Method for preparing long single-stranded DNA
Through the steps of synthesis, phosphorus sulfation modification and Lambda exonuclease digestion in laboratories or enterprises, the problem of difficulty in preparing long single-strand DNA on a large scale and low cost in the prior art is solved, and efficient and economical preparation of high-purity LssDNA is achieved.
Patent Information
- Application Number
- CN202410821777.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-24
- Publication Date
- 2025-03-07
AI Technical Summary
The prior art is difficult to prepare long single-stranded DNA (LssDNA) at a large scale, low cost, high purity, high yield and high reproducibility in laboratories or enterprises.
By synthesizing the target gene into the plasmid vector, phosphothionization modification was performed, digested with Lambda exonuclease, and purified by agarose gel electrophoresis and gel cutting to obtain high-purity long single-strand DNA.
A low-cost and high-efficiency large-scale preparation of long single-strand DNA is achieved, which reduces experimental costs, improves experimental efficiency, and obtains high-purity products.
Smart Images
Figure CN119570879A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology and relates to a method for preparing long single-chain DNA. Background Art
[0002] In recent years, the ability of the CRISPR-Cas9 system to achieve precise and sequence-specific genome editing has revolutionized genome engineering, with the ability of the CRISPR-Cas9 system to edit the genome of almost any organism having unprecedented potential. In the CRISPR-Cas9 system, Cas9 mediates the cleavage of the target DNA upstream of the PAM, generating a double-strand break (DSB). The DSB is then repaired by either non-homologous end joining (NHEJ) or homology-directed repair (HDR) pathways. NHEJ is the predominant repair pathway in higher eukaryotic cells, but this repair mechanism is imprecise and often results in destructive insertions and deletions (indels) at the target site. In contrast, the HDR pathway, which is much less efficient than NHEJ, is a more precise mechanism.
[0003] The HDR pathway requires DNA as a template, which can be in the form of sister chromatids (naturally present in the S and G2 phases of the cell cycle) or exogenous artificial DNA. In 2015, Miura et al. first reported a chemically synthesized oligonucleotide with a larger long single-stranded DNA (LssDNA) molecule as an effective alternative donor template for RGEN-assisted homologous recombination (HDR) (Miura H, Gurumurthy CB, Sato T, Sato M, Ohtsuka M. CRISPR / Cas9-based generation of knockdown mice by intronic insertion of artificial microRNA using longer single-stranded DNA. Sci Rep. 2015; 5: 12799. doi: 10.1038 / srep12799.). With the development of research, the use of long single-stranded DNA (LssDNA) as a donor DNA template has been shown to be more effective in HDR-based genome editing due to its lower cytotoxicity and higher integration specificity.
[0004] At present, the main ways to prepare single-stranded LssDNA in vitro include chemical synthesis, Lambda exonuclease digestion and phosphorylation of single strands, transcription-reverse transcription-RNase H digestion coupling reaction, etc. These methods can effectively obtain high-purity LssDNA, however, the above methods are relatively expensive and not suitable for large-scale preparation, and the length of LssDNA products of some methods is obviously limited.
[0005] Therefore, there is an urgent need for a method for preparing long single-stranded DNA (LssDNA) on a large scale, at low cost, with high purity, high yield, and high reproducibility, which is suitable for laboratories or enterprises. Summary of the invention
[0006] In order to solve the above problems of the prior art, the purpose of the present invention is to provide a method for preparing long single-stranded DNA, which can be suitable for large-scale, low-cost, high-purity, high-yield and high-reproducibility preparation of long single-stranded DNA in laboratories or enterprises.
[0007] The purpose of the present invention can be achieved through the following technical solutions:
[0008] A method for preparing long single-stranded DNA comprises the following steps:
[0009] (1) Synthesize the target gene into a plasmid vector to obtain the target double-stranded DNA;
[0010] (2) obtaining a phosphothioate-modified double-stranded DNA by phosphothioate-modifying the target double-stranded DNA;
[0011] (3) digesting the phosphorothioate-modified double-stranded DNA with Lambda exonuclease to obtain a long single-stranded DNA to be purified;
[0012] (4) Purifying the long single-stranded DNA to be purified by agarose gel electrophoresis and gel excision recovery to obtain the target long single-stranded DNA.
