Method for rapidly obtaining genotype homozygous intermuscular thorn-free grass carp

Abstract

The invention discloses a method for rapidly obtaining genotype homozygous intermuscular thorn-free grass carps, which comprises the following steps: carrying out gene editing on wild grass carps by taking runx2b genes as target genes, screening successfully mutated F0-generation individuals, culturing to sexual maturity, then screening mutated F0-generation male and female individuals with the same mutation type, and mating to obtain F1-generation grass carps; the individuals with homozygous runx2b alleles in the F1 generation are obtained through genotype detection, and the individuals are the F1 generation intermuscular thorn-free grass carp new germplasm. The sexual maturity of the grass carp needs 4-5 years, and the period of breeding the first generation is long, so that the invention aims to establish a method for quickly obtaining the grass carp without the intermuscular thorns by utilizing a gene editing technology, the period of obtaining homozygotes is shortened, and a method is provided for genetic improvement of economic characters of economic fishes such as the grass carp and the like. The method provides support for molecular mechanism research of fish intermuscular spines, and has important scientific research and industrial application values.

Description

Technical Field

[0001] The invention relates to the technical field of aquatic biological breeding, and in particular to a method for rapidly obtaining genotype homozygous intermuscular thornless grass carp. Background Art

[0002] Intermuscular bone (IB), commonly known as fish bone, is derived from the ossification of the tendon between the diaphragms of bony fish and only exists in lower bony fish. The major freshwater fish farmed in my country contain a certain number of intermuscular bones, especially the economic fish of the Cyprinidae family. The presence of intermuscular bones seriously affects their consumption and deep processing, reducing their economic value. The production of major freshwater fish with intermuscular bones in my country accounts for 74.85% of the total production of freshwater fish farming in the country (China Fisheries Yearbook, 2024). The adverse effects of intermuscular bones on the consumption and processing of fish have made it a trait that has attracted much attention in fish genetic breeding. Therefore, the cultivation of fish without intermuscular bones is of great significance to the high-quality development of the seed industry and industry of major freshwater fish farmed in my country.

[0003] Studies have shown that intermuscular spines in fish have moderate heritability and can be reduced or removed through genetic improvement (Pang et al., 2022; Xiong et al., 2019; Nie et al., 2019). In recent years, researchers have been working on the genetic breeding of intermuscular spines in economic fish and have made significant progress (Wang et al., 2021). Single-cell transcriptome, proteome, whole genome and gene editing revealed that runx2b is a key gene regulating the formation of intermuscular spines in fish, and obtained runx2b with normal growth and development and 100% absence of intermuscular spines. - / - Zebrafish (Nie et al., 2022, related technology patent CN112226465A). Similarly, the runx2b gene was successfully applied to economic fish Megalobrama amblycephala and silver crucian carp (Carassius gibelio) to obtain new germplasm without intermuscular spines (Dong et al., 2023; patent publication number: CN115720874A; Gan et al., 2023; patent publication number: CN115943930A). Xue et al. (2022) used gene editing technology to obtain bmp6 with normal growth and complete lack of intermuscular spines. - / -Zebrafish (related technology patent CN112772468A), and successfully applied in diploid crucian carp, to obtain a new F3 generation strain of carp without intermuscular spines that grows normally (Kuang et al., 2023). At present, the creation of new germplasm of fish without intermuscular spines has only been applied to a small number of economic fish, and the genetic breeding research of important farmed fish such as grass carp (Ctenopharyngodon idella) has not been officially reported.

[0004] Grass carp is the largest herbivorous freshwater farmed fish in my country, with a production of 5.9413 million tons in 2023 (FAO, 2024). However, grass carp has a complex morphology and a certain number of intermuscular spines (about 118), which poses a risk of injury to consumers and limits the further development of its deep processing industry. In addition, grass carp has a long sexual maturity cycle, and it generally takes 4-5 years to reproduce a generation. Gene-edited offspring can generally only obtain homozygous in the F2 generation, which takes 8-10 years.

[0005] Therefore, constructing a method to quickly obtain genotype homozygous grass carp without intermuscular spines has important application value to my country's grass carp breeding and industry. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for quickly obtaining genotype homozygous grass carp without intermuscular spines. The method uses gene editing technology to mutate the runx2b gene of grass carp, the mutation type is a frameshift mutation, and the period for obtaining homozygotes is shortened, thereby cultivating grass carp without intermuscular spines.

