and long roots into soil until the plants are established.

[0055] When the T0 generation plants grow up and have 2-3 leaves, take a small amount of leaves for DNA extraction. The DNA extraction steps are as follows:

[0056] 1) Place a small amount of Arabidopsis leaves in a 1.5 mL centrifuge tube, grind to powder using liquid nitrogen, and add 600 μL of CATB extract.

[0057] 2) After thorough mixing, place in a 65°C water bath for 90 minutes, inverting and mixing every 30 minutes;

[0058] 3) After the water bath is complete, add 700 μL of a 24:1 (chloroform:isoamyl alcohol) mixed extract, mix vigorously by inversion, and centrifuge at 12,000 rpm for 15 minutes at room temperature. Transfer the supernatant (approximately 500 μL) to a new 1.5 mL centrifuge tube.

[0059] 4) Add an equal volume of pre-chilled isopropanol to the supernatant, mix thoroughly by inverting, and place in a -20°C refrigerator to precipitate (precipitation time can be extended);

[0060] 5) After precipitation is complete, remove the pellet and centrifuge at 12,000 rpm for 10 minutes. Discard the supernatant and add 1 mL of pre-chilled 75% ethanol. Rinse 2-3 times, discard the alcohol, and air-dry in a fume hood.

[0061] 6) Add 20-30 μL ddH2O to each tube to dissolve the DNA. Store the dissolved DNA in a -20°C refrigerator.

[0062] For concentration determination, 1 μL of each sample was taken and measured on a NanoDrop 2000 ultra-micro-volume spectrophotometer (Thermo, USA). DNA purity was high when the OD260 / OD280 ratio was within the range of 1.8-2.0. Gel electrophoresis was also used for the determination.

[0063] Using identification primers, multiple positive plants were obtained by PCR identification. The identification primer sequences were 35S-F: 5'-TCCTCGGATTCCATTGCCCAGC-3 and gene-R: 5'-TCCCTCGAGAAGCTTTTTGAATTCGCTTGTGGTCCCACACATGGG-3'. Real-time fluorescence quantitative analysis of the relative expression level of VaWRKY65 in positive Arabidopsis plants showed that the expression level of VaWRKY65 was significantly increased compared with WT ( Figure 5 (B) Based on the positive seedling identification results, T3 seeds of overexpressing plants #1 and #3 were selected for subsequent analysis.

[0064] Example 4:

[0065] Analysis of cold resistance of transgenic Arabidopsis

[0066] 14-day-old potted transgenic Arabidopsis and wild-type Arabidopsis (WT) were used to identify their cold resistance. After being treated at -6°C for 1 hour, most of the leaves of the wild-type Arabidopsis turned yellow and wilted, while only some of the transgenic Arabidopsis showed water-soaked wilting. Figure 5 After recovery, the survival rates of transgenic Arabidopsis plants were calculated. The survival rates of line #1 and line #4 were 72.2% and 88.9%, respectively, while the survival rate of wild-type plants was only 40%. Figure 5 Middle C), compared with overexpressed Arabidopsis, the relative conductivity of wild-type Arabidopsis after low temperature treatment is higher ( Figure 5 D), indicating that the cell membrane of wild-type Arabidopsis was severely damaged. In addition, compared with WT Arabidopsis, transgenic Arabidopsis accumulated lower MDA content ( Figure 5 Middle E). Compared with wild-type Arabidopsis, BAM activity is higher in overexpressed Arabidopsis ( Figure 5 F), starch content decreased ( Figure 5 G), the soluble content increased significantly ( Figure 5 In conclusion, phenotypic observations and physiological data measurements indicate that overexpression of the VaWRKY65 gene confers enhanced cold tolerance and frost resistance in transgenic Arabidopsis.

[0067] Example 5:

[0068] Grape hairy root genetic transformation

[0069] Based on previous research (Meng et al., 2019), an Agrobacterium rhizogenes-induced transgenic system for grape capillary roots was developed. Specifically, the 35S promoter-driven overexpression vector pSAK277-VaWRKY65 and the CRISPR-Cas9 vector pKSE401-VaWRKY65 were transformed into Agrobacterium rhizogenes MSU440, respectively. After 3 days of culture, single positive colonies were selected on antibiotic-containing medium. Single colonies were selected and cultured overnight to an OD of 0.8. They were then activated with 100 μM acetosyringone at 28°C for 2 hours before use.