[0013] Furthermore, the synthesizing the target gene into a plasmid vector to obtain the target double-stranded DNA includes PCR amplification of the target fragment to obtain the target double-stranded DNA, or:
[0014] Single digestion with restriction endonuclease I or double digestion with restriction endonuclease I and restriction endonuclease II to obtain the target fragment and obtain the target double-stranded DNA, or:
[0015] The target fragment is chemically synthesized to obtain the target double-stranded DNA.
[0016] Furthermore, the amplification system in the PCR amplification of the target fragment is: 25 μL of DNA polymerase, 0.5-2 μL of upstream primer, 0.5-2 μL of downstream primer, 0.5-1 μL of template DNA, and 20-23.5 μL of ddH2O.
[0017] Furthermore, the reaction program of the PCR amplification target fragment is: after pre-denaturation at 92-98°C for 3 minutes, the program is set to 92-98°C for 15 seconds to denature to obtain a denatured product, after obtaining the denatured product, the temperature is lowered to 55-65°C for 15 seconds for annealing, and then maintained at 72°C for 30 seconds for extension, to synthesize a double-stranded DNA of the target fragment to complete a set of cycles;
[0018] The cycle was repeated 35 times, the temperature was maintained at 72°C for 3 min, and finally stored at 4°C.
[0019] Furthermore, in the target fragment obtained by single digestion with restriction endonuclease I or double digestion with restriction endonuclease I and restriction endonuclease II of the existing plasmid, the digestion temperature is 36.5-37.5°C; the digestion time is 4-8h; the working concentration of the restriction endonuclease I is 0.5-1U / μL; the working concentration of the restriction endonuclease II is 0.5-1U / μL.
[0020] Furthermore, the chemically synthesized target fragment comprises:
[0021] The target gene fragment is connected to the plasmid vector using SLIC ligase to synthesize the target gene into the plasmid vector; the plasmid vector is a linearized plasmid vector.
[0022] Furthermore, the first 2-5 bases at the 5' end of one of the DNA strands of the phosphothioate-modified double-stranded DNA in step (2) contain phosphate backbone thioate modification.
[0023] Furthermore, the step of modifying the target double-stranded DNA by phosphothioate to obtain the phosphothioate-modified double-stranded DNA comprises:
[0024] Synthesize a target primer with a thiolation modification on one end and no modification on the other end;
[0025] A double-stranded DNA fragment carrying the phosphothioate modification is obtained by PCR reaction with the target primer; the double-stranded DNA fragment carrying the phosphothioate modification is purified by agarose gel electrophoresis to a single clear band without impurities, and a gel recovery kit is used to purify and recover the double-stranded DNA target fragment carrying the phosphothioate modification, and the amount of the double-stranded DNA target fragment carrying the phosphothioate modification is ≥20 μg.
[0026] Furthermore, the method of digesting the phosphorothioate-modified double-stranded DNA with Lambda exonuclease to obtain the long single-stranded DNA to be purified includes: mixing the Lambda exonuclease system and placing the mixture in a 37° C. water bath for reaction for 12-18 hours.
[0027] Furthermore, the long single-stranded DNA to be purified is purified by agarose gel electrophoresis and gel excision recovery to obtain the target long single-stranded DNA, the concentration of the target long single-stranded DNA is ≥100 ng / μL and the volume is ≥10 μL, and 1.0-2.0 μL of the long single-stranded DNA and the template are taken for QC by electrophoresis, and the target band size of the target long single-stranded DNA is correct and clear without diffusion.
[0028] Beneficial effects:
[0029] 1. Phosphothioate-modified DNA can act as an antioxidant to protect DNA from oxidative damage. At the same time, the DNA phosphothioate restriction system has a special protection mechanism that can maintain the stability of its own genome. The present invention utilizes the characteristics of phosphothioate-modified DNA to innovate the existing technology of preparing LssDNA by digesting phosphorylated double-stranded DNA with Lambda exonuclease. The principle is changed from Lambda exonuclease digesting phosphorylated single strands to Lambda exonuclease digesting single strands that are not protected by phosphothioate modification.
[0030] 2. According to the market price of a single primer phosphothioate modification of about 10 yuan, and the price of a single primer phosphorylation modification of about 30 yuan, the cost of the double-stranded DNA synthesis step can be greatly reduced, and it has high economic applicability.