[0007] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0008] The present invention provides a method for rapidly obtaining genotype homozygous intermuscular spurless grass carp. The method utilizes CRISPR / Cas9 gene editing technology to microinject a mixture of sgRNA and Cas9 mRNA containing a runx2b specific knockout target site into a fertilized egg of grass carp at the I-cell stage, thereby obtaining F0 generation individuals with mutations, and then screening F0 generation male and female individuals with mutations and the same mutation type for mating to obtain F1 generation. Individuals homozygous for the runx2b allele in the F1 generation are F1 generation intermuscular spurless grass carp.

[0009] Furthermore, the nucleotide sequence of the sgRNA containing the runx2b-specific knockout target site is shown in SEQ ID NO.1.

[0010] Furthermore, the nucleotide sequence of runx2b is shown as SEQ ID NO.2; in the spiny grass carp, the nucleotide sequence of runx2b is shown as SEQ ID NO.3.

[0011] Furthermore, the method comprises the following specific steps:

[0012] 1) According to the CRISPR / Cas9 knockout principle, the target site sgRNA sequence was designed for the seventh exon of the grass carp runx2b gene, that is, the sgRNA containing the runx2b specific knockout target site;

[0013] 2) Perform overlap PCR amplification and purification using the conservative downstream Scaffold primer and the upstream primer with a T7 promoter that specifically contains the target site sgRNA sequence; use the purified PCR product as a template to perform in vitro transcription and purification to obtain sgRNA;

[0014] 3) Using the linearized pT3TS-nCas9n plasmid as a template, Cas9 mRNA was synthesized by in vitro transcription;

[0015] 4) The sgRNA and Cas9 mRNA were mixed and microinjected into the fertilized eggs of grass carp at the I-cell stage, and the F0 generation of grass carp with mutations were cultivated and screened;

[0016] 5) Through genotyping, the male and female F0 generation individuals with effective mutations and the same mutation type are selected for mating to obtain the F1 generation, among which the individuals homozygous for the runx2b allele are grass carp without intermuscular spines.

[0017] Furthermore, the nucleotide sequence of the sgRNA containing the runx2b-specific knockout target site is shown in SEQ ID NO.1.

[0018] Furthermore, in step 4), the final concentration of sgRNA is 100-150 ng / μL, and the final concentration of Cas9 mRNA is 500-800 ng / μL.

[0019] Furthermore, in step 4), the injection time after the egg and sperm are fertilized is no more than 40 minutes.

[0020] Furthermore, in the grass carp without intermuscular spiny grass carp, the nucleotide sequence of runx2b is shown as SEQ ID NO.3.

[0021] Furthermore, in the step 5), the phenotypic observation method for identifying grass carp without intermuscular spines in the F1 generation is: screening using alizarin red bone staining or X-ray imaging.

[0022] Beneficial effects of the present invention:

[0023] After the present invention uses gene editing technology to edit the runx2b gene of grass carp, a new germplasm of grass carp with normal growth and development and homozygous genotype without intermuscular spines can be obtained, shortening the breeding cycle for obtaining homozygotes. The grass carp without intermuscular spines can reproduce normally and expand the population, and the trait of no intermuscular spines can be stably inherited, which effectively solves the problem that the intermuscular spines of grass carp are difficult to remove, and helps the high-quality development of my country's aquaculture seed industry. The method of the present invention provides technical support for gene editing breeding of grass carp, and also provides an important reference for the precise design breeding of economic traits of other farmed fish. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a schematic diagram of the sequence of the target site of the grass carp runx2b gene.

[0025] Figure 2 This is a schematic diagram of the overall and local alizarin red bone staining of wild-type grass carp (30 days after hatching). The arrows indicate intermuscular spines.

[0026] Figure 3 Schematic diagram of overall and local Alizarin red bone staining of mutant grass carp (30 days after hatching).

[0027] Figure 4 This is a schematic diagram of the overall and local CT imaging of wild-type grass carp (90 days after hatching), and the arrows indicate intermuscular spines.

[0028] Figure 5 Schematic diagram of overall and local CT imaging of mutant grass carp (90 days after hatching).