[0070] The stems of six-week-old rose fragrant tissue culture seedlings were cut into fragments containing two buds and immersed in a suspension for 8 minutes. The stem segments were transferred to 1 / 2MS culture medium and cultured together at 25°C in the dark for two days. The stem segments were then washed with sterile water (400mg / L cefotaxime sodium (cef) + 400mg / L carbenicillin disodium salt (carb)) for 5 minutes and washed three times in total. The explants were transferred to new 1 / 2MS culture medium (200mg / L cef + 200mg / L carb + 10mg / L kanamycin (kan)) and cultured at 26°C for one month. Subsequent experiments were performed after the root system grew well.

[0071] The pKSE401-VaWRKY65 vector was constructed by logging on to the website http: / / www.genome.arizona.edu / crisp r / CRISPRsearch.html, screening the target site, the target sequence is: GTTCAAAAGGCTGCCCAGCT, and designing primers. The primer structures are as follows:

[0072] VaWRKY65-DT1-BsF:ATATATGGTCTCGATTGTTCAAAAGGCTGCCCAGCTGTT

[0073] VaWRKY65-DT1-F0:TGTTCAAAAGGCTGCCCAGCTGTTTTAGAGCTAGAAATAGC

[0074] VaWRKY65-DT2-R0:AACCGCCTAGGTCAGTGAACTTTCAATCTCTTAGTCGACTCTACVaWRKY65-DT2-BsR:ATTATTGGTCTCGAAACCGCCTAGGTCAGTGAACTTTCAA

[0075] Four-primer PCR amplification was performed using 100-fold diluted pCBC-DT1T2 as a template. The PCR product was purified and recovered, and the following enzyme digestion-ligation system was established to obtain the pKSE401-VaWRKY65 vector:

[0076]

[0077]

[0078] Take 5ul of the transformed E. coli competent cells and grow a single clone for sequencing.

[0079] Using identification primers, multiple overexpression-positive root systems were obtained by PCR identification. The identification primer sequences were 35S-F and gene-R (Example 3). Real-time fluorescence quantitative analysis of the relative expression levels of VaWRKY65 and the downstream gene VaBAM3 in the positive root systems (VaWRKY65 fluorescence quantitative primers are shown in Example 2, and the downstream gene VaBAM3 fluorescence quantitative primers are B3-qF: 5'-GGCAAGTAAAGATGGCGACTAAGAC-3' and B3-qR: 5'-CCAATGTAAAGGTCTGTC CCGC-3'). The results showed that the expression levels of VaWRKY65 and the downstream gene VaBAM3 were significantly increased compared to the empty control (i.e., the root system only transformed with the pSAK277 vector) ( Figure 6 Middle A, Figure 6Middle B), based on the positive seedling identification results, all overexpressing root lines were used for subsequent analysis.

[0080] Using the identification primers, multiple knockout root lines were obtained after PCR amplification and sequencing on the Hi-TOM platform ( Figure 7 A), the identification primer sequences were 35S-F: 5'-GGAGTGAGTACGGTGTGCCATCCGATTCATGGGCTT GGAG-3' and gene-R: 5'-GAGTTGGATGCTGGATGGTCTTCGGTTGTGATCAGCG-3'. At the same time, the relative expression level of the downstream gene VaBAM3 in the knockout root system was quantitatively analyzed by real-time fluorescence. Compared with the empty vector group (i.e., the root system transformed with only the pKSE401 vector), the expression level of the gene VaBAM3 in the knockout root system was significantly reduced ( Figure 7 Middle B), based on the sequencing results of the knockout sites, all knockout root lines were used for subsequent analysis.