[0031] 3. The present invention can adopt the method of overnight digestion, which improves the overall utilization rate of experimental time, effectively improves efficiency and reduces experimental costs;
[0032] 4. In the present invention, agarose gel electrophoresis and gel excision recovery are used to purify LssDNA to obtain high-purity LssDNA, which can effectively avoid the influence of residual double-stranded template DNA on subsequent experiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 The agarose gel electrophoresis diagram of the original dsDNA in Example 1 and the LssDNA prepared by digestion with Lambda exonuclease;
[0034] Figure 2 The agarose gel electrophoresis diagram of the LssDNA prepared by digestion with Lambda exonuclease in Example 1 and the dsDNA re-prepared by PCR reaction using the LssDNA as a template;
[0035] Figure 3 This is a sequencing verification diagram of the theoretical sequence and the sequencing spliced sequence in Example 1;
[0036] Figure 4The agarose gel electrophoresis diagram of the LssDNA prepared for the original dsDNA and the LssDNA digested with Lambda exonuclease in Example 2;
[0037] Figure 5 This is an agarose gel electrophoresis diagram of the LssDNA prepared by digestion with Lambda exonuclease in Example 2 and the dsDNA re-prepared by PCR reaction using LssDNA as a template;
[0038] Figure 6 This is a sequencing verification diagram of the theoretical sequence and the sequencing spliced sequence in Example 2;
[0039] Figure 7 The agarose gel electrophoresis diagram of LssDNA prepared for the original dsDNA and the LssDNA digested with Lambda exonuclease in Example 3.
[0040] Figure 8 This is an agarose gel electrophoresis diagram of the LssDNA prepared by digestion with Lambda exonuclease in Example 3 and the dsDNA re-prepared by PCR reaction using LssDNA as a template.
[0041] Fig. 9 This is a sequencing verification diagram of the theoretical sequence and the sequencing spliced sequence in Example 3. DETAILED DESCRIPTION
[0042] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.
[0043] In the following examples, the reagents and consumables used include: high-fidelity PCR kit, gel recovery kit, SLIC ligase, LB culture solution and culture medium, Lambda Exonuclease, agarose;
[0044] The instruments used include: PCR instrument, constant temperature shaker, constant temperature incubator, nucleic acid electrophoresis instrument, and gel imager.
[0045] Example 1: This example provides a method for preparing long single-stranded DNA, comprising the following steps:
[0046] (1) Synthesize the target gene into a plasmid vector to obtain the target double-stranded DNA;
[0047] (2) obtaining phosphothioate-modified double-stranded DNA based on phosphothioate-modified target double-stranded DNA;
[0048] (3) digesting the phosphorothioate-modified double-stranded DNA with Lambda exonuclease to obtain the long single-stranded DNA to be purified;
[0049] (4) Purifying the long single-stranded DNA to be purified by agarose gel electrophoresis and gel excision recovery to obtain the target long single-stranded DNA.
[0050] Specifically, Lambda exonuclease was used to digest double-stranded DNA, specifically to digest single-stranded DNA that was not protected by phosphothioate modification, to obtain LssDNA containing the EGFP-WPRE-pA element, and PCR amplification was performed using LssDNA as a template to re-obtain dsDNA (double strand DNA), and sequencing verification was performed at the same time, and the obtained dsDNA sequence was consistent with the theoretical sequence.
[0051] 1. Obtaining target double-stranded DNA:
[0052] In this embodiment, the target gene is synthesized into a plasmid vector to obtain a target double-stranded DNA, and the target fragment is amplified by PCR to obtain the target double-stranded DNA, wherein the amplification system in the PCR amplification of the target fragment is: DNA polymerase 25 μL, upstream primer 0.5-2 μL, downstream primer 0.5-2 μL, template DNA 0.5-1 μL, ddH2O20-23.5 μL.
[0053] Preferably, the DNA polymerase is 2×Phanta Max Master Mix, the upstream primer is 1 μL of a forward primer modified with phosphate backbone thiolation (sulfo) (C*t*gggtggagccactgccttat), the downstream primer is 1 μL of a common reverse primer (GCACACAAACAGGACAGCAC), the template DN is 1 μL of a plasmid containing the EGFP-WPRE-pA element, 2 μL of ddH2O2, and the amplification system in the PCR amplification target fragment is a total of 50 μL.
[0054] Of course, other types of DNA polymerase may be selected, and the amounts of the upstream primer, downstream primer, template DNA and ddH2O may be any values within the specified range.