[0029] Figure 6 The peak diagram of sequencing of sequences near the mutation site of runx2b in wild type and mutant grass carp. The red “-” indicates the deletion sequence of runx2b gene in mutant grass carp. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0031] Example 1

[0032] A method for rapidly obtaining genotype homozygous grass carp without intermuscular spines and its application, comprising the following steps:

[0033] 1.1 Experimental Materials

[0034] Wild grass carp male and female parents were raised in Taishan Aquatic Breeding Base of Haida Group in Jiangmen City, Guangdong Province. The fertilized eggs used for grass carp microinjection were obtained from artificial breeding of sexually mature male and female parents.

[0035] 1.2 Experimental methods

[0036] 1.2.1 Design of sgRNA target sites

[0037] The optimal target site of the grass carp runx2b gene was designed and screened on the website (https: / / www.crisprscan.org / ?page=sequence). The sgRNA sequence containing the runx2b specific knockout target site in this example is located in the seventh exon of the grass carp runx2b gene; the sequence of the sgRNA is:

[0038] 5'-GCTCAATCTCCCCACCTTGG-3' (SEQ ID NO. 1).

[0039] 1.2.2 In vitro synthesis of sgRNA

[0040] The conservative downstream primer Scaffold (5'-GATCCGCACCGACTCGGTGCC

[0041] ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTA TTTCTAGCTCTAAAAC–3') and an upstream primer containing the target site sgRNA sequence with a T7 promoter (5'- TAATACGACTCACTATAGGGCTCAATCTTCCC CACCTGTTTTAGAGCTAGAAA-3') was used for overlap PCR amplification. The PCR system was: Primer starMix 10.5μL, Scaffold 5μL, gRNA 5μL, ddH2O4.5μL. The PCR reaction conditions were: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 15s, 45 cycles; 72℃ extension for 5min. Take 2μL of PCR product for 1.5% agarose gel electrophoresis. After the band size was verified to be correct, the PCR product was purified and recovered, and the concentration was detected using an ultra-micro spectrophotometer K5600 (Beijing Kaiao, China). According to the instructions of the Transcriptaid T7 high yield transcription kit (Thermo Scientific, USA), sgRNA was transcribed in vitro and purified and recovered using the lithium chloride precipitation method. The specific steps of the lithium chloride precipitation method are as follows: add 1 μL DNase I to 25 μL sgRNA in vitro transcription system and incubate for 15 min to remove residual template DNA, add 2 μL 0.2 M EDTA to terminate the reaction, then add 2.5 μL 4 M lithium chloride and 75 μL pre-cooled 100% anhydrous ethanol, and precipitate at -20°C for 16 h; collect the precipitate by centrifugation, add 50 μL 70% pre-cooled ethanol to wash the precipitate, centrifuge to remove the ethanol, and add 25 μL DEPC water to dissolve the precipitate. Take 1 μL to detect the sgRNA concentration, and after detecting the sgRNA quality by 1.5% agarose gel electrophoresis, store it in a -80°C refrigerator for use.

[0042] 1.2.3 In vitro transcription of Cas9 mRNA

[0043] The pT3TS-nCas9n plasmid was linearized using the restriction endonuclease XbaI (NEB, USA), and after confirmation of complete linearization by 1% agarose gel electrophoresis, it was recovered using the Hipure Gel Pure DNA Mini Kit (Magen, China) agarose gel DNA recovery kit. According to the instructions of T3mMESSAGE mMACHINE (Invitrogen, USA), Cas9 mRNA was transcribed in vitro, purified and recovered using the lithium chloride precipitation method, and after being fully dissolved in enzyme-free water, the concentration was detected using an ultra-micro spectrophotometer K5600 (Beijing Kaiao, China), and after passing the 1.5% agarose gel electrophoresis test, the devices were stored at -80°C for later use.