[0081] Example 6: Identification of cold resistance of knockout grape roots

[0082] The rose fragrance VaWRKY65 gene overexpression root system and knockout root system prepared in Example 5 were subjected to low temperature treatment (-5°C) for 4 hours, and various tests were performed. The test results are as follows, and the following results are all average values:

[0083] After being treated at -5℃ for 4h, the relative conductivity of the overexpression root system was also significantly lower than that of the empty load control ( Figure 6 In C), the overexpression root system was 28.5%, while the empty root system was 53.7%. At the same time, the overexpression root system accumulated less MDA ( Figure 6 D) in the middle, which is 55% of the empty root system. At the same time, DAB staining and NBT staining showed that the H2O2 and O2 ·- Higher content ( Figure 6 Middle E, Figure 6 In addition, after low temperature treatment, the BAM activity and soluble sugar content of the overexpression roots were significantly higher than those of the empty load, while the starch content was significantly lower than that of the empty load ( Figure 6 Middle G, Figure 6 Medium H Figure 6 Middle I).

[0084] The knockout roots showed the opposite phenotype. After being treated at -5℃ for 4 hours, the relative conductivity of the knockout roots was significantly higher than that of the wild type ( Figure 7 C), where the knockout root system was 45.4% and the empty root system was 32.9%. At the same time, the knockout root system accumulated more MDA ( Figure 7D), where the knockout root system is 4.0nmol / mg prot and the empty root system is 3.2nmol / mg prot. At the same time, DAB staining and NBT staining showed that the H2O2 and O2 ·- Higher content ( Figure 7 Middle E, Figure 7 In addition, after low temperature treatment, the BAM activity and soluble sugar content of the overexpression roots were significantly lower than those of the empty load, while the starch content was significantly higher than that of the empty load ( Figure 7 Middle G, Figure 7 Medium H Figure 7 Middle I).

[0085] Therefore, these results indicate that the VaWRKY65 gene is associated with its ability to scavenge reactive oxygen species and accumulate soluble sugars, which may be an important factor in its enhanced cold resistance. Using the above method, overexpressing this gene in plants can significantly improve the cold resistance of plants.

[0086] Example 7: VIGS Intervention in Vitis amurensis and Identification of Positive Seedlings

[0087] VIGS material identification and low temperature resistance analysis

[0088] TRV2 homologous recombination primers were designed using a non-conserved fragment of the VaWRKY65 gene sequence to construct the TRV2 vector (construction and transformation procedures were the same as those for pSAK277-VaWRKY65) to interfere with the normal expression of the VaWRKY65 gene. The primers are TRV2-VaWRKY65-F: 5'-TTCTCTAGAAGGCCTCCATGGGGATCCGCAATTTTCTCAAGCCA AGC-3' and TRV2-VaWRKY65-R: 5'-GTTTAATGTCTTCGGGACATGCCCGGGGCTTGTGG TCCCACACATGGG-3'.

[0089] The gene was silenced using VIGS-mediated silencing. Transformed plants were detected using two pairs of primers: TRV1-F: 5'-ATTGAGGCGAAGTACGATGG-3', TRV1-R: 5'-CCATCCACAATTATTTTCCG C-3'; and TRV2-F: 5'-ATTCACTGGGAGATGATACGCT-3', TRV2-VaWRKY65-R: 5'-GTTTA ATGTCTTCGGGACATGCCCGGGGCTTGTGGTCCCACACATGGG-3'. Transformed plants were considered positive only if both primer pairs amplified bands. Plants co-transformed with TRV2-VaWRKY65 and a TRV1 empty plasmid served as the experimental group (TRV-VaWRKY65), while plants co-transformed with a TRV2 empty plasmid and a TRV1 empty plasmid served as the control group (TRV). After transformation, positive plants were identified. Figure 8 A), 9 positive seedlings were selected and their VaWRKY65 was quantitatively analyzed in real time ( Figure 8 Middle B), the results showed that the expression level of VaWRKY65 in positive plants was suppressed by 20%-70% compared with the empty vector, and the expression level was generally low, indicating that VIGS has a high silencing efficiency.

[0090] Before low temperature treatment, there was no significant phenotype difference between VaWRKY65 silenced plants and control plants. However, after low temperature treatment, the leaves of silenced plants wilted much more than those of the control group ( Figure 9 Compared with the control group, before low temperature treatment, the electrical conductivity and MDA content of the silent plants were basically the same as those of the control plants, but after low temperature treatment, the electrical conductivity and MDA content of the silent plants increased significantly ( Figure 9 In addition, the BAM activity and soluble sugar content of the silenced plants after low temperature treatment were significantly lower than those in the control group, while the starch content was significantly higher than that in the control group ( Figure 9 Middle D, Figure 9 China E Figure 9 In addition, the DAB staining and NBT staining of the leaves of the VaWRKY65 interference plants after low temperature treatment were darker ( Figure 9 Middle E, Figure 9 (F) These results suggest that interfering with the VaWRKY65 gene disrupts the plant's reactive oxygen species scavenging system, inhibiting the removal of reactive oxygen species in Vitis amurensis under low-temperature treatment, thereby making the plant more susceptible to damage from low-temperature stress. In summary, VaWRKY65 is a positive regulator of plant resistance to low-temperature stress.