[0055] The reaction program in PCR amplification of the target fragment is: 92-98°C for 3 minutes for pre-denaturation, and then the program is set to 92-98°C for 15 seconds for denaturation to obtain the denatured product;
[0056] After obtaining the denatured product, the temperature is lowered to 55-65°C and maintained for 15 seconds for annealing, and then maintained at 72°C for 30 seconds for extension to synthesize the double-stranded DNA of the target fragment to complete a set of cycles;
[0057] The above cycle was repeated 35 times, the temperature was maintained at 72°C for 3 min, and finally the target double-stranded DNA was stored at 4°C.
[0058] In addition, the target fragment can be obtained by single digestion with restriction endonuclease I or double digestion with restriction endonuclease I and restriction endonuclease II, or the target double-stranded DNA can be obtained by chemically synthesizing the target fragment. When the target fragment is obtained by single digestion with restriction endonuclease I or double digestion with restriction endonuclease I and restriction endonuclease II, the digestion temperature is 36.5-37.5°C; the digestion time is 4-8h; the working concentration of restriction endonuclease I is 0.5-1U / μL; the working concentration of restriction endonuclease II is 0.5-1U / μL. When the target double-stranded DNA is obtained by chemically synthesizing the target fragment, the target gene fragment is connected to the plasmid vector using SLIC ligase to synthesize the target gene into the plasmid vector; the plasmid vector is a linearized plasmid vector.
[0059] 2. Obtaining phosphorylated double-stranded DNA:
[0060] Synthesize a target primer with a thiolation modification on one end and no modification on the other end;
[0061] The double-stranded DNA fragments carrying the phosphorothioate modification are obtained by PCR reaction with the target primers;
[0062] The double-stranded DNA fragment carrying the phosphothioate modification was purified by agarose gel electrophoresis to a single clear band without impurities, and the double-stranded DNA target fragment carrying the phosphothioate modification was purified and recovered using a gel recovery kit. The amount of the double-stranded DNA target fragment carrying the phosphothioate modification was ≥20 μg.
[0063] Exemplarily, the denatured product is obtained by pre-denaturation at 95°C for 3 minutes, and after obtaining the denatured product, the program is set to 95°C for 15 seconds for denaturation, and then the temperature is lowered to 58°C for 15 seconds for annealing, and then maintained at 72°C for 30 seconds for extension, synthesizing the phosphate backbone thiolated (sulfo) modified double-stranded DNA, i.e., the target fragment double-stranded DNA, to complete a set of cycles, repeat the cycle 35 times, maintain the temperature at 72°C for 3 minutes, and finally store at 4°C. The first 2 or 3 or 4 or 5 bases at the 5' end of one of the DNA chains of the phosphothioated double-stranded DNA contain phosphate backbone thiolated modification. Preferably, the first 2 bases at the 5' end of one of the DNA chains of the phosphothioated double-stranded DNA contain phosphate backbone thiolated modification.
[0064] Agarose gel electrophoresis requires a single clear band without impurities, and the Takara gel recovery kit is used to purify and recover the target thiolated double-stranded DNA fragment, with a required amount of 20 μg or more.
[0065] First, cut the target band and put it into a clean 10mL centrifuge tube (self-prepared), and weigh it; secondly, add Sol Buffer at a ratio of 1:3 (gel mass in milligrams: melt volume in microliters), and shake gently at room temperature until the gel is completely dissolved; then add 1 / 3 gel volume of isopropanol, mix well and pass through the column at 10000rpm for 1min, and discard the waste liquid; then add 500μL Sol Buffer, 10000rpm for 1min, and discard the waste liquid; then wash twice with 600μL Wash Buffer at 10000rpm for 1min; finally, centrifuge at 12000rpm for 2min, then transfer the column to a sterile 1.5mL centrifuge tube, dry at room temperature for 10min, and add 20μL TE preheated at 70℃ for elution.
[0066] 3. Obtaining LssDNA to be purified:
[0067] The phosphothioate-modified double-stranded DNA was digested with Lambda exonuclease. The reaction system was: Lambda exonuclease Reaction Buffer 20 μL, dsDNA template 20 μg, Lambda Exonuclease 12 μL, and ddH2O was added to 200 μL.
[0068] Reaction system steps: Place in a 37°C water bath for overnight reaction (about 16 hours), take 5 μL of the product after the reaction is completed for pre-running, and add 1 μL of template as a control for electrophoresis to observe whether the double-stranded DNA is completely digested. The electrophoresis parameters are 150V and the electrophoresis time is 25 minutes.