[0044] 1.2.4 Microinjection

[0045] Before microinjection, male and female grass carps were separated in proportion and placed in the same cement pool with a certain flow rate (0.3m / s) for water stimulation. In the afternoon, female fish were injected with the first injection of luteinizing hormone releasing hormone A2 (0.71μg / kg), with a needle interval of about 12h (the water temperature was generally 23-28℃, and the time was shortened or extended appropriately according to the water temperature). Then the second injection (luteinizing hormone releasing hormone A2 (2.08μg / kg) + dioxin maleate (1.67μg / kg)) was injected. Male fish were not injected with the first injection, and the second injection was half of the injection amount of female fish. The effect time after injection of oxytocin is generally 6h (the effect time is closely related to the water temperature, and the time is appropriately extended according to the water temperature). Grass carp is generally suitable for reproduction at night. Then the eggs of female grass carp were manually stripped into a dry centrifuge tube, and the sperm of male fish were manually stripped into a centrifuge tube containing 50mL Hank's solution (1:3 dilution) for in vitro fertilization. Microinjection started 5 minutes after artificial insemination. The injection system was prepared by mixing sgRNA and Cas9 mRNA, in which the final concentration of sgRNA was 100-150ng / μL, and the final concentration of Cas9 mRNA was 500-800ng / μL. The experimental mixed sample was injected into the fertilized eggs of grass carp at the I-cell stage and spread in a culture dish using a Picoliter Microinjector (Warner, PL-100A, USA). The injection time was controlled to be completed within 40 minutes after the fertilization of the eggs (water temperature was 23-28°C). 1000-2000 fertilized eggs can be injected with each 5μL mixed reagent. After the injection is completed, the fertilized eggs are incubated in oxygenated water at a water temperature of 23-28°C.

[0046] 1.2.5 Screening of mutant individuals in the F0 generation of grass carp

[0047] Extract the genomic DNA of the fin rays of the grass carp individuals that survived in 1.2.4, and amplify the target site and the gene sequence near it using the target detection primers (runx2b-F: 5'-GTCATAGCACGATGGAGGCA-3'; runx2b-R: 5'-GTCATAGCACGATGGAGGCA-3', fragment size 326bp); wherein the PCR reaction system is: Master Mix (Yisheng, Shanghai) 10 μL, upstream and downstream primers 0.5 μL each, genomic DNA template 2 μL, sterile water 7 μL. PCR reaction conditions are: 94℃ pre-denaturation 5min; 94℃ denaturation 30s, 54℃ annealing 30s, 72℃ extension 30s, 35 cycles; 72℃ extension 5min. After amplification, 10 μL of PCR product was taken for 2.5% agarose gel electrophoresis, and the individuals with non-single bands or non-single peaks in the target site sequencing results were detected and screened, which were the F0 generation individuals of grass carp with mutations.

[0048] 1.2.6 Genotyping of F0 generation

[0049] The F0 generation with effective mutations was screened and injected with electronic chips, and the PCR amplification products were connected to the pCE2 TA / Bront Zero vector (Novozymes, Nanjing, C601-02), and then transformed into Escherichia coli DH5α competent cells (Qingke, Beijing, TSC-01). The single colony was further expanded and cultured, and the bacterial liquid was further amplified by PCR, and then analyzed by Sanger sequencing to verify the mutation type caused by the insertion or deletion of the gene sequence compared with the wild-type fish, providing data reference for subsequent male-female pairing breeding.

[0050] 1.2.7 Analysis of phenotype and genotype of intermuscular spines in F1 mutant grass carp

[0051] When the F0 generation mutant grass carp reaches sexual maturity, the male and female individuals with the same gene mutation type are mated to obtain the F1 generation grass carp population.

[0052] In order to observe the intermuscular spine phenotype of grass carp F1 mutant, the intermuscular spine phenotype of grass carp was observed by alizarin red whole bone staining method, and the specific steps were as follows: after 30 days of incubation, F1 mutant grass carp were randomly selected, fixed in 4% paraformaldehyde for 48 hours, and then rinsed in ddH2O water for 2-3 hours; then bleached in a mixed solution of 3% H2O2 and 1% KOH in equal volumes for 4 hours; rinsed in ddH2O for 30 minutes; treated in 30% saturated borax solution for 12 hours; rinsed in ddH2O for 30 minutes; dyed in a mixed solution of 1% Alizarin Red S (Sigma, 1g Alizarin Red powder dissolved in 1% KOH solution) and 1% KOH for 12 hours; washed the excess Alizarin Red dye in 1% KOH solution; rinsed in a mixed solution of 1% trypsin (Solarbio) and 2% saturated borax for 3-5 days to remove impurities; gradient transparent in 50%, 100% glycerol and stored. The results showed that among the 30 grass carps, 10 of them had completely lost their intermuscular spines, with a mutation rate of 33.3%. The wild-type grass carp has a significant number of intermuscular spines, and its overall and local skeletal phenotypes are as follows: Figure 2 The overall and local skeletal phenotypes of the runx2b mutant grass carp without intermuscular spines are shown in Figure 3 shown.