[0091] Example 8:

[0092] Subcellular localization and transcriptional activation analysis of VaWRKY65 gene

[0093] The ORF region of VaWRKY65 (excluding the stop codon) was amplified using primers p101YFP-WRKY65-F: 5'-GGATCTACTAGTGAATTCATGGACGGCAGATTCAA-3' and p101YFP-WRKY65-R: 5'-GGTACCGTCGACGGATCCGCTTGTGGTCCCACACATGG-3'. The target gene was constructed into the 101LYFP vector, with the YFP protein located at the 3' end of the gene and expression driven by the CaMV35S promoter. 35S:VaWRKY65-YFP+mCherry and the control 35S:YFP+mCherry were transiently transformed into the epidermal cells of Arabidopsis thaliana leaves. Laser confocal microscopy revealed that the fluorescence of the control filled the entire epidermal cell, including the cytoplasm and nucleus, while the fluorescence of the transformed 35S:VaWRKY65-YFP was concentrated only in the nucleus. This indicates that VaWRKY65 is a nuclear-localized protein ( Figure 3 ).

[0094] Subcellular localization of VaWRKY65 showed that VaWRKY65 is a nuclear transcription factor. To investigate the transcriptional activation activity of VaWRKY65, the gene was divided into the full-length WRKY65-F1 (1-225 bp / 1-75 aa), amplified using primers 5'-ATGGCCATGGAGGCCGAATTCATGGACGGCAGATTCAAC-3' and 5'-CTAGTTATGCGGCCGCTGCAGGGAGCACAGTCCCCCTTGA-3'); and the bHLH interaction region of WRKY65-F2 (226 bp-408 bp / 76-136 aa), amplified using primers 5'-ATGGCCATGGAGGCCGAATTCACCATCCGATTCATGGG The VaWRKY65 gene coding region sequence fragments were ligated into the yeast GAL4 fusion expression vector pGBK T7 to construct the recombinant vectors, and then transformed into yeast AH109 competent cells ( Figure 4(A) The transcriptional activation activity of VaWRKY65 was tested on the corresponding defective culture medium. Positive and negative controls were set up. The results showed that all transformants could grow on SD / -Trp deficiency medium, while only full-length, VaWRKY65-FL and VaWRK Y65-F3 could grow normally on the deficiency medium SD-Trp / Ade / His and SD-Trp / Ade / His+X-α-Gal ( Figure 4 Middle B). This indicates that the C-terminus of VaWRKY65 can activate the LacZ reporter gene, which then triggers the degradation of β-galactosidase, breaking down X-α-Gal and displaying blue color.

Claims

1. Use of the protein shown in SEQ ID NO. 2 or the gene encoding the protein in regulating cold resistance in plants, wherein the regulation is to increase the expression level of the protein shown in SEQ ID NO. 2 or the gene encoding the protein in the plant to improve the cold resistance of the plant, wherein the plant is Vitis amurensis or Arabidopsis thaliana.

2. Use of the protein represented by SEQ ID NO. 2 or a gene encoding the protein in preparing a cold-resistant transgenic plant, wherein the use comprises introducing a substance that increases the expression of the protein represented by SEQ ID NO. 2 or the gene encoding the protein represented by SEQ ID NO. 2 into the plant, wherein the plant is Vitis amurensis or Arabidopsis thaliana.

3. The use according to claim 2, characterized in that: The substance is a nucleic acid molecule encoding the protein shown in SEQ ID NO. 2, or its expression frame, recombinant vector, or recombinant microorganism.

4. The use according to claim 1 or claim 2, characterized in that: The sequence of the gene encoding the protein shown in SEQ ID NO.2 is shown in SEQ ID NO.1.