[0069] 4. Target long single-stranded DNA:
[0070] Purification of LssDNA: All denatured products were subjected to electrophoresis at 150V for 30min, and the target band was cut according to the template size and recovered using the Takara gel recovery kit. The final recovered LssDNA concentration was ≥100ng / μL and the volume was ≥10μL.
[0071] Electrophoresis detection of LssDNA: Take 1 μL of LssDNA and template for electrophoresis at 150V for 30min. If the target band is of the correct size and clear without diffusion, it is considered a qualified sample. Figure 1 shown.
[0072] 5. Obtain dsDNA using target LssDNA as template
[0073] PCR amplification system: 2×Phanta Max Master Mix 25μL, common forward primer 1μL, common reverse primer 1μL, template LssDNA 1μL, ddH2O 22μL, a total of 50μL.
[0074] Primer sequences:
[0075] F is shown in SEQ ID NO.1: CTGGGTGGAGCCACTGCCTTAT
[0076] R is shown in SEQ ID NO.2: GCACACAAACAGGACAGCAC
[0077] PCR reaction program: first maintain at 95°C for 3 minutes for pre-denaturation, then set the program to maintain at 95°C for 15 seconds for denaturation, then lower the temperature to 58°C for 15 seconds for annealing, and then maintain at 72°C for 30 seconds for extension to synthesize double-stranded DNA to complete a set of cycles, repeat the cycle 35 times, maintain at 72°C for 3 minutes, and finally store at 4°C.
[0078] Electrophoresis detection: Take 1 μL of LssDNA template and dsDNA for electrophoresis at 150V for 30min. Figure 2 shown.
[0079] Sequencing verification: Theoretical sequence and sequencing splicing sequence Figure 3 shown.
[0080] Example 2: The difference between this example and Example 1 is that in this example, Lambda exonuclease is used to digest double-stranded DNA, specifically to digest single-stranded DNA that is not protected by phosphothioate modification, to obtain LssDNA containing the P2A-CreERT2 element, and dsDNA is obtained by PCR amplification using LssDNA as a template, and sequencing is performed to verify that the obtained dsDNA sequence is consistent with the theoretical sequence. The results of agarose gel electrophoresis of the original dsDNA used in this example and the LssDNA prepared by digestion with Lambda exonuclease are as follows: Figure 4 As shown, the agarose gel electrophoresis results of LssDNA prepared by digestion with Lambda exonuclease and dsDNA re-prepared by PCR reaction using LssDNA as a template are shown in Figure 5 shown.
[0081] Primer sequences:
[0082] F is shown in SEQ ID NO. 3: CAGCAGGCTTGGTTTTCCTG;
[0083] R is shown in SEQ ID NO.4: TTTGCAGCTGGTGAGAAGGC
[0084] Sequencing verification: Theoretical sequence and sequencing splicing sequence Figure 6 shown.
[0085] Example 3: The difference between this example and Example 1 is that in this example, Lambda exonuclease is used to digest double-stranded DNA, specifically to digest single-stranded DNA that is not protected by phosphothioate modification, to obtain LssDNA containing the DreERT2-P2A element, and dsDNA is obtained by PCR amplification using LssDNA as a template, and sequencing is performed to verify that the obtained dsDNA sequence is consistent with the theoretical sequence. The agarose gel electrophoresis structure of the original dsDNA and the LssDNA prepared by digestion with Lambda exonuclease in this example is shown in FIG. Figure 7 As shown, the agarose gel electrophoresis results of LssDNA prepared by digestion with Lambda exonuclease and dsDNA re-prepared by PCR reaction using LssDNA as a template are shown in Figure 8 shown.
[0086] Primer sequences:
[0087] F is shown in SEQ ID NO.5: CGTTTGCTCATGTCTGTCTTTC
[0088] R is shown in SEQ ID NO.6: CACTGTGCAGCCAAGGAAGT
[0089] Sequencing verification: Theoretical sequence and sequencing splicing sequence Fig. 9 shown.
[0090] As shown in the agarose gel electrophoresis gel images of Examples 1, 2 and 3, Lambda exonuclease was used to digest double-stranded DNA, specifically to digest single-stranded DNA that was not protected by phosphothioate modification, to obtain a qualified LssDNA sample, and PCR amplification was performed using LssDNA as a template to re-obtain dsDNA, and sequencing verification was performed at the same time, and the obtained dsDNA sequence was consistent with the theoretical sequence.
[0091] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.
Claims
1. A method for preparing long single-stranded DNA, characterized in that: The following steps are involved: (1) Synthesize the target gene into a plasmid vector to obtain the target double-stranded DNA; (2) obtaining a phosphothioate-modified double-stranded DNA by phosphothioate-modifying the target double-stranded DNA; (3) digesting the phosphorothioate-modified double-stranded DNA with Lambda exonuclease to obtain a long single-stranded DNA to be purified; (4) Purifying the long single-stranded DNA to be purified by agarose gel electrophoresis and gel excision to obtain the target long single-stranded DNA.
2. The method for preparing long single-stranded DNA according to claim 1, characterized in that: The synthesis of the target gene into a plasmid vector to obtain the target double-stranded DNA comprises: PCR amplification of the target fragment to obtain the target double-stranded DNA, or: Single digestion with restriction endonuclease I or double digestion with restriction endonuclease I and restriction endonuclease II to obtain the target fragment and obtain the target double-stranded DNA, or: The target fragment is chemically synthesized to obtain the target double-stranded DNA.
3. The method for preparing long single-stranded DNA according to claim 2, characterized in that: The amplification system in the PCR amplification of the target fragment is: 25 μL of DNA polymerase, 0.5-2 μL of upstream primer, 0.5-2 μL of downstream primer, 0.5-1 μL of template DNA, and 20-23.5 μL of ddH2O.
4. The method for preparing long single-stranded DNA according to claim 2 or 3, characterized in that: The reaction procedure of the PCR amplification target fragment is: maintaining at 92-98°C for 3 minutes for pre-denaturation, and then setting the program to maintain at 92-98°C for 15 seconds for denaturation to obtain a denatured product; After obtaining the denatured product, the temperature is lowered to 55-65° C. and maintained for 15 seconds for annealing, and then maintained at 72° C. for 30 seconds for extension to synthesize the double-stranded DNA of the target fragment to complete a set of cycles; The cycle was repeated 35 times, the temperature was maintained at 72°C for 3 min, and finally stored at 4°C.
5. The method for preparing long single-stranded DNA according to claim 4, characterized in that: In the process of obtaining the target fragment by single digestion with restriction endonuclease I or double digestion with restriction endonuclease I and restriction endonuclease II, the digestion temperature is 36.5-37.5° C.; the digestion time is 4-8 hours; the working concentration of restriction endonuclease I is 0.5-1 U / μL; and the working concentration of restriction endonuclease II is 0.5-1 U / μL.
6. The method for preparing long single-stranded DNA according to claim 2, characterized in that: The chemical synthesis fragments include: The target gene fragment is connected to the plasmid vector using SLIC ligase to synthesize the target gene into the plasmid vector; the plasmid vector is a linearized plasmid vector.
7. The method for preparing long single-stranded DNA according to claim 1, characterized in that: The first 2-5 bases at the 5' end of one of the DNA strands of the phosphorothioate-modified double-stranded DNA in (2) contain phosphate backbone thioate modification.
8. The method for preparing long single-stranded DNA according to claim 7, characterized in that: The method of obtaining phosphorothioate-modified double-stranded DNA by phosphorothioate-modifying the target double-stranded DNA comprises: Synthesize a target primer with a thiolation modification on one end and no modification on the other end; Obtaining a double-stranded DNA fragment carrying phosphorothioate modification through PCR reaction with the target primer; The double-stranded DNA fragment carrying the phosphorothioate modification is purified by agarose gel electrophoresis to a single clear band without impurities, and the double-stranded DNA target fragment carrying the phosphorothioate modification is purified and recovered using a gel recovery kit, and the amount of the double-stranded DNA target fragment carrying the phosphorothioate modification is ≥20 μg.
9. The method for preparing long single-stranded DNA according to claim 1, characterized in that: The method of digesting the phosphorothioate-modified double-stranded DNA with Lambda exonuclease to obtain the long single-stranded DNA to be purified includes: mixing the Lambda exonuclease system and placing the mixture in a 37° C. water bath for reaction for 12-18 hours.
10. The method for preparing long single-stranded DNA according to claim 1, characterized in that: The long single-stranded DNA to be purified is purified by agarose gel electrophoresis and gel excision recovery to obtain the target long single-stranded DNA, wherein the concentration of the target long single-stranded DNA is ≥100 ng / μL and the volume is ≥10 μL, and 1.0-2.0 μL of the long single-stranded DNA and the template are taken for QC by electrophoresis, and the target band size of the target long single-stranded DNA is correct and clear without diffusion.