[0053] When the F1 generation runx2b gene mutant grass carp was cultivated to 90dph (about 50-100g), a portable X-ray imager was used to perform a live rapid scan of the intermuscular spines phenotype of all F1 generation mutant grass carp. Among the 8447 F1 generation mutants, 1678 mutant grass carp were found to completely lack intermuscular spines, accounting for 19.79% of the grass carp without intermuscular spines, and the homozygous genotype accounted for 20-25% of the population without intermuscular spines. The overall and local skeleton X-ray scans of wild-type grass carp (including intermuscular spines) are shown in the figure below. Figure 4 As shown, the whole and local skeleton X-ray scans of the runx2b mutant grass carp (without intermuscular spines) are shown in Figure 5 shown.

[0054] The F1 genotype of the runx2b mutation was then analyzed in detail. After extracting the genomic DNA of the F1 generation individuals without intermuscular spines, PCR amplification and product sequencing were performed using target detection primers. The runx2b gene sequence of the F1 generation mutant individuals obtained by sequencing was compared with the runx2b gene sequence of the wild-type grass carp, and it was found that the runx2b alleles of the grass carp without intermuscular spines had frameshift mutations (runx2b -4 / -4 ;runx2b -5 / -5 ) to obtain individuals with homozygous genotypes. Comparison results of target site gene sequences between wild-type grass carp and F1 mutant grass carp Figure 6 As shown, the results of genotype and phenotypic analysis of the F1 generation mutants revealed that the runx2b gene is necessary for the formation of intermuscular spines in grass carp. At the same time, the destruction of the runx2b allele can lead to the complete absence of intermuscular spines and create grass carp mutants without intermuscular spines.

[0055] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A method for rapidly obtaining genotype homozygous grass carp without intermuscular spines, characterized in that: This method uses CRISPR / Cas9 gene editing technology to microinject a mixture of sgRNA and Cas9 mRNA containing a runx2b-specific knockout target site into the fertilized eggs of grass carp in the I-cell stage to obtain F0 generation individuals with mutations. After that, the F0 generation male and female individuals with mutations and the same mutation type are screened for mating to obtain the F1 generation. The individuals in the F1 generation that are homozygous for the runx2b allele are the F1 generation grass carp without intermuscular spines.

2. The method according to claim 1, characterized in that: The nucleotide sequence of the sgRNA containing the runx2b-specific knockout target site is shown in SEQ ID NO.

1.

3. The method according to claim 2, characterized in that: The nucleotide sequence of runx2b is shown in SEQ ID NO.2; in the spiny grass carp, the nucleotide sequence of runx2b is shown in SEQ ID NO.

3.

4. The method according to claim 1, characterized in that: The specific steps of the method are as follows: 1) According to the CRISPR / Cas9 knockout principle, the target site sgRNA sequence was designed for the seventh exon of the grass carp runx2b gene, that is, the sgRNA containing the runx2b specific knockout target site; 2) Perform overlap PCR amplification and purification using the conservative downstream Scaffold primer and the upstream primer with T7 promoter specificity containing the target site sgRNA sequence; use the above purified PCR product as a template, transcribe and purify in vitro to obtain sgRNA; 3) Using the linearized pT3TS-nCas9n plasmid as a template, Cas9 mRNA was synthesized by in vitro transcription; 4) The sgRNA and Cas9 mRNA were mixed and microinjected into the fertilized eggs of grass carp at the I-cell stage, and the F0 generation of grass carp with mutations were cultivated and screened; 5) Through genotyping, the male and female F0 generation individuals with effective mutations and the same mutation type are selected for mating to obtain the F1 generation, among which the individuals homozygous for the runx2b allele are grass carp without intermuscular spines.

5. The method according to claim 4, characterized in that: The nucleotide sequence of the sgRNA containing the runx2b-specific knockout target site is shown in SEQ ID NO.

1.

6. The method according to claim 4 or 5, characterized in that: In step 4), the final concentration of sgRNA is 100-150 ng / μL, and the final concentration of Cas9 mRNA is 500-800 ng / μL.

7. The method according to claim 6, characterized in that: In step 4), the injection time after the egg and sperm are fertilized is no more than 40 minutes.

8. The method according to claim 4, characterized in that: In the abscissorhynchus mykiss, the nucleotide sequence of runx2b is shown in SEQ ID NO.

3.

9. The method according to claim 4, characterized in that: In the step 5), the phenotypic observation method for identifying grass carp without intermuscular spines in the F1 generation is: screening using alizarin red bone staining or X-ray imaging.

